CN110734910A - Ovule specific promoter PMEI _ d and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and relates to ovule specific expression promoters PMEI _ d and application thereof, aiming at solving the technical problem of providing new choices for improving seed development by utilizing genetic engineering means, wherein the nucleotide sequence of the ovule specific expression promoter PMEI _ d is shown as SEQ ID No. 1.

Description

Ovule specific promoter PMEI _ d and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and relates to an ovule development specific promoter and application thereof.

Background

With the advent of world resource shortages and population growth, as well as improvements in human living standards, food shortages remain the most serious global problem in this century, according to the united nations Food and Agricultural Organization (FAO), about 8.2 billion people are facing the food shortages in 2017 of the world, the figure accounts for about , which is a ninth of the global general population, although the problem of food shortages is partially alleviated by the continuous efforts of major technologists, the ever-expanding food demand for rapid population growth, increasing food yields and improving their quality remain the primary targets of agricultural production, in which our major food and oil crops such as wheat, rice, canola, cotton, etc. are seeds whose major food parts are seeds for the progeny plants, plant seeds are not only important sources of our food, but also important reproductive organs of the progeny plants, the development of the seeds is initiated from fertilization, not only the zygotic seed development into endosperm, but also the development of the triploid embryos, as well as the development of the endosperm, the theoretical and the theoretical improvement of the quality of the seeds.

Therefore, on the basis of determining the molecular mechanism of plant seed development, genes related to promoting seed development are separated, and then the method of genetic engineering is used for carrying out directional improvement on the yield and quality of plant seeds, is a hot spot in domestic and foreign researches, so that the target genes are successfully expressed, the regulation and control of the promoter are essential, namely DNA molecules which can be specifically identified by RNA polymerase, namely, the site where transcription starts, in the regulation and control of gene expression, the transcription is the step of gene expression and the key step of expression regulation and control (Lewi, gene VIII 669-705, Beijing: scientific publishing Co., Ltd.) in the plant genetic engineering, the promoter greatly influences the expression site and the expression level of an exogenous gene in organisms, is an important element of a gene engineering expression vector, the common promoter can be divided into three types according to the action mode and function, the promoter, tissue and tissue specificity, and tissue specific expression of the promoter are determined by the specific expression of the organ, the metabolic factors of the promoter, the specific expression of the promoter, the organ, the specific expression of the tissue and the organ, the development of the organ, the specific expression of the tissue, the organ, the metabolic factors of the specific expression of the promoter, the organ, the tissue, the specific expression of the organ, the tissue, the organ.

The utilization of the seed specific expression promoter can ensure that the exogenous target gene is only expressed in the seed, improve the expression concentration of the exogenous gene at a specific part and enhance the transgenic effect. Seed-specific promoters have been utilized to attempt to improve seed quality through bioengineering techniques, such as Tomlinson and others utilizing the seed-specific promoter napin to drive the specific expression of yeast sucrose invertase genes in tobacco seeds, thereby increasing the activity of sucrose invertase by 10-30 times and obviously increasing the accumulation of oil substances in the seeds. In turn, Na and the like increase the size and weight of the flax mustard seed by specifically inhibiting the expression in the seed of the glucose pyrophosphorylase gene, a key enzyme in starch synthesis. Lee et al utilized soybean-derived glinin-1 seed specific promoters to control the expression of BASS2 gene in Arabidopsis thaliana, significantly increasing the oil content of the seeds. Similar to their work, Tang et al utilize a seed specific promoter to express the Arabidopsis thaliana AtLEC1 gene in peanuts, and synchronously increase seed weight and oil content. In the improvement of rice yield and quality, the GluB-1 promoter drives the expression of a soybean iron binding protein gene in rice endosperm, so that the iron content in rice can be increased (Liuqiaoquan et al, 2004). Junko et al, which utilizes the rice 18kDaoleosin promoter to drive the expression of linoleic acid isomerase gene in rice, not only improves the content of linoleic acid in rice, but also enhances the functions of cancer prevention and arteriosclerosis resistance of rice. The promoter of the rice Ole18 gene drives the RINO1 gene to specifically express in the seeds, so that the phytic acid content in rice grains is reduced. These findings are a good indication of the great value of seed-specific promoters in the genetic engineering improvement of plant seeds.

For example, Doshi et al utilizes LegA2 seed specific promoter to respectively express hADA genes from human in tobacco, pea and lupin to produce recombinant protein ADA for treating severe immune deficiency syndrome.

In the genetic engineering improvement of grain and oil crops, the seed specific expression or dominant expression promoter has great potential value. However, the promoters which can be used for the gene improvement of the grain and oil crops are still very limited, so that more seed specific promoters with different null expression characteristics are obtained, and the promoter has important theoretical and practical values.

Disclosure of Invention

The invention aims to provide seed development specific promoters, and provide novel methods for controlling specific expression of target genes in seeds for improving plant seeds.

In order to achieve the aim, the technical scheme of the invention is that the seed development specific promoter PMEI _ D has a nucleotide sequence shown as SEQ ID No. 1.

The invention also provides an expression vector containing the promoter PMEI _ D.

Specifically, the expression vector is a plant expression vector.

The invention also provides a host containing the vector.

Specifically, the host is agrobacterium tumefaciens.

The invention also provides application of the promoter PMEI _ D in obtaining transgenic plants.

The invention also provides application of the promoter PMEI _ D in improving the yield and quality of plant seeds.

The invention also provides a preparation method of the transgenic plant of the promoter, which comprises the following steps:

(1) operably inserting the ovule-specific promoter into an expression vector to construct a plant expression vector;

(2) transforming a host with the plant expression vector to obtain a transformant;

(3) and transforming the transformant into a plant to obtain a transgenic plant.

The seed specific promoter sequence at least contains a nucleotide sequence shown by SEQ ID NO.1, and the sequence is a PMEI _ D promoter sequence with the length of 1922bp, which is obtained by designing a primer according to a cotton GhPMEI gene sequence and adopting a PCR method. The sequence comprises a plurality of cis-regulatory elements such as GCN4(TGAGTCA), AACA _ motif (TAACAAACTCCA), GT1_ motif (GGTTAA) related to light induction, TGACG related to jasmonate methyl ester response, ABRE (ACGTG) related to ABA response, LTR (CCGAAA) and ARE (AAACCA) related to low-temperature and anaerobic induction, O2_ site (GATGATGTGG) related to zein metabolism regulation and a core TATAA combined with TFII. GUS histochemical staining detection in transgenic Arabidopsis proves that the promoter drives the GUS gene to be specifically expressed in Arabidopsis seeds.

The PMEI _ D promoter and a reporter gene are used for constructing a plant expression vector, the plant expression vector is transformed into a host to obtain a transformant containing the PMEI _ D promoter, and a transgenic plant is obtained by transforming a plant with the transformant. The transgenic plant is preferably Arabidopsis thaliana.

The promoter PMEI _ D specifically expressed in the seed development process is obtained, has ovule expression specificity in upland cotton and arabidopsis thaliana, and provides a new selection and effective way for improving the yield and quality of cotton and arabidopsis thaliana seeds by genetic engineering.

Drawings

FIG. 1 shows the results of expression detection of GhPMEI gene in different tissues of upland cotton

The detection result is obtained by real-time quantitative PCR amplification by taking the cDNA of the leaves, cotyledons, caulicles, hypocotyls, sepals, petals, stamens, pistils and ovules 10 days after blooming of the upland cotton Ji cotton 14 as templates; the gene is hardly expressed in upland cotton leaves, cotyledons, caulicles, hypocotyls, sepals, petals, stamens and pistils, and is highly expressed in ovules 10d after flowering, wherein the expression level in the ovules 10d is almost 45 ten thousand times of that in the leaves, 40 ten thousand times of that in the petals and the cotyledons, and 1.6 ten thousand times of that in the hypocotyls, the sepals and the pistils.

FIG. 2 shows the expression level of the GhPMEI gene in different developmental stages of upland cotton fibers

The detection result is obtained by real-time quantitative PCR amplification by using the ovules and fibers of the upland cotton on the day of flowering, 1 day after flowering, 3 days after flowering and 5 days after flowering and the cDNAs in the fibers on 5 days, 7 days, 9 days, 10 days, 11 days, 13 days, 15 days, 17 days, 19 days, 20 days, 21 days, 23 days, 25 days, 27 days, 29 days and 30 days after flowering as templates; the gene is mainly expressed in the ovule of upland cotton, and the expression level is lower in each period of fiber development.

FIG. 3 shows the expression level of the GhPMEI gene in different developmental stages of upland cotton seeds

The detection result is obtained by real-time quantitative PCR amplification by using cDNA in ovules of 1 day before blooming, ovules and fibers of the day of blooming, ovules and fibers of 1 day after blooming, ovules and fibers of 3 days after blooming, ovules and fibers of 5 days, 7 days, 10 days, 11 days, 13 days, 15 days, 17 days, 19 days, 20 days, 21 days, 23 days, 25 days, 27 days, 29 days, 30 days and 35 days after blooming as templates; the gene is efficiently expressed in the upland cotton ovule, wherein the expression is higher in the early stage (-1-13 d) of ovule development. The expression level in ovules 7 days after flowering was the highest, about 26 times the expression level in ovules 1 day before flowering, about 4 ten thousand times the expression level in ovules 35 days after flowering, and about 128 ten thousand times the expression level in leaves.

FIG. 4 shows a flow chart of construction of a Gossypium hirsutum PMEI _ D promoter expression vector.

FIG. 5 shows a structural diagram of a plant expression vector pBI101-PMEI _ D for PMEI _ D promoter.

The major elements of the vectors in FIGS. 4 and 5 are indicated, rep origin plasmid replication origin, NPTII neomycin phosphotransferase gene, GUS β -glucoronidase gene, NOS terminator and NOS terminator, NOS Promoter, NOS constitutive Promoter, LB, RB, T-DNA insertion left and right borders.

FIG. 6 shows the PCR validation results of transgenic Arabidopsis thaliana with PMEI _ D: GUS fusion gene.

M is standard molecular weight DNA, 1-5 are different transgenic lines. The results show that 1-5 are transgenic positive lines.

FIG. 7 shows the results of GUS staining of various tissues of Arabidopsis transformed with PMEI _ D: GUS fusion gene.

GUS is expressed only in the seeds of transgenic Arabidopsis thaliana, but not in the tissues of leaves, cotyledons, roots, petals, stamens, pistil pod peel and the like. Wherein, A: seedlings 10 days after germination; b: true leaves; c: flower; d: a pod; e: and (4) seeds.

FIG. 8 shows sections of transgenic Arabidopsis seeds with PMEI _ D: GUS gene after GUS staining.

The expression is high in endosperm, cotyledon and embryo, the expression is slight in radicle, and the expression is not in seed coat.

Detailed Description

The invention is described in further detail in with reference to the drawings, but the invention is not limited by the following description, and any variations and modifications of the invention are within the scope of the invention as defined in the appended claims without departing from the spirit of the invention.

Reagents and drugs in the examples of the present invention are not specifically described, and they are generally commercially available, and materials and methods are not specifically described, and reference is made to molecular cloning protocols (Sambrook and Russell, 2001).

The plant source is as follows:

upland cotton, variety Ji cotton 14(Gossypium hirsutum L.cv Jinian 14), given by professor of Mariang Ying, Baoding City Temple street of Hebei province No. 289 Hebei agricultural university Life sciences, postal code: 071001

Arabidopsis thaliana (Arabidopsis thaliana L.) Col ecotype, purchased from The Arabidopsis Biological Resource Center (ABRC)

Example 1 extraction of RNA from various tissues of Gossypium hirsutum and quantitative PCR analysis

The RNA of each tissue of cotton is extracted by using an EASYspin plant RNA rapid extraction Kit (Aidlab). refer to the RevertAId First Strand cDNA Synthesis Kit (MBI) specification, the reverse transcription of a cDNA chain is carried out and is used as a quantitative RT-PCR analysis template, the relative expression quantity of a target gene is analyzed by using an iQ SYBR Green Supermix (BIO-RAD) reagent, the internal standard gene selects a Ghhis3 gene (AF024716) of upland cotton, the primers are Ghhis1 and Ghhis2 which are respectively shown as SEQ ID NO.2 and SEQ ID NO.3, the GhPMI gene quantitative PCR primers are PMEI-1 and PMEI-2 which are respectively shown as SEQ ID NO.4 and SEQ ID NO.5, the amplification conditions are that the pre-denaturation is carried out at 95 ℃ for 3min, the denaturation is carried out at 95 ℃ for 20s, the annealing is carried out at 56 ℃ for 20s, and the extension is carried out at 72 ℃ for 30s, and 40 cycles.

As shown in FIG. 1, the gene is hardly expressed in the leaves, cotyledons, caulicles, hypocotyls, sepals, petals, stamens and pistils of upland cotton, and is highly expressed in the ovules 10d after flowering, wherein the expression level in the ovules 10d is almost 45 ten thousand times that in the leaves, 40 ten thousand times that in the petals and the cotyledons, and 1.6 ten thousand times that in the hypocotyls, the sepals and the pistils, and steps are performed to test cotton fibers and cotton ovules in different developmental stages, and as shown in FIGS. 2 and 3, the gene is highly expressed in the ovules 3 to 11 days, and the expression level in each stage of fiber development is low.

Example 2 cloning of upland cotton PMEI _ D promoter and construction of plant expression vector

The novel plant genome DNA rapid extraction kit of Elder Rice organism company is adopted, the genome DNA of Gossypium hirsutum Ji cotton 14 is extracted according to the method of the instruction, the specific primers PMEI _ D-up and PMEI _ D-dn (SEQ ID NO.6 and 7) of the promoter are designed and synthesized, and the promoter sequence is amplified by taking the DNA as a template. The amplification system was as follows: 10 XPCRbuffer for KOD Plus 5. mu.L, 25 mmoleMgSO₄mu.L, 2mmol/L dNTPs 2. mu.L, 2. mu.L of primer PMEI _ D-up (5. mu. mol/L), 2. mu.L of primer PMEI _ D-dn (5. mu. mol/L), 1U/. mu.L of KOD Plus polymerase, about 60ng of upland cotton DNA, and made up to 50. mu.L with double distilled water. The amplification procedure was: 94 ℃ for 2 min; 94 ℃, 15sec, 53 ℃, 30sec, 68 ℃, 2min, 35 cycles. After amplification, agarose gel electrophoresis was performed and the corresponding DNA bands were recovered, and the recovered products were placed in a-20 ℃ freezer for use.

The specific procedures for constructing the Plant expression vector pBI101-PMEI _ D are shown in FIG. 4, respectively, the pBI101 plasmid is first digested with Hind III and BamH I restriction enzymes at 37 ℃ for 30min to obtain linearized vector, and the desired DNA fragment is recovered after electrophoresis through 1% agarose gel, the amplified gene product is recombined with the recovered vector fragment according to the method of the specification, the recombinant is 5 XCE buffer 4. mu.L, the optimal cloning vector usage amount required for recombination reaction is [0.02 × cloning vector base pair ] ng, the optimal insertion fragment usage amount is [0.04 × cloning vector base pair ] ng, recombinase Exnase II 2. mu.L, the volume is made up to 20. mu.L with double distilled water, the temperature is maintained at 37 ℃ for 30min, and then the product is transformed into DH5 α according to the method of [ molecular cloning vector cloning ] Czochra ] to construct pBEI 101-PMEI _ D positive expression vector (FIG. 5), the results of the cis-expression vector is analyzed by using the DNA sequence of GAAPAA, DNA sequence of the cis-related to obtain various genes related to TGA. A. the sequence related to express cis-TGA. related to the sequence of the Plant expression vector, and DNA related to the sequence of the sequence related to the expression vector, and the sequence related to induce the expression of TGA. A. related to obtain the sequence of the sequence related to the sequence of the Plant expression vector (TGA. related to the cis-TGA. A. related to the sequence of the Plant expression vector, the sequence of the Plant expression vector, and the sequence of the.

Extracting the constructed expression vector plasmid, transferring the expression vector plasmid into agrobacterium GV3101 by an electric shock method, and carrying out the specific operation steps according to the specification of an electric shock instrument.

EXAMPLE 3 genetic transformation of Arabidopsis thaliana and selection of transformants

Genetic transformation of Arabidopsis

⑴ the method includes such steps as activating and culturing Agrobacterium strain at-80 deg.C at 28 deg.C for 36-48 hr, culturing in 5mL of YEB liquid medium containing relative resistance at 28 deg.C under 200rpm, inoculating activated bacterial liquid at 28 deg.C under 200rpm in 250mL of YEB liquid medium containing relative resistance, shaking to OD600 of 1.2-1.5 at 28 deg.C under 200rpm, centrifuging at 5000rpm for 10min, collecting bacterial cells, culturing in the same volume, soaking Arabidopsis flowers in the full-bloom state for 1min, standing in the dark for 1d, and culturing in the culture box to obtain seeds.

⑵ Arabidopsis transformant screening, which comprises placing an appropriate amount of Arabidopsis seeds in a sterile 1.5mL centrifuge tube, adding 1mL disinfectant (75% alcohol + 0.1% Tween-80), shaking the centrifuge tube fully during disinfection, disinfecting for 20min, changing the disinfectant every 10min for times, sucking out the disinfectant with a sterile gun head, washing with sterile water for 2-3 times to remove residual alcohol, adding an appropriate amount of sterile water to suck up the seeds, uniformly spreading the seeds on an MS (adding corresponding antibiotics) flat plate, sealing the flat plate with a sealing film, vernalizing at 4 ℃ for 2d, placing the vernalized Arabidopsis flat plate in an Arabidopsis incubator to culture for 12-15d, wherein the negative plants have yellow or even white leaves due to no antibiotic resistance, the roots are short and short, the positive plants have good growth and developed roots, and the leaves are dark green.

Example 4 PCR validation of transgenic Arabidopsis plants

A novel plant genome DNA rapid extraction kit of the Edley organism company is adopted, and DNA of transgenic arabidopsis is extracted according to a method of a specification. Specific primers GUS-1: AGCGTAATGCTCTACACCACG (SEQ ID NO.8) and GUS-2: GTAATGCG AGGTACGGTAGG (SEQ ID NO.9) were designed based on the sequence of the GUS reporter gene for specific PCR amplification. The conditions for PCR in vitro amplification verification of transgenic plant DNA are as follows: the total reaction volume was 25. mu.L, including 2.5. mu.L of 10 × LATaq buffer, 100. mu. mol/L of each dNTP, 1.5mmol/L MgCl₂Template DNA10ng, upstream and downstream primers of 400nmol/L each, and 1 unit of LA Taq DNA polymerase (TaKaRa Co.).

Amplification conditions: denaturation at 94 ℃ for 4min, followed by denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and finally extension at 72 ℃ for 10 min. The amplification products were electrophoresed on a 1% agarose gel containing ethidium bromide at a voltage of 5V/cm, and the image was observed under an ultraviolet lamp. The PCR verification result of transgenic Arabidopsis is shown in FIG. 6, and the result shows that 1-5 is a transgenic positive strain.

EXAMPLE 5 histochemical staining and visualization of GUS

Fresh transgenic Arabidopsis thaliana material is taken and placed into a 1.5mL centrifuge tube, and GUS staining solution (10mmol/LEDTA, 100mmol/L sodium phosphate buffer solution pH7.0, 0.1mol/L K) is added₃[Fe(CN)₆]， 0.1mol/L K₄[Fe(CN)₆]0.1% (V/V) Triton X-100,5mg/ml X-Glue). And putting the centrifuge tube containing the plant material and the GUS dye solution into a constant temperature incubator at 37.0 ℃ for dyeing for 3 h. Most preferablyThe staining solution was then decanted, decolorized with 70% ethanol, and the photograph was observed.

EXAMPLE 6 visualization of Paraffin sections after GUS histochemical staining of seeds

Peeling the seeds of the pod, adding GUS staining solution (10mmol/LEDTA, 100mmol/L sodium phosphate buffer pH7.0, 0.1mol/L K)₃[Fe(CN)₆]，0.1mol/L K₄[Fe(CN)₆]0.1% (V/V) Triton X-100,5mg/ml X-Glue) in a centrifuge tube and stained in a 37.0 ℃ incubator for 3 hours. The dyed seeds are taken out and immediately put into FAA (38% formaldehyde 5 ml: glacial acetic acid 5 ml: 70% alcohol 90ml) fixing solution, and the fixing solution is washed away by tap water for 2-3 times after the treatment for 1-24 h. After the dehydration of grade 6 by the conventional ethanol-tert-butanol method, the wax is dipped and embedded by the conventional method. The paraffin-embedded seeds were sectioned on a microtome, and the thickness of the sections was controlled to 10-15 μm. After the sections were naturally air-dried, they were deparaffinized with xylene and mounted, and then observed under a microscope and photographed.

And (3) transferring the PMEI _ D, wherein the GUS staining result of GUS gene Arabidopsis is shown in figure 7, and the result shows that GUS is only expressed in the seeds of the transgenic Arabidopsis and is not expressed in tissues such as leaves, cotyledons, roots, petals, stamens, gynoecium pericarps and the like. The promoter was shown to have seed expression specificity and to be expressed mainly in endosperm and cotyledon (FIG. 8). Therefore, the gene engineering modification of plant seeds can be used for driving the specific expression of target genes in the seeds, and has important application value.

The above examples show that the nucleotide length of the cloned PMEI _ D promoter is 1922bp, and the promoter can guide GUS reporter gene to express in seeds in Arabidopsis after being fused with the reporter gene.

The above detailed description of the invention does not limit the invention, and those skilled in the art can make various modifications and changes according to the invention without departing from the spirit of the invention, which is defined by the appended claims.

SEQ ID No.1

attctatgttgatataaggtcagcgaactttttttttatatttaacattatttaaataaaaaacattaatatttttttta

catgcatttacaatttcaagcaaaatttttaatatttaaacaaaaaatatttttttaattattatttgatatattaagga

aaccgcttttgaactttacaaaattaaaaaatagtcaaggttaggaccgaaatcagaaaatttttaaggggtcaaaatta

aattgtaatttttacgatgacaaaaatataatttcactattttaatagcctatatctttataatttaatagtctaaatgt

aaaactttccataggggccggagcctctactagcccctagtttcgcccttggtcaaggtgacttatttatttaatattta

cttttttaaaatattgatttaagaaatataatatttttgtaaaccaaatagttgtatatttaaggataattatgttattt

aatttttataaaaaatttaaataataaaaaagtgaaagataaaaaaataaagaaaaatgaagattatttggtggttaaag

gagtgagtaaataaacactaaaaattctatcacatatatgtagggggaaatcatgtatttagaatacatattattaatat

atatatacacaattgatgtaagtaataaattgtgcataataaaattaaaatatataaaataaataaattaaaattttagt

tgagtggtaaattggagattctgcaaacttaattggtataggttcaaatcttattatgtgcatttttttattatttaaaa

aaaattaaagtactctcaaataatataatttattataaatgcaaagggacattaaaataattttcctaacaaatgtaact

atatatttactaacttaaaatgtttgactgagtcagtgccacaagtcaattgaataccaactcgaataagaaatgattaa

aaaaattatatttaaaaatttgaaaatattatgatgggtatgttttttatatttgatacaaaatctataagaaaacaatt

taaacaaaaaaaatccatttatttattatttatatagttatttttcattcatatatattggatctgcccatatataacca

cttaaactaacaaattataggtatagtaacttatttggtccgtcaactttacataaaaaaattattttagcatttcattt

aattttttttttttatctttaaaacttatattatttgtcagcttactcaaaaatggatggaaaattaactttattgatgt

gacatgcacgtggtctgtcacattagcaattaattaatttttaaaaatttaaaaattttaaaaaaaccaaataatattac

aaatttatttaaaaattattaaattatcaaaaaaataaaaataaaaaactattgtttaaaatatttttaatttttaaaaa

atcaattaattgctgacgtacacgtggactgccacatcagcaaagttaacaaacaccaattttgtcgatttttgctcgtc

gctttggaccatccgaggttgattttattgtcgcattaagtgctcgcaatcacttgagatatgttgtgcttgagttgtga

taaagccaattatcaatgtgtcataatgtactattgatgttgatggagcttatcattcatcatctatggcgagtgtttgc

tattttttttattttttgaatgaattaataaatttacctttcaaaacaaataaaaataaaaatttaaatattaaaagaga

agaaaaacaaataaaaagttaaaatatatttttataaaaataaaaggacaaataagtcattatagttcaatcatattaaa

tgaattcttaagcgtatgttataagtatataaataatcaacactaccacaaagagctccatatcagcttaacaaaatcat

cc

SEQ ID NO.2

Ghhis1 gaa gcc tca tcg ata ccg tc

SEQ ID NO.3

Ghhis2 cta cca cta cca tca tgg c

SEQ ID NO.4

PMEI-1 cgaccttgataaacaacatgacgac

SEQ ID NO.5

PMEI-2 gagcgcttgtttcaccagaag

SEQ ID NO.6

PMEI_D-up tgattacgccaagcttattctatgttgatataaggtcaagc

SEQ ID NO.7

PMEI_D-dn acctacccggggatccggatgattttgttaagctgatatgg

SEQ ID NO.8

GUS-1:agcgtaatgctctacaccacg

SEQ ID NO.9

GUS-2:gtaatgcg aggtacggtagg

Primary references

Doshi,K.M.,Loukanina,N.N.,Polowick,P.L.et al.(2016)Seed specificexpression and analysis of recombinant human adenosine deaminase(hADA)inthree host plant species Transgenic Res 25(5):629-637.https://doi.org/ 10.1007/s11248-016-9951-7

Junko K.M.，Marii，Saorieket al.(2006)Production of trans-10，cis-12conjugated linoleic acid in rice.Transgenic Res，15(1)：95-100

Kuwano M.Mimura T.Takaiwa F.et al.(2009)Generation of stable‘lowphytic acid’transgenic rice through antisense repression of the 1d-myo-inositol 3-phosphate synthase gene(RINO1)using the 18kDa oleosin promoterPlant Biotechnology Journal，7(1):96-105

Lee，E.J.，Oh，M，Hwang，J.U.，Li，B.Y.，Nishida，I.，Lee，Y.S.(2017) Seed-Specific Overexpression of the Pyruvate Transporter BASS2Increases OilContent in Arabidopsis Seeds Front.Plant Sci.,8(194)https://doi.org/10.3389/ fpls.2017.00194

Lewis (2005) gene VIII p669-705

Na G.N.,Aryal N.,Fatihi A.,Kang J.L.,Lu C.F.(2018)Seed-specificsuppression of ADP-glucose pyrophosphorylase in Camelina sativa increasesseed size and weight,Biotechnology for Biofuels，11:330

Tang，G.Y.,Xu，P.L.,Ma，W.H.,Wang，F.,Liu，Z.J.,Wan，S.B.,Shan， L.(2018)Seed-Specific Expression of AtLEC1Increased Oil Content and Altered FattyAcid Composition in Seeds of Peanut(Arachishypogaea L.),Frontiers in PlantScience 9(260)DOI10.3389/fpls.2018.00260

TomlinsonKL，MchughS，LabbeH et al.(2004)Evidence that the hexose-to-sucrose ratio does not control the switch to storage product accumulation inoilseeds:analysis of tobacco seed development and effects of overexpressingapoplasticinvertase.Journal of Experimental Botany，55(406)：2291-2303

Liuqiaoquan, Yaoquan flood, Wanghong plum, Guminghong (2004) transgenic rice endosperm expression iron binding protein to improve rice iron content genetics report 31 (5): 518-524.

SEQUENCE LISTING

<110> university of southwest

<120> ovule-specific promoter PMEI _ d and application thereof

<130>CQ302-19P122650

<160>9

<170>PatentIn version 3.3

<210>1

<211>1922

<212>DNA

<213>Gossypium hirsutum L.cv Jimian 14

<400>1

attctatgtt gatataaggt cagcgaactt tttttttata tttaacatta tttaaataaa 60

aaacattaat atttttttta catgcattta caatttcaag caaaattttt aatatttaaa 120

caaaaaatat ttttttaatt attatttgat atattaagga aaccgctttt gaactttaca 180

aaattaaaaa atagtcaagg ttaggaccga aatcagaaaa tttttaaggg gtcaaaatta 240

aattgtaatt tttacgatga caaaaatata atttcactat tttaatagcc tatatcttta 300

taatttaata gtctaaatgt aaaactttcc ataggggccg gagcctctac tagcccctag 360

tttcgccctt ggtcaaggtg acttatttat ttaatattta cttttttaaa atattgattt 420

aagaaatata atatttttgt aaaccaaata gttgtatatt taaggataat tatgttattt 480

aatttttata aaaaatttaa ataataaaaa agtgaaagat aaaaaaataa agaaaaatga 540

agattatttg gtggttaaag gagtgagtaa ataaacacta aaaattctat cacatatatg 600

tagggggaaa tcatgtattt agaatacata ttattaatat atatatacac aattgatgta660

agtaataaat tgtgcataat aaaattaaaa tatataaaat aaataaatta aaattttagt 720

tgagtggtaa attggagatt ctgcaaactt aattggtata ggttcaaatc ttattatgtg 780

cattttttta ttatttaaaa aaaattaaag tactctcaaa taatataatt tattataaat 840

gcaaagggac attaaaataa ttttcctaac aaatgtaact atatatttac taacttaaaa 900

tgtttgactg agtcagtgcc acaagtcaat tgaataccaa ctcgaataag aaatgattaa 960

aaaaattata tttaaaaatt tgaaaatatt atgatgggta tgttttttat atttgataca 1020

aaatctataa gaaaacaatt taaacaaaaa aaatccattt atttattatt tatatagtta 1080

tttttcattc atatatattg gatctgccca tatataacca cttaaactaa caaattatag 1140

gtatagtaac ttatttggtc cgtcaacttt acataaaaaa attattttag catttcattt 1200

aatttttttt ttttatcttt aaaacttata ttatttgtca gcttactcaa aaatggatgg 1260

aaaattaact ttattgatgt gacatgcacg tggtctgtca cattagcaat taattaattt 1320

ttaaaaattt aaaaatttta aaaaaaccaa ataatattac aaatttattt aaaaattatt 1380

aaattatcaa aaaaataaaa ataaaaaact attgtttaaa atatttttaa tttttaaaaa 1440

atcaattaat tgctgacgta cacgtggact gccacatcag caaagttaac aaacaccaat 1500

tttgtcgatt tttgctcgtc gctttggacc atccgaggtt gattttattg tcgcattaag 1560

tgctcgcaat cacttgagat atgttgtgct tgagttgtga taaagccaat tatcaatgtg 1620

tcataatgta ctattgatgt tgatggagct tatcattcat catctatggc gagtgtttgc 1680

tatttttttt attttttgaa tgaattaata aatttacctt tcaaaacaaa taaaaataaa 1740

aatttaaata ttaaaagaga agaaaaacaa ataaaaagtt aaaatatatt tttataaaaa 1800

taaaaggaca aataagtcat tatagttcaa tcatattaaa tgaattctta agcgtatgtt 1860

ataagtatat aaataatcaa cactaccaca aagagctcca tatcagctta acaaaatcat 1920

cc 1922

<210>2

<211>20

<212>DNA

<213>Synthetic

<400>2

gaagcctcat cgataccgtc 20

<210>3

<211>19

<212>DNA

<213>Synthetic

<400>3

ctaccactac catcatggc 19

<210>4

<211>25

<212>DNA

<213>Synthetic

<400>4

cgaccttgat aaacaacatg acgac 25

<210>5

<211>21

<212>DNA

<213>Synthetic

<400>5

gagcgcttgt ttcaccagaa g 21

<210>6

<211>41

<212>DNA

<213>Synthetic

<400>6

tgattacgcc aagcttattc tatgttgata taaggtcaag c 41

<210>7

<211>41

<212>DNA

<213>Synthetic

<400>7

acctacccgg ggatccggat gattttgtta agctgatatg g 41

<210>8

<211>21

<212>DNA

<213>Synthetic

<400>8

agcgtaatgc tctacaccac g 21

<210>9

<211>20

<212>DNA

<213>Synthetic

<400>9

gtaatgcgag gtacggtagg 20

Claims (7)

1, kinds of ovule-specific promoter PMEI _ d, characterized in that, its nucleotide sequence is shown in SEQ ID No. 1.

2. An expression vector comprising the promoter PMEI _ d according to claim 1.

3. A host comprising the vector of claim 2.

4. The host of claim 3, wherein: the host is agrobacterium tumefaciens.

5. Use of the promoter PMEI _ d according to claim 1 for the preparation of transgenic plants.

6. The use of the promoter PMEI _ d according to claim 1 in modified ovules.

7. A method for producing a transgenic plant containing the promoter PMEI _ d according to claim 1, comprising the steps of:

(1) the promoter is operably inserted into an expression vector to construct a plant expression vector;

(2) transforming a host with the plant expression vector to obtain a transformant;

(3) and transforming the transformant into a target plant to obtain a transgenic plant.

Images