CN104328125A - Epidermal hair and cotton fiber specific promoter PLTP and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering and relates to an epidermal hair and cotton fiber specific promoter PLTP and an application thereof. A technical problem to be solved in the invention is to provide a new choice for improving the cotton variety. A technical scheme adopted by the invention is that the epidermal hair and cotton fiber specific promoter PLTP has a nucleotide sequence as shown in SEQ ID No.1. The invention further provides an expression vector containing the promoter PLTP. The invention further provides a host containing the vector. The invention further provides the application of the promoter PLTP to obtaining transgenic plants. The promoter disclosed by the invention can be used for improving the quality of tobaccos and cottons as well as improving the quality of the cotton fibers.

Description

Epidermal hair and cotton fiber specific promoter PLTP and application thereof

Technical field

The invention belongs to field of plant genetic, relate to epidermal hair and cotton fiber specific promoter and application thereof.

Background technology

Epidermal hair, by plant epidermis cell development, is distributed widely in terrestrial plant, is a kind of specialised structure of growth at plant epidermis tissue.Its form is varied, by a cell or multiple cellularity; Have and produce branch, also have unbranched; What have has body of gland, can secrete alkaloid (as Nicotine, terpenoid etc.), the then Non-gland body (Gao Ying etc., Botany Gazette 2011,46 (1): 119 – 127) had.Epidermal hair, except having increase skin layer thickness, reduces outside the function of heat and moisture loss, can also protective plant from insect and pathogenic agent infringement and reduce physical abuse and ultraviolet light harms etc. (Szymanski et al., 2000).In addition, the epidermal hair of Chinese Ferns Herba pteridis vittatae (Pterisvittata) also has the ability of high absorption heavy metal chemical element, this has important enlightenment effect (Li et al., 2005) to the exploitation of the Initiative Defense and new defensive measure that improve heavy metal pollution of soil undoubtedly.

From phytological angle, cotton fiber is also a kind of epidermal hair of growth on seed coat.Cotton fiber is important textile industry raw material, and China is cotton textiles consumption and big export country, and therefore, Cotton Production occupies an important position in Chinese national economy, is also simultaneously the important source of finance of peasant.The fibrous quality of Cotton in China kind can be improved rapidly, be directly connected to the survival and development of the industry such as the ups and downs and textile production processing, Weaving device manufacture, foreign export of Cotton in China industry.Although utilize traditional breeding method once to achieve very large success in cotton variety improvement, but over nearly 20 years, World cotton kind has reached a plateau in output, utilizes existing genetic resources and breeding technique to be difficult to increase substantially output of cotton (Meredith W.R.Better Crops 200084 (4): 6 ~ 9) again.Simple dependence conventional breeding improving cotton fiber quality is quite difficult.This is because: 1) the quality trait gene such as cotton fiber brute force, fineness and lint yield exist negative chain, and conventional breeding methods is difficult to break the negative correlation in this heredity; 2) cotton cultivar of China mainly upland cotton, and fine fiber Quality Gene mainly comes from diplontic plucked instrument Bai Shi cotton (fibre strength), Gossypium anomalum (fibre strength and fineness) and tetraploid sea island cotton (fibre strength and fineness) etc., the utilization of these good character genes is subject to many limitations in conventional breeding.Plucked instrument Bai Shi is cotton is wild diploid species with Gossypium anomalum, after hybridizing, has that the economical character that distant hybirdization brings is poor, offspring is difficult to problems such as stablizing, the cycle is oversize with Tetraploid G. hirsutum; Even if be all the hybridization of tetraploid sea × land, there is offspring equally and be separated strongly, output-quality bear linkage relationship still difficulty the problem (Pan family coltfoal 1998 cotton breeding 99 ~ 104 Beijing: Chinese agriculture press) such as to break.Jeffrey Chen even thinks :-will to improve cotton fiber quality under the prerequisite not affecting output be almost impossible ‖ (Nature Biotechnology, 2011,29 (5): 407-409).

Utilize engineered method can break genetic block between species, realize the orientation transfer of goal gene, there is the advantages such as offspring is easy to stable, and breeding cycle is short simultaneously.Therefore, on the basis of clear and definite cotton fiber development molecule mechanism, the gene that promotes cotton fiber development is relevant, and then utilize engineered means to carry out orderly improvement to cotton fiber yield and quality, be the focus in research both at home and abroad in recent years always.

Promotor is that RNA polymerase can the section of DNA molecule of specific recognition, namely makes the position of transcribing beginning.In the regulation and control of genetic expression, transcribing is the first step of genetic expression, is also key one step (Lewi, 2005 gene VIII 669 ~ 705, Beijing: Science Press) of expression regulation.Along with engineered development, usually need to build a kind of can the expression vector of high level expression heterologous protein, promotor affect very greatly the expressive site of foreign gene in biology and expression level, is the critical elements of gene engineering expression carrier.In the genetically engineered improvement of cotton fiber quality, often need foreign gene to express in fibrocyte specifically, thus reduce foreign gene to the impact of cotton normal growth.About in the gene regulating study mechanism of cotton fiber development, usually adopt genetically modified means, by goal gene overexpression or expression silencing, thus infer its function.Therefore, when being verified its function by transgenic approach, the normal growth of meeting interference of transgene cotton, produces unforeseen result, affects accuracy and the experiment progress of experimental result.If employing cotton fiber specific promoter, then the expression of goal gene can be made to control in Fibre Development process.Therefore, the clone of cotton fiber or seed coat specific promoter and expression analysis thereof, to the gene functional research of cotton fiber development and the genetically engineered improvement of fibrous quality, all have very important value.

Forefathers, by utilizing fiber specific promoter, attempt the quality by biotechnology improvement cotton fiber, as polyhydroxybutyrate synthetase series specifically expressing in cotton fiber improved the thermal property of cotton fiber.The investigative test of Agracetus company of U.S. reported first genetically engineered improvement cotton fibre in 1996.Containing a kind of natural aliphatic polyester compound---poly-D-(-)-3 hydroxybutyric acid (PHB) in the cotton fibre of genetic transformation.PHB polyester is a kind of natural degradable thermal plastic (thermoplastic), and its physico-chemical property is similar to polypropylene.As carbon source in PHB is often present in some bacterium body using the form of inclusion body.The biosynthesizing of PHB relates to 3 kinds of enzymes: β-ketothiolase, acetyl-CoA reductase enzyme and PHB synthetic enzyme.(the John M E such as John, Keller G.Metabolic ProcNatlAcadSci, USA 1996,93:12768-12773) acetyl-CoA reductase gene (phaB) is connected with fiber specific promoter E6 and FbL2A respectively with PHB synthase gene (phaC), build plant expression vector, use gene gun technology, by phaB and phaC gene cotransformation in upland cotton cultivar DP50, successfully obtain the transgene cotton of simultaneously expressing phaB and phaC gene.Gus gene is expressed, Northern hybridizes equimolecular detected result all proves: phaB and phaC expresses in transgenosis cotton plant fiber.Fluorescent microscope is consistent with transmission electron microscope observation to be shown: containing PHB particle in transgenic cotton fibre cell.GC-the MC of transgenic cotton fibre extract is analyzed and shows in fiber, there be the material identical with bacterium PHB mass spectrum, prove in transgenic cotton fibre, to have synthesized PHB macromolecular substance.HPLC analytical results shows: every gram of fiber dry weight contains the PHB of about 30-3440 μ g, and the synthesis of PHB starts from Post flowering 10d, and after fiber maturation, PHB content does not reduce.To utilize in plant materials the acetyl-CoA synthetic macromolecule PHB of self, not on cotton fiber quality as length, intensity and mic value bring any impact, but the existence of PHB improves the thermal insulation properties of fiber really.But because in fiber, PHB content is still lower, the amplitude that insulativity improves is still limited.

Another focus that rather people pay close attention in genetically engineered improvement cotton fibre is the research work of Auburn university of U.S. Daniell.Daniell (Henry Daniell, Beltwide Cotton Conferences, 1998,595 ~ 598) attempt albumen aggressiveness (the protein-based polymers of coding containing Val-Pro-Gly-Val-Gly repeating unit, PBPs) gene genetic converting cotton, makes cotton cells energy specifically expressing go out PBPs albumen.PBPs albumen is extensively present in occurring in nature, and as the elastin in mammalian connective tissue, containing the repetitive sequence be made up of multiple amino acid in molecule, PBPs molecule often shows stronger elasticity (coefficient of elasticity 10.6 ~ 10.9Pa).Daniell (Henry Daniell, Beltwide Cotton Conferences, 1998,595 ~ 598) think and PHBs introduced cotton fibre, be expected to the elasticity and the intensity that improve fiber on the one hand, the raising of protein content in another aspect fiber, fibrous absorbent ability strengthens, to the avidity also corresponding enhancing of dyestuff, this is that current conventional breeding methods not accomplished.

Above-mentioned case illustrates and utilizes genetic engineering technique, and under fiber specific promoter controls, specifically expressing goal gene can improving cotton fiber quality.The importance of specific promoter in cotton gene Engineering Breeding, more outstanding (Zhang, et al Nature Biotechnology, 2011, the 29:453-458) that show in the work of the people such as Zhang.Forefathers are used by external source, find that growth hormone has promoter action to Fibre Development, under so growth hormone IAA biosynthetic enzyme genes is placed in fiber specific promoter E6 control by John (1999), to usually improving output of cotton or quality by the growth increased in fibrocyte.Found that, although IAA content significantly increases in transgene cotton fibrocyte, there is not obvious improvement in transgenic fibre cell.John reaches a conclusion thus: overexpression growth hormone does not affect (John, M.E.1999) the length of cotton fiber, intensity and mic value.Zhang etc. utilize monoclonal antibody hybridization in situ technique to carry out cellular localization to IAA, find that IAA accumulates at the cotton fiber initiator cell middle and high concentration on the same day of blooming; Then there is no obvious IAA signal without Mutants of Fiber, show that IAA had a very important role to the initial of cotton fiber cell.Cotton fiber cell by ovule outer integument cells of superficial layer through differentiation projection, elongation and being formed.Research shows, only has the epidermic cell of the Post flowering inner process of 5 days (accounting for about 10%) to bud into and has the macrofiber spinning and be worth.They in this discovery of cotton fiber protrusion cell Semi-polarity distribution ‖ according to-growth hormone, analyze forefathers and utilize growth hormone to improve the reason of cotton fiber failure.Think and the feature that the polar contribution of growth hormone and cotton fiber cell are grown must be combined, utilize specific promoter to carry out the accuracy controlling on privileged site, time and intensity to growth hormone synthase gene, the object of fibres modified yield and quality can be reached.So they will from petunia and expression activity district at ovule exterior skin, controlling gene time of expressing before flowering 2 days to the Post flowering FBP7 promotor of 8 days, merge with growth hormone biosynthesis gene iaaM and import in cotton.Transgene cotton phenotype analytical result shows, not only ovule surface fiber number increases, ginning outturn is improved, and fiber fineness is also improved, and namely the yield and quality of transgene cotton fiber is synchronously improved.Compared with the promotor E6 used with John mainly expresses in the fibrocyte of Post flowering 5-24 days, this experiment has selected another one to have the promotor of following features: the time of 1. expressing is before flowering between 2 days to Post flowering 5 days; The position of 2. expressing is not the fibrocyte be differentiated to form, but ovule exocuticle, facilitating more ovule exocuticle differentiation and development is fibrocyte, and then improves the yield and quality of cotton; 3. the intensity expressed is different, especially should all the time to the regulation and control of hormonal readiness, otherwise growth and development of plants is abnormal, and the underproduction or quality also can be caused to decline.Therefore, Pioneer Electronic Corp. division vice president Michael Lassner thinks, this research-clearly demonstrate that the importance ‖ of the selection of promotor on character improvement (" Faculty of 1000 ", on September 14th, 2011).The bright outlook ‖ (Jeffrey Chen, Nature Biotechnology, 2011,29 (5): 407-409) of this research-present genetically modified crops of new generation.

Cotton ovule epidermis or the huge potential value of fiber specific promoter in the improvement of cotton gene engineering, this kind of specific promoter of some cottons is cloned, but the promotor that can be used for cotton gene improvement is at present still very limited, therefore, obtain more cotton fiber specific promoters, to the genetically engineered improvement of cotton fiber from now on and Fibre Development gene functional research, all there is important utility value.

Summary of the invention

The technical problem to be solved in the present invention is for the improvement of cotton variety provides a kind of new selection.

Technical scheme of the present invention is epidermal hair and cotton fiber specific promoter PLTP, and its nucleotide sequence is as shown in SEQ ID No.1.

Present invention also offers the expression vector containing described promotor PLTP.

Concrete, described expression vector is plant expression vector.

Present invention also offers the host containing described carrier.

Concrete, described host is agrobacterium tumefaciens.

Present invention also offers described promotor PLTP and obtain the application in transgenic plant.

Present invention also offers described promotor PLTP and obtain the application in transgene cotton or transgene tobacco.

Present invention also offers described expression vector and obtain the application in transgenic plant.

Present invention also offers described expression vector and obtain the application in transgene cotton or transgene tobacco.

Present invention also offers described promotor PLTP and improve the application in cotton fiber quality.

Present invention also offers the preparation method of the transgenic plant containing described promotor, comprise the steps:

(1) promotor of epidermal hair and cotton fiber specific is operationally inserted in expression vector, build plant expression vector;

(2) transform host with described plant expression vector, obtain transformant;

(3) by described transformant conversion of plant, transgenic plant are obtained.

Epidermal tobacco hair of the present invention and cotton fiber specific promoter sequence, it is at least containing the nucleotide sequence shown in SEQ ID NO.1, this sequence is that adopt PCR method, the length obtained is the PLTP promoter sequence of 2467bp according to cotton GhLTP gene order design primer.The relevant SKn-1 of multiple seed endosperm is comprised in this sequence, MRE and MBS relevant with myb transcription factor binding site, with corresponding relevant ABRE and TCA of hormone such as ABA, SA, MSA-like and cricadian inducing relevant TC enrichment region relevant with ARE, cell cycle and diel rhythm to adverse circumstance, anaerobism etc., a large amount of cis-regulating element such as multiple CAAT-box, A-box, G-box, AAGAA-motif and the core sequence TATAA be combined with TFII.Detected by GUS histochemical stain in transgene tobacco and transgene cotton, confirm that this promoters driven gus gene is expressed specifically in transgene tobacco epidermal hair and in upland cotton fiber cell.

In the present invention, adopt gene engineering method, PLTP promotor is inserted in suitable expression vector and can obtains the plant expression vector containing this promotor PLTP of the present invention.

The host of above-mentioned plant expression vector transforming appropriate can be obtained transformant of the present invention by the present invention.Concrete, adopt electric shocking method to be transformed in agrobacterium tumefaciens lba4404 by the plant expression vector containing PLTP promotor and obtain transformant.

PLTP promotor of the present invention and reporter gene are built plant expression vector, described plant expression vector is transformed host and obtains the transformant containing PLTP promotor, and obtain transgenic plant with described transformant conversion of plant.Described transgenic plant are preferably tobacco or upland cotton.

Beneficial effect of the present invention: the promotor PLTP that present invention obtains cotton fiber specific gene, this promotor has epidermal hair specific expression activity in tobacco, there is fiber predominant expression specificity in upland cotton, for genetically engineered improvement tobacco, cotton variety provide new selection and effective approach.

Accompanying drawing explanation

The expression amount of Fig. 1 GhLTP gene in upland cotton different tissues (Relative Expression)

With the cDNA in upland cotton root (root), stem (stem), leaf (leaves), corolla (petal), hypocotyl (hypocotyl), cotyledon (cotyledon), ovule on the same day of blooming (0-O & F), the fiber (11-F) of Post flowering 11d and the ovule (11-O) of Post flowering 11d for template, through the result of real-time quantitative PCR amplification; This gene is expressed hardly in root, and in the ovule on the same day of blooming, expression amount is also very low; In hypocotyl, cotyledon, blade, stem, petal and Post flowering 11d ovule, expression amount is lower, and in Post flowering 11d fiber high expression level.

Fig. 2 GhLTP gene is at the expression amount (Relative Expression) of upland cotton fiber different development stage

To bloom ovule on the same day (0-O & F), the Post flowering ovule of 3 days (3-O & F), the Post flowering ovule of 7 days (7-O), the Post flowering ovule of 9 days (9-O), the Post flowering ovule of 11 days (11-O), the Post flowering ovule of 13 days (13-O), the Post flowering ovule of 19 days (19-O), the Post flowering ovule of 26 days (26-O), the fiber (7-F) of Post flowering 7d, the fiber (9-F) of Post flowering 9d, the fiber (11-F) of Post flowering 11d and the fiber (13-F) of Post flowering 13d.

Fig. 3 represents the nucleotide sequence figure of PLTP promotor, on figure, mark is the position of some cis-acting elements, SKn-1 (GTCAT) relevant with multiple seed endosperm respectively, the MRE (AACCTAA) relevant with myb transcription factor binding site and MBS (CGGTCA), with ABA, the corresponding relevant ABRE (GACACGTGGC) of the hormones such as SA and TCA (CCATCTTTTT), with adverse circumstance, the TC enrichment region (GTTTTCTTAC) that the induction such as anaerobism is relevant and ARE (TGGTTT), the MSA-like (TCAAACGGT) that cell cycle is relevant with diel rhythm and cricadian (CAANNNNATC).

Fig. 4 represents that PLTP promotor is cloned into the plasmid map on pEASY-Blunt carrier.

Wherein carrier main element indicates, pUC origin Plasmid replication origins; Ampicillin resistance ORF: ampicillin resistance gene; Kanamycin resistance ORF: kalamycin resistance gene; All the other are restriction endonuclease sites.

The structure schema of Fig. 5 upland cotton PLTP promoter expression vector;

The structure iron of Fig. 6 PLTP promoter expression vector pBI101-PLTP.

In Fig. 5 and Fig. 6, carrier main element indicates, rep origin Plasmid replication origins; NPTII: neomycin phosphotransferase gene; GUS: β-gluconic acid glycoside enzyme gene; NOS terminato and NOS: terminator; NOS Promoter:NOS composition promotor; LB, RB:T-DNA insert left and right border.

Fig. 7 represents the PCR the result turning PLTP ∷ GUS fusion gene tobacco.18,19,38 be standard molecular weight DNA (Mark2000), 1-17,20 ~ 37 is different transgenic lines.Result shows 1,2,6,8,12-17,20,23,24,31 ~ 36 is transgene negative strain, all the other strains are transgenic positive strain.

Fig. 8 represents the GUS coloration result turned in PLTP ∷ GUS fusion gene tobacco, GUS predominant expression on the epidermal hair of transgenic tobacco leaf, stem, carpopodium and flower.Wherein, A: the seedling sprouting latter 5 days; B: true leaf; C: young stem crosscut; D: petiole crosscut; The amplification of young stem in E:C; The amplification of petiole in F:D; G: the ovary on the same day of blooming; H: the corolla on the same day of blooming.

Fig. 9 represents the PCR the result turning PLTP ∷ GUS fusion gene cotton.1,18,19,36 is standard molecular weight DNA, and 2-17,20-35 are different transgenic lines, and result shows that transgenic line is positive strain.

Figure 10 represents the GUS coloration result turning PLTP ∷ GUS fusion gene upland cotton; Wherein A: root; B: stem; C: leaf; D: petiole; E: flower; F: corolla; G: the ovule on the same day of blooming; H: the Post flowering ovule of 3 days; I: the Post flowering ovule of 7 days; J: the Post flowering ovule of 12 days; K: the Post flowering ovule of 15 days; L: the Post flowering ovule of 18 days.

Embodiment

Below in conjunction with accompanying drawing, the present invention is described in further detail, but below illustrate and the present invention is not limited, any to distortion of the present invention and change, only otherwise depart from spirit of the present invention, the scope that claims of the present invention define all should be belonged to.

It is common commercially available that reagent chemicals in example of the present invention does not do being of illustrating, and MATERIALS METHODS does not do equal reference " Molecular Cloning: A Laboratory guide " (Sambrook and Russell, 2001) that illustrate.

Embodiment 1 upland cotton each organize extraction and the quantitative PCR analysis of RNA

EASYspin plant RNA rapid extraction test kit (Aidlab) is utilized to extract the RNA of each tissue of cotton.The reverse transcription of cDNA mono-chain is carried out, as quantitative RT PCR analysis template with reference to RevertAid First Strand cDNA Synthesis Kit (MBI) specification sheets.Adopt the relative expression quantity of iQ SYBR Green Supermix (BIO-RAD) reagent analysis goal gene.Internal standard gene selects the Ghhis3 gene (AF024716) of upland cotton, primer is Ghhis1 (5 '-GAA GCC TCA TCG ATA CCG TC-3 ') and Ghhis2 (5 '-CTA CCA CTA CCA TCA TGG C-3 '), respectively as shown in SEQ ID NO.8 and SEQ ID NO.9; GhLTP gene quantification PCR primer is, Ltp-1 (5 ' CGCCCAAACAACACCAGAC3 ') and Ltp-2 (5 ' CTTTTGCAGTCAGTGCTAGG 3 '), respectively as shown in SEQ ID NO.2 and SEQ ID NO.3.Amplification condition is: 95 DEG C of denaturation 3min; 95 DEG C of sex change 20s, 56 DEG C of annealing 20s, 72 DEG C extend 30s, 40 circulations.

Calculate goal gene and interior target ratio in each material, the relative expression quantity of goal gene in different organ and tissue can be obtained.As shown in Figure 1, this gene is expressed hardly in root, and in the ovule on the same day of blooming, expression amount is also very low; In hypocotyl, cotyledon, blade, stem, petal and Post flowering 11d ovule, expression amount is lower, and in Post flowering 11d fiber high expression level.Detect the cotton fibre of different developmental phases and cotton ovule further, result as shown in Figure 2, express higher in the fiber of 7 days to 11 days, and the expression amount accordingly in ovule is lower by this gene.

The clone of embodiment 2 upland cotton PLTP promotor

Adopt Ai Delai biotech firm plant genes group DNA rapid extraction test kit, method to specifications extracts the genomic dna of upland cotton Ji cotton 14, with special primer PLTP-up and PLTP-dn (SEQ ID NO.4 and 5) of this promotor of design and synthesis, with above-mentioned DNA for template, increase this promoter sequence.Amplification system is as follows: 10 × PCR buffer for KOD Plus 5 μ L, 25mmolMgSO45 μ L, 2mmol/L dNTPs 2 μ L, primer PLTP-up (5 μm of ol/L) 2 μ L, primer PLTP-dn (5 μm of ol/L) 2 μ L, KOD Plus polysaccharase 1U/ μ L, upland cotton DNA is about 60ng, and distilled water complements to 50 μ L.Amplification program is: 94 DEG C, 2min; 94 DEG C, 15sec, 53 DEG C, 30sec, 68 DEG C, 2min, 35 circulations.After having increased, agarose electrophoresis also reclaims corresponding DNA band, and method is to specifications cloned on pEASY_Blunt blunt vector, and positive colony sends the handsome company in Shanghai sequence verification to, obtains pEASY-PLTP1131 carrier (see Fig. 4).The PLTP promoter sequence that result display obtains is as shown in SEQ ID NO.1.Utilize analysis software (Plant CARE, http://intra.psb.ugent.be:8080/PlantCARE/), from plant promoter database, promoter regulation component analysis is carried out to this sequence, therefrom find a large amount of cis-regulating element (see Fig. 3), these cis-regulating element comprise the relevant SKn-1 of multiple seed endosperm (GTCAT), the MRE (AACCTAA) relevant with myb transcription factor binding site and MBS (CGGTCA), with dormin ABA, the corresponding relevant ABRE (GACACGTGGC) of hormone and the TCA (CCATCTTTTT) such as Whitfield's ointment SA, with adverse circumstance, the TC enrichment region (GTTTTCTTAC) that the induction such as anaerobism is relevant and ARE (TGGTTT), the MSA-like (TCAAACGGT) that cell cycle is relevant with diel rhythm and cricadian (CAANNNNATC).

Embodiment 3DNA fragment reclaims, expression vector establishment intestinal bacteria transform

Under ultraviolet lamp, cut the sepharose block containing object fragment with the blade of cleaning, reclaim corresponding DNA fragmentation according to the method for test kit (Roche company), be building up to.The idiographic flow of vector construction is shown in Fig. 5, first from the cloning vector pEASY-PLTP1131 of this promotor, utilize restriction enzyme Sal I and Sma I to be cut out by promoter fragment, then to be cloned in the Sal I of expression vector pBI101 (purchased from CLONTECH company) and Sma I site and to be placed in gus reporter gene upstream, thus building the forward expression vector (Fig. 6) of pPLTP-GUS.All restriction enzymes, all purchased from Roche company, operate according to working instructions.

The fragment reclaimed with the linked system of carrier segments is: 10 × T4DNA is connected damping fluid 1 μ L, vector DNA fragment 1 μ L, and external source connects product D NA fragment 1 μ L, and T4DNA ligase enzyme 1 μ L, supplies volume to 10 μ L with distilled water.Wherein, vector DNA fragment is connected product D NA fragment mol ratio with external source is that 1 ︰ 3,16 DEG C connects 12h.Product conversion will be connected afterwards in bacillus coli DH 5 alpha.

The genetic transformation of embodiment 4 Agrobacterium and tobacco and cotton

With electrization, the plant expression carrier plasmid built is imported Agrobacterium LBA4404.

According to the step of OMEGA company plasmid extraction kit (D6943-01) specification sheets, extract PLTP::GUS plant expression carrier plasmid, with reference to Bio-RADMicroPulser instruction manual book, by Electroporation conversion, this plasmid is proceeded in Agrobacterium LBA4404.

The genetic transformation of tobacco: utilize agriculture bacillus mediated leaf disc transformation method (Horsch, et al., 1985), genetic transformation is carried out to tobacco, the method of the transgenic tobacco plant of acquisition by pcr amplification screened, adopt Ai Delai biotech firm plant genes group DNA rapid extraction test kit, method to specifications extracts the DNA of transgene tobacco, then the plant that PCR is positive is planted in greenhouse, Routine Management.

The genetic transformation of upland cotton: adopt agriculture bacillus mediated method to carry out genetic transformation (Luo et al. to cotton, 2007), the method of the transgenic cotton plant of acquisition by pcr amplification is screened, adopt Ai Delai biotech firm plant genes group DNA rapid extraction test kit, method to specifications extracts the DNA of transgene cotton, then pcr amplification qualification is carried out, the seedling of the positive is placed in clear water, cultivate after 1 week for 22 DEG C and transplant in greenhouse, carry out normal management.

The PCR checking of embodiment 5 transfer-gen plant

Adopt Ai Delai biotech firm plant genes group DNA rapid extraction test kit, method to specifications extracts the DNA of transgene tobacco and cotton.According to the sequences Design special primer GUS-1:AGCGTAATGCTCTACACCACG (SEQ ID NO.6) of gus reporter gene and GUS-2:GTAATGCGAGGTACGGTAGG (SEQ ID NO.7) for specific PCR amplification.Transfer-gen plant DNA carries out the condition of PCR amplification in vitro checking: reaction cumulative volume is 25 μ L, comprises 10 × LA Taq buffer 2.5 μ L, often kind of dNTP 100 μm of ol/L, 1.5mmol/L MgCl2, template DNA 10ng, each 400nmol/L of upstream and downstream primer, 1 unit LA Taq archaeal dna polymerase (TaKaRa company).

Amplification condition: 94 DEG C of sex change 4min, continue with 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C of extensions 1min, totally 35 circulations, last 72 DEG C extend 10min.

Amplified production containing ethidium bromide 1% sepharose on the electrophoresis of 5V/cm after, under ultraviolet lamp observe take pictures.

The PCR the result of transgene tobacco is shown in Fig. 7, result shows 1,2,6,8,12-17,20,23,24,31-36 is transgene negative strain, all the other strains are transgenic positive strain.

The PCR the result of transgene cotton is shown in Fig. 9, and result shows that transgenic line is positive strain.

The histochemical stain of embodiment 6GUS and observation

Get fresh transgene tobacco, upland cotton material, be cut into small pieces in rearmounted 1.5mL centrifuge tube, add GUS staining fluid (10mmol/LEDTA, 100mmol/L sodium phosphate buffer pH7.0,0.1mol/L K ₃[Fe (CN) ₆], 0.1mol/LK ₄[Fe (CN) ₆], 0.1% (V/V) Triton X-100,5mg/ml X-Glue).By the centrifuge tube containing vegetable material and GUS dye liquor, put into 37.0 DEG C of constant temperature incubators, dyeing 3h.Most backwardly remove staining fluid, after 70% ethanol decolorization, observe and take a picture.

The GUS coloration result turned in PLTP ∷ gus gene tobacco is shown in Fig. 8, result display GUS predominant expression on the epidermal hair of transgenic tobacco leaf, stem, carpopodium and flower, and do not express in non-epidermal hair tissue, namely this promotor has epidermal tobacco hair expression specificity.

The GUS coloration result turning PLTP ∷ gus gene upland cotton is shown in Figure 10, found that the blue signal all not observing GUS in root, blade, young stem; Spending, the epidermal hair of corolla and stamen, GUS positive signal is had to exist in flower pesticide; And the cotton ovule surface from the same day of blooming starts the blue signal occurring GUS, especially in the rapid elongation phase of Fibre Development, strong GUS positive signal is had to exist in fiber specific cell, show that this promotor has floral organ epidermal hair specific and fibrocyte specificity in upland cotton, in fibrocellular genetically engineered improvement, may be used for driving goal gene specifically expressing in fibrocyte, there is important using value.

Above-described embodiment shows, the PLTP promotor length of nucleotides of the present invention clone is 2467bp, when after this promotor and reporter gene fusion, reporter gene can be instructed in tobacco to express in epidermal hair; Reporter gene can be instructed in upland cotton to express in fibrocyte.

Above detailed description of the present invention does not limit the present invention, and those skilled in the art can make various distortion and change according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope that claims of the present invention define.

Claims (10)

1. epidermal hair and cotton fiber specific promoter PLTP, is characterized in that, its nucleotide sequence is as shown in SEQ ID No.1.

2. the expression vector containing promotor PLTP described in claim 1.

3. expression vector as claimed in claim 2, is characterized in that: described expression vector is plant expression vector.

4. the host containing carrier described in Claims 2 or 3.

5. host as claimed in claim 4, is characterized in that: described host is agrobacterium tumefaciens.

6. promotor PLTP according to claim 1 is obtaining the application in transgenic plant.

7. promotor PLTP according to claim 1 is obtaining the application in transgene cotton or transgene tobacco.

8. the expression vector described in Claims 2 or 3 is obtaining the application in transgene cotton or transgene tobacco.

9. promotor PLTP described in claim 1 is improving the application in cotton fiber quality.

10. the preparation method of the transgenic plant containing promotor PLTP described in claim 1, comprises the steps:

(1) promotor of epidermal hair and cotton fiber specific is operationally inserted in expression vector, build plant expression vector;

(2) transform host with described plant expression vector, obtain transformant;

(3) by described transformant conversion of plant, transgenic plant are obtained.