CN105543229B - Rice chitin exciton combination gene promoter and its application - Google Patents
Rice chitin exciton combination gene promoter and its application Download PDFInfo
- Publication number
- CN105543229B CN105543229B CN201610109317.8A CN201610109317A CN105543229B CN 105543229 B CN105543229 B CN 105543229B CN 201610109317 A CN201610109317 A CN 201610109317A CN 105543229 B CN105543229 B CN 105543229B
- Authority
- CN
- China
- Prior art keywords
- rice
- polynucleotides
- expression
- promoter
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8225—Leaf-specific, e.g. including petioles, stomata
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8226—Stem-specific, e.g. including tubers, beets
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Abstract
The invention discloses rice chitin exciton binding proteins（Chitin elicitor binding protein）Gene promoter（OsCEBiPP）, belong to field of plant genetic.Promoter of the present invention controls rice chitin exciton binding-protein gene specifically expressing only in Rice Vascular Bundle or vascular bundle phloem cell from the nucleotide sequence shown in SEQ ID No.1.Comparative analysis finds that CGTCA motif function element may regulate and control specifically expressing of the gene in phloem cell, and 5UTR Py rich stretch and GT1GMSCAM4 function element affects the transcriptional activity of overall length promoter.Promoter of the present invention can be used for foreign gene specifically expressing in Rice Vascular Bundle or vascular bundle bast.
Description
Technical field
The invention belongs to biotechnologys and botany field；It is opened more particularly to a kind of rice chitin exciton combination gene
The separation identification and application of mover.
Background technology
Rice is the hot spot plant of current agricultural production and scientific research, after rice full-length genome plan is completed,
The research of functional genome obtains more and more extensive concerns, particularly to some adjusting and controlling rice Important Agricultural character genes
Research is increasingly subject to the attention of researcher.
Chitin exciton albumen (OsCEBiP) is the receptor for being positioned at rice cell film surface, have extracellular LysM by
Binding domains, the albumen identify mycosin signal so as to excite the immune response of rice.First clone of Kaku et al.
OsCEBiP genes, it was demonstrated that it plays a significant role (Kaku etc., 2006Plant cells in the disease resistance response of plant
recognize chitin fragments for defense signaling through a plasma membrane
receptor.Proceedings of the National Academy of Sciences 103:11086-11091).And
The function of the gene promoter is not yet studied, and especially its mode of action is unclear.
Invention content
The purpose of the present invention is to provide a kind of rice chitin exciton knots with vascular tissue expression specificity
Hop protein gene promoter and its application.
In the first aspect of the present invention, a kind of polynucleotides of separation, the polynucleotides, positioned at rice chitin are provided
The range of the initiation codon ATG upstream 1807bp of matter exciton binding-protein gene OsCEBiP, sequence such as SEQ ID NO:1；
According to the search of plant cis-regulating element database (NEWPLACE and PLACE), promoter region provided by the present invention contains
There is the cis-acting elements (as shown in Figure 1 and Figure 2) of multiple tissue specificities.Promoter contains 1 abscisic acid and calcium ion response
Cis-acting elements ABRERATCAL, 3 disease resistance response response elements BIHD1OS, 2 jasmonic response element CGTCA-
Motif, 1 disease resistance response response element GT1GMSCAM4,1 drought resisting response element MBS, 1 wounding signal response element WUN-
8 masters such as motif, 10 disease-resistant response element WRKY71OS, 1 transcriptional activity controlling element 5UTR Py-rich stretch
The cis-acting elements wanted.
In embodiments of the present invention, it builds to obtain 6 including overall length using the promoter OsCEBiPP and truncates startup
The plant expression vector pCAMBIA1391Z-OsCEBiPP (as shown in Figure 3) of sub-piece, is respectively designated as C0.2, C0.4,
C0.6, C0.9, C1.3 and C1.8, by agrobcterium-mediated transformation by the carrier rice transformation kind, each length
Degree promoter observes the expression (as shown in Figure 4) of reporter gene beta-glucosidase GUS in callus period and young period；
C0.2, C0.4 can observe the expression of Reporter gene GUS in the vascular bundle of plant, and C0.6, C0.9, C1.3 can be in plant
Vascular bundle bast in observe the expression (as shown in Figure 5) of Reporter gene GUS, C0.2, C0.4, C0.6, C0.9, C1.3 and
The expression intensity of C1.8 reduces (as shown in Figure 6) successively.
Therefore, the present invention provides following polynucleotides：
(1)SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-164；
(2)SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-372；
(3)SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-556；
(4)SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-883；
(5)SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-1282；
It should be understood by those skilled in the art that the nucleotide sequence according to (1), (2), (3), (4), (5), replaces it
Change, lack and/or increase one or several nucleotide, it is also possible to obtain there is the nucleotides sequence of vascular tissue expression specificity
Row for example, in non-response original paper or effect original paper, replace one or several bases.In addition, those skilled in the art can be with root
It is obtained according to the sequence of SEQ ID NO.1 other with the control specifically expressed DNA function fragments of gene space-time, this function fragment
It is that can be enhanced gene expression, and the nucleotide sequence with vascular tissue expression specificity by brown paddy plant hopper damage induction.
Another aspect of the present invention, provide (1), (2), (3), (4), polynucleotides described in (5) purposes, for instructing
Target gene specifically expressing in plant vasular beam.
Another aspect of the present invention, provide (3), (4), polynucleotides described in (5) purposes, for instructing target gene
The specifically expressing in plant vasular beam bast.
In another aspect of this invention, a kind of carrier is provided, the carrier contain (1), (2), (3), (4),
(5) any one of polynucleotides, as promoter element.
In the preference of the present invention, target gene is operably connected under the promoter of the present invention, structure
It builds to obtain expression cassette, further the expression cassette can be imported plant expression vector, the recombinant expression for obtaining organizing specific expression carries
Body.Therefore, the expression the invention also includes the expression cassette built by above-mentioned promoter and containing above-mentioned promoter or expression cassette
Carrier or recombinant expression carrier.
Promoter of the present invention can be used for prepare transgenosis plant.For example, pass through agriculture bacillus mediated, particle bombardment and flower
The modes such as tube cell channel obtain genetically modified plants.So as to by introducing important agronomic trait gene, cultivate efficient spy
The plant of different expression so as to achieve the purpose that improve the breed, such as is introduced into resistant gene and is expressed in vascular bundle, is planted for improving
The ability of the anti-piercing sucking insect of object.
Pass through quantitative PCR and semiquantitive PCR, detection rice root, stem and leaf tissue chitin exciton binding protein base
Because OsCEBiP has expression in root, stem, leaf, wherein the expression quantity highest in spire.
By quantitative PCR technique, when detection rice chitin exciton binding-protein gene OsCEBiP is by brown paddy plant hopper feeding
Between relative expression quantity, it can be seen that with the increase of brown paddy plant hopper feeding time, the expression quantity of OsCEBiP gradually rises (such as Fig. 8
It is shown).
Advantages of the present invention and effect：
1st, promoter of the invention is organizing specific expression, can be used for gene in plant vascular bundle and vascular bundle bast
Specifically expressed research in cell.
2nd, promoter of the invention is disease-resistant pest-resistant related to plant, can be used for improving grinding for the pest-resistant reaction of plant disease-resistant
Study carefully.
Description of the drawings
Fig. 1 promoter sequences, underscore represent 5 ' UTR areas, box represent basal promoter element TATA-box or
CAAT-box。
Fig. 2 construct 6 overall lengths according to substep of the cis-acting elements on promoter sequence and truncate promoter vector
Schematic diagram, which contains 8 function element.
The physical map of each length expression vector pCAMBIA1391Z-OsCEBiPP of Fig. 3, the carrier contain hygromycin and resist
Property screening-gene, promoter be fused to gus gene 5 ' hold transcribed non-translated regions.
Fig. 4 .GUS Activity determinations scheme A：Callus period, B：Seed period, C：The seedling stage of 6 days, D：20 days seedling stage etc. is raw
It is long.As shown, in callus, the young root young shoot in 6 day seedling stage has blue in the spire in 20 day seedling stage.
20 day seedling stage of Fig. 5 transgenic leaf GUS dyeing after paraffin section observation, A-F be followed successively by C0.2, C0.4,
Paraffin section after C0.6, C0.9, C1.3 and C1.8 blade GUS dyeing.As shown, C0.2, C0.4 can be in the dimensions of plant
The expression of Reporter gene GUS is observed in tube bank, C0.6, C0.9, C1.3 can be observed in the vascular bundle bast of plant
The expression of Reporter gene GUS is not observed in the expression of Reporter gene GUS, C1.8.The position of GUS dyeing is indicated by an arrow.
Fig. 6 protein hybridizations analyze C0.2, C0.4, C0.6, C0.9, C1.3 and C1.8 blade Reporter gene GUS expression quantity.
As shown, C0.2, C0.4, C0.6, C0.9, C1.3, C1.8 expression intensity reduce successively.
The expression of Fig. 7 quantitative PCRs and semiquantitive PCR detection OsCEBiP genes in each histoorgan of rice.Actin is
Crt gene, YR：The young root of growth 18 days, YS：The young stem of growth 18 days, YL：The spire of growth 18 days, MR：It grows 67 days
Matured root, MS：The ripe stem of growth 67 days, ML：The climax leaves of growth 67 days.Data show OsCEBiP genes table in spire
Up to highest.
Fig. 8 quantitative PCR detections OsCEBiP are expressed by brown paddy plant hopper damage induction.Actin is crt gene, is inoculated with brown paddy plant hopper
0h, 6h, for 24 hours, after 48h, 72h, 96h gene expression quantity, the one-way analysis of variance data significance of SPSS, arbitrary two
Group data are compared, and have the different letter designation of data of significant difference.Data show that OsCEBiP is being inoculated with brown fly
After lice, expression quantity significantly raises, these illustrate OsCEBiP really by brown paddy plant hopper damage induction.
Specific embodiment
By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.The implementation provided
Example is only explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
In addition, any method similar or impartial to described content and material all can be applied in the present invention.
【Embodiment 1】The separation and identification of promoter
Inventor chooses the initiation codon ATG upstreams of rice chitin exciton binding-protein gene OsCEBiP
The range of 1807bp carries out PCR amplification as alternate promoters region.According to the position of cis-acting elements, design primer is used for
Vector construction is shown in Table shown：
With the genomic DNA of rice material B5, (CTAB methods extract, Zhang QF etc., 1992, Genetic diversity
and differentiation of indica and japonica rice detected by RFLP
Anaysis.Theor.Appl.Genet.83,495-499) it is that template carries out PCR amplification, using high-fidelity enzyme KOD-Plus-
Neo (TOYOBO, Japan) 50 μ l reaction systems amplification.PCR conditions are：94 DEG C of pre-degeneration 2min, 98 DEG C of denaturation 10s, 68 DEG C are moved back
Fire extension 30s/kb, 40 cycles.PCR system is as follows：
It is connected on pGEM-T carriers after PCR product recycling, coupled reaction：1 0.5 μ l, 1U T4 of μ l, pGEM-T of PCR product
2 μ l of ligase, 5 × buffer, total 10 μ l volumes, 4 DEG C of connections are overnight；Connection product and Escherichia coli TOP10 mixings, 42 DEG C
Heat shock 90s adds 500 μ l LB, recovery 45min, and 200 μ l is taken to be applied to the LB tablets of the mycin of benzyl containing ammonia, 37 DEG C, are stayed overnight.Screening is positive
It clones and is sequenced.As a result as shown in SEQ ID No.1.By sequence inputting NEWPLACE and PLACE databases, that is, give this
Promoter has spatial and temporal expression specificity and disease resistance response response element (Fig. 1 and Fig. 2) comprising multiple, according to each function element
Distribution amplification it is other 5 truncate promoter fragment (Fig. 2).
【Embodiment 2】Promoter expression activity is identified
The gus gene expression vector of the embodiment of the present invention structure promoter is simultaneously transformed into rice varieties, GUS colour developing observations
The organizing specific expression activity of the promoter.Concrete operations are as follows：
First by PCR product Hind III/BamH I and EcoR I double digestions, pCAMBIA1391Z carriers are also with similary
Digestion, kits recycling, connect, sequencing.Correct clone's electricity is turned into Agrobacterium EHA105.Using Agrobacterium EHA105
Genetic transforming method (Hiei etc., 1994, Efficient transformation of rice (Oryza sativa of mediation
L.)mediated by Agrobacterium and sequence analysis of the boundaries of the
T-DNA.Plant Journal 6:271-282) by genome vector Introduced into Rice kind.
The homozygous positive plant of single copy will be obtained after the rotaring gene breeding of acquisition, to groups such as its callus, seed, seedling leafs
It knits and carries out GUS vital stainings (Lagarde D etc., 1996, Tissue-specific expression of respectively
Arabidopsis AKT1 gene is consistent with a role in K+nutrition.Plant J.9,195–
203).Material is taken pictures in stereoscopic sem observation after dyeing.Observation indicate that in callus, the young root young shoot in 6 day seedling stage, 20
Its seedling leaf has blue (Fig. 4)；Specimens paraffin embedding slices are carried out to the rice leaf tissue in 20 day seedling stage, glass slide is placed in aobvious
(Olympus BX51) microscopy is taken pictures under micro mirror, the results showed that, C0.2 and C0.4 can observe report in the vascular bundle of plant
The expression of gene GUS is accused, C0.6, C0.9 and C1.3 can observe Reporter gene GUS in the vascular bundle bast of plant
It expresses (Fig. 5)；Plant 100mg leaf tissues grind into powder in liquid nitrogen is taken, adds in 750 μ l Ugp protein extracts
(Ciereszko etc., 2001, Phosphate status affects the gene expression, protein
content and enzymatic activity of UDP-glucose pyrophosphorylase in wild-type
and pho mutants of Arabidopsis.Planta 212:598-605.), protein hybridization is carried out with GUS antibody.It sees
Examine the result shows that, C0.2, C0.4, C0.6, C0.9, C1.3, C1.8 expression intensity reduce (Fig. 6) successively.Comparative analysis discovery,
CGTCA-motif function element may regulate and control specifically expressing of the gene in phloem cell, 5UTR Py-rich
Stretch and GT1GMSCAM4 function element affects the transcriptional activity of overall length promoter.
Embodiment 3：The tissue specific expression of rice chitin exciton binding-protein gene OsCEBiP
With acceptor material Hejiang 19 (also known as H1493, purchased from national Rice Germplasm Resources library) for research material, to growth
18 day seedling stage and 67 day heading stage of growth, root, stem and leaf tissue 2g is taken to immerse in liquid nitrogen preserve immediately respectively.Use RNAiso
Plus (TaKaRa) extracts total serum IgE, then uses RevertAidTM first strand cDNA synthesis kit
(Fermentas) reversion synthesis the first chains of cDNA.With CFX96 TouchTM Real-Time PCR Detection System
(Bio-Rad) quantitative PCR detection is carried out to the OsCEBiP of different tissues.The 8ul reaction systems of PCR are：DNase/RNase-
Free ddH2O 2.9 μ l, 2 × Supermix 4 μ l, 0.6 μ l, cDNA template of primer (5mM), 0.5 μ l.Reaction condition：95 DEG C of changes
Property 2min；95 DEG C of denaturation 5-10s, TM annealing extension 10-60s, 40 cycles；65-95 DEG C, 0.5 DEG C of often step increase, 5s, which is done, to be dissolved
Curve is with the specificity of determining amplified production.
OsCEBiP quantifies primer：
F:CCACGCTTCTCACCAGAAAT
R:CTGATTGATGAACGGCACAC primer sizes 97bp.
With BIO-RAD MyCyler Thermal Cyler to the chitin exciton binding-protein gene of different tissues
OsCEBiP carries out semiquantitive PCR detection.The 10 μ l reaction systems of PCR：0.3 μ l, 1XPCR buffer (Mg of cDNA templates2+),
DNTP 1mM, primer 2 μM, Fermentas Taq DNA Polymerase 0.3U add aqua sterilisa to 10ul.Reaction condition is：
94℃4min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 40 cycles.Using actin as reference gene, same PCR system and
Reaction condition.
OsCEBiP sxemiquantitative primers：
F:GGGTGACGGAGTCCACGCTTCT
R:CAGGCTGTTGTCTGATTAGTTGC primer sizes 394bp.
Data show that OsCEBiP genes have expression in root, stem, leaf, wherein the expression quantity highest in spire.
【Embodiment 4】Rice chitin exciton binding-protein gene OsCEBiP is by brown paddy plant hopper induced expression
Using acceptor material H1493 as research material, sow to two leaves wholeheartedly when be inoculated with brown paddy plant hopper, and using be not inoculated with as pair
According to.0h, 6h, for 24 hours, after 48h, 72h, 96h, take leaf sheath 2g and be encapsulated in liquid nitrogen to preserve.RNA, reversion are extracted with the above method
Record, quantitative PCR.As a result show that OsCEBiP expresses apparent up-regulation after by brown paddy plant hopper feeding, which may take part in rice to brown
The responsing reaction (Fig. 8) of plant hopper.It is disease-resistant anti-in inference rice chitin exciton binding-protein gene promoter (OsCEBiPP)
Answer response element BIHD1OS and the cis-acting elements WUN-motif and WRKY71OS that are raised by stress-inducing so that CEBiP
Gene has played effect in disease resistance response and pest-resistant reaction.
SEQUENCE LISTING
<110>Wuhan University
<120>Rice chitin exciton combination gene promoter and its application
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 1807
<212> DNA
<213> Oryza sativa
<400> 1
ccaccccttt cgagaggagc tctccaccct tactctccga accacaaaca aactgacagc 60
acaactgtga cctcgtcctc ctcatacgga gctacgatca cgaacaccgc tgaatttacc 120
aacgtcgcac ccggaaaggg ataggaaacc aaactaacgt agtttcatct tttaccactt 180
gaacacacct taactaacca aactcagtct gaacctcttg ttttttagtg actttaaagt 240
tttaatggct acctttaaac tgatgtttgc aatcggtacg tacgtcgaat cgcagaagtt 300
cccctcgaac tgatgcgatt ctgaaaccgt tgggttcagt ccgattaatt taacgtgttc 360
tccggttaga cctgaagttt cagtgtttac acttgctcat cggagcaggt gccgtcgtgt 420
gaacctatgt tcgtcctgtc tgtccggcct cgacctacgc tccttttacc tttgtcgtcc 480
cgcttcaact gcagagaagc ggtgtgtttg gttgtcggtt tgtctccaca ggtgtagcgt 540
tccgttacga ttttttgcgc acctatagta actctcgaaa gaggaggcaa taaatatgcc 600
tcgaaaatac gtttttacgt gtacctattc gtatctctgt tatactagcg ctcggtgact 660
aataaagcgg attaactagt ttgtcgtcag gccttgctat tttgcgattc ggcgccttcc 720
ttttgtacga tgctttctta cttacttggt tacttgcgtt atgacgccaa ctaggggaaa 780
gatgtttctt acaaggggaa tgtccgtttt aacctttgga tacgtctttt cgaagagaaa 840
acatgaccgt gtccatactg agtaaggtct ccgcttcctc cgtacggacc acctagtagg 900
cttccacctc gacctctact tcgcgacttc agttatcaac ccatgtgagg accaccggaa 960
agctgtccaa catagctgtc ttcaacacaa ctcagaggtt gctgtagtcg ggtaggcatt 1020
actccgaggc gggattaact gttacgtgtc tagttgcggt ttaacattta gacttttatg 1080
aggcttctac agaccttctt ggtttgttct gtattagaat gagcatcatg cagaggagta 1140
gttgatggtt tagggtcgag agcggtcaac acgagaacgg cataaatact tgaaaagact 1200
ttatgttctc ttgttgtcat agattctttc gatgatgaca ttacggtcca tcatagcaac 1260
gttcttcttg gtaacgtctt actgtatatc acataatctt ttcctgttcg ggtacaccaa 1320
agttaagtaa ataattacag ttcacagtca gtttggttta cgctctggtc gcagtactac 1380
cttgtatggg taatggtttt acgagaagag gggttcaaga actggtagga ctttcatagt 1440
ttagtctatt cacctaccgt taacctttag tctattcagt attcagtgtg atgctcgcca 1500
cgtgtgtaaa ttgttacgtt atttgtccta gattgaagat ttggactcat acgtctgtca 1560
tctatgtcga gtatatattt tcgttgtaca attttatagg tcgtatcgaa ggttatctaa 1620
cgtggtcaca cttaaagccg gttacgtcgt ccgtttgaaa aagatacgta gtttccaggt 1680
ttccacgaat cgtaaatacg gattatggtc gtaggtttct cttgtttcgg gtagtagttc 1740
cacctatgac acgtatatat atttactgct actttgaatg ctagaggtgg tcccctatgt 1800
acggtac 1807
<210> 2
<211> 29
<212> DNA
<213>Artificial sequence
<400> 2
cccaagcttt tgatgcaatc aaaccaaag 29
<210> 3
<211> 28
<212> DNA
<213>Artificial sequence
<400> 3
cccaagcttc cagattggcc tcttgtgc 28
<210> 4
<211> 30
<212> DNA
<213>Artificial sequence
<400> 4
cccaagcttt tttttagcat tgccttgcga 30
<210> 5
<211> 27
<212> DNA
<213>Artificial sequence
<400> 5
cgcggatcct gcctccttcg cctctgg 27
<210> 6
<211> 31
<212> DNA
<213>Artificial sequence
<400> 6
cgcggatccc attctgcaat ggttcttctt g 31
<210> 7
<211> 28
<212> DNA
<213>Artificial sequence
<400> 7
cgcggatccc atggcatgta tcccctgg 28
<210> 8
<211> 29
<212> DNA
<213>Artificial sequence
<400> 8
ccggaattcg gtggggaaag ctctcctcg 29
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
ccacgcttct caccagaaat 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence
<400> 10
ctgattgatg aacggcacac 20
<210> 11
<211> 22
<212> DNA
<213>Artificial sequence
<400> 11
gggtgacgga gtccacgctt ct 22
<210> 12
<211> 23
<212> DNA
<213>Artificial sequence
<400> 12
caggctgttg tctgattagt tgc 23
Claims (7)
1. a kind of polynucleotides of separation, which is characterized in that the polynucleotides are：
（1）SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-164；
（2）SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-372；
（3）SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-556；
（4）SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-883；
（5）SEQ ID NO：The polynucleotides of nucleotide sequence in 1 shown in 1-1282；
In any one, the SEQ ID NO：1 is the promoter of rice chitin exciton binding-protein geneOsCEBiPThe nucleotide sequence of P, SEQ ID NO in sequence table：1 direction is 3 ' → 5 ', polynucleotides（1）-（5）In rice
Specifically expressing in vascular bundle, polynucleotides（3）、（4）、（5）The specifically expressing in Rice Vascular Bundle bast.
2. the expression cassette that polynucleotides described in claim 1 are built as promoter.
3. the plant expression vector containing expression cassette described in polynucleotides described in claim 1 or claim 2.
4. carrier as claimed in claim 3 is pCAMBIA1391Z-OsCEBiPP.
5. the expression described in the expression cassette or claim 3 or 4 described in polynucleotides described in claim 1, claim 2 carries
Body prepares the application in transgenic paddy rice.
6. the expression described in the expression cassette or claim 3 or 4 described in polynucleotides described in claim 1, claim 2 carries
Application of the body in organizing specific expression rice is cultivated.
7. the expression described in the expression cassette or claim 3 or 4 described in polynucleotides described in claim 1, claim 2 carries
Application of the body in novel disease-resistant insect-proof rice is cultivated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109317.8A CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109317.8A CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105543229A CN105543229A (en) | 2016-05-04 |
| CN105543229B true CN105543229B (en) | 2018-06-19 |
Family
ID=55822787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610109317.8A Active CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543229B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116515889A (en) * | 2023-05-15 | 2023-08-01 | 北京林业大学 | Plant leaf tissue specific expression DNA regulatory element and application thereof |
| CN116478998B (en) * | 2023-06-07 | 2024-01-23 | 河北科技大学 | Rice phloem specific expression promoter POs04g0452500 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1492925A (en) * | 2001-01-05 | 2004-04-28 | �ձ��̲ݲ�ҵ��ʽ���� | Rice sucrose transporter gene promoter |
| CN1761751A (en) * | 2003-01-23 | 2006-04-19 | 得克萨斯科技大学 | Chitinase encoding DNA molecules from cotton expressed preferentially in secondary walled cells during secondary wall deposition and a corresponding promoter |
| CN103740719A (en) * | 2013-12-30 | 2014-04-23 | 安徽省农业科学院水稻研究所 | Separation and application of rice vascular bundle specific expression promoter POsvas 1 |
-
2016
- 2016-02-26 CN CN201610109317.8A patent/CN105543229B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1492925A (en) * | 2001-01-05 | 2004-04-28 | �ձ��̲ݲ�ҵ��ʽ���� | Rice sucrose transporter gene promoter |
| CN1761751A (en) * | 2003-01-23 | 2006-04-19 | 得克萨斯科技大学 | Chitinase encoding DNA molecules from cotton expressed preferentially in secondary walled cells during secondary wall deposition and a corresponding promoter |
| CN103740719A (en) * | 2013-12-30 | 2014-04-23 | 安徽省农业科学院水稻研究所 | Separation and application of rice vascular bundle specific expression promoter POsvas 1 |
Non-Patent Citations (3)
| Title |
|---|
| An OsCEBiP/OsCERK1-OsRacGEF1-OsRac1 module is an essential early component of chitin-induced rice immunity;Akira Akamatsu et al.;《Cell Host & Microbe》;20130417;465-476 * |
| Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor;Hanae Kaku et al.;《PNAS》;20060718;第103卷(第29期);11086-11091 * |
| 病原菌保守性特征分子及其介导的植物抗病性;戴景程 等;《微生物学通报》;20120420;第39卷(第4期);553-565 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105543229A (en) | 2016-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L. | |
| TWI414236B (en) | Corn event das-59122-7 and methods for detection thereof | |
| US7385105B2 (en) | Root active promoters and uses thereof | |
| CN104480117B (en) | NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN102994517A (en) | Rice MYB transcription factor protein gene OsMyb1 and application thereof | |
| CN107099535A (en) | A kind of promoter HLP4 induced by low temperature, high salt, arid or ABA | |
| CN109609527A (en) | CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| CN105543229B (en) | Rice chitin exciton combination gene promoter and its application | |
| Xiao et al. | An Agrobacterium-mediated transient expression method contributes to functional analysis of a transcription factor and potential application of gene editing in Chenopodium quinoa | |
| CN105505932B (en) | A kind of plant inducible promoter and its application | |
| JP2022500039A (en) | Genes that modify resistance to beet necrotic leaf vein yellowing virus (BNYVV) | |
| CN104388433A (en) | Plant osmotic stress inducible promoter and application thereof | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| CN104017061A (en) | Transcription factor ZmbZIP17 as well as coding gene of transcription factor and application of transcription factor to stress response | |
| CN111454923A (en) | Application of soybean GmP5CDH gene | |
| US20160281101A1 (en) | Compositions and methods containing a specific leaf promoter to modify the expression of genes of interest in plants | |
| CN111808864A (en) | Novel application of GmMYB48 gene in improving plant phosphorus starvation stress tolerance | |
| CN113881699B (en) | Application of MAC3A and MAC3B in plant organ size regulation | |
| CN104152454A (en) | Soybean derived drought induced type promoter GmMYB363P and application thereof | |
| CN113005106B (en) | Application of corn low temperature resistant gene ZmCIPK10.1 in improving plant cold resistance | |
| WO2023168691A1 (en) | Methods and compositions for modifying flowering time genes in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |