CN105543229A - OsCEBiP (oryza sativa-Chitin elicitor binding protein) gene promoter and application thereof - Google Patents
OsCEBiP (oryza sativa-Chitin elicitor binding protein) gene promoter and application thereof Download PDFInfo
- Publication number
- CN105543229A CN105543229A CN201610109317.8A CN201610109317A CN105543229A CN 105543229 A CN105543229 A CN 105543229A CN 201610109317 A CN201610109317 A CN 201610109317A CN 105543229 A CN105543229 A CN 105543229A
- Authority
- CN
- China
- Prior art keywords
- polynucleotide
- gene
- plant
- expression
- oscebip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8225—Leaf-specific, e.g. including petioles, stomata
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8226—Stem-specific, e.g. including tubers, beets
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Abstract
The invention discloses an OsCEBiP (oryza sativa-Chitin elicitor binding protein) gene promoter and belongs to the technical field of plant genetic engineering. The promoter is derived from a nucleotide sequence represented as SEQ ID No.1, and an OsCEBiP gene is controlled to have specific expression only in cells of vascular bundles or vascular bundle phloem of oryza sativa. Comparative analysis indicates that a CGTCA-motif functional element possibly regulates and controls the specific expression of the gene in the phloem cells, and 5UTR Py-rich stretch and GT1GMSCAM4 functional elements influence transcriptional activity of an overall-length promoter. The promoter can be applied to the specific expression of an exogenous gene in the vascular bundles or vascular bundle phloem of oryza sativa.
Description
Technical field
The invention belongs to biotechnology and phytology field; Be specifically related to a kind of paddy rice chitin exciton in conjunction with the isolation identification of gene promoter and application.
Background technology
Paddy rice is the focus plant of current agriculture production and scientific research, after completing the plan of paddy rice full-length genome, the research of its functional genome obtains increasing extensive concern, particularly the research of some adjusting and controlling rice Important Agricultural character genes is subject to day by day to the attention of researchist.
Chitin exciton albumen (OsCEBiP) is the acceptor being positioned rice cell film surface, has the outer LysM receptor domain of born of the same parents, this albumen identification mykose signal thus excite the immune response of paddy rice.The people such as Kaku first have cloned OsCEBiP gene, prove that it plays a significant role in the disease resistance response of plant (Kaku etc., 2006Plantcellsrecognizechitinfragmentsfordefensesignalin gthroughaplasmamembranereceptor.ProceedingsoftheNational AcademyofSciences103:11086-11091).And the function of this gene promoter is not yet studied, especially its mode of action it be unclear that.
Summary of the invention
The object of the present invention is to provide a kind of paddy rice chitin exciton binding-protein gene promotor and the application thereof with vascular tissue expression specificity.
In a first aspect of the present invention, provide a kind of polynucleotide of separation, described polynucleotide, be positioned at the scope of the initiator codon ATG upstream 1807bp of paddy rice chitin exciton binding-protein gene OsCEBiP, sequence is as SEQIDNO:1; According to the search of plant cis-regulating element database (NEWPLACE and PLACE), promoter region provided by the present invention contains multiple tissue-specific cis-acting elements (as shown in Figure 1 and Figure 2).Promotor contains the cis-acting elements ABRERATCAL of 1 dormin and calcium ion response, 3 disease resistance response response element BIHD1OS, 2 jasmonic response element CGTCA-motif, 1 disease resistance response response element GT1GMSCAM4,1 drought resisting response element MBS, 1 wounding signal response element WUN-motif, 10 disease-resistant response element WRKY71OS, the cis-acting elements that 1 transcriptional activity controlling element 5UTRPy-richstretch etc. 8 are main.
In embodiments of the present invention, utilize described promotor OsCEBiPP to build and obtain the plant expression vector pCAMBIA1391Z-OsCEBiPP (as shown in Figure 3) that 6 comprise total length and brachymemma promoter fragment, called after C0.2 respectively, C0.4, C0.6, C0.9, C1.3 and C1.8, by agrobcterium-mediated transformation by described vector rice varieties, each length promotor observes the expression (as shown in Figure 4) of reporter gene beta-glucosidase GUS in callus period and young period; C0.2, C0.4 can observe the expression of Reporter gene GUS in the vascular bundle of plant, C0.6, C0.9, C1.3 can observe the expression (as shown in Figure 5) of Reporter gene GUS in the vascular bundle phloem of plant, C0.2, C0.4, the expression intensity of C0.6, C0.9, C1.3 and C1.8 reduces (as shown in Figure 6) successively.
Therefore, the invention provides following polynucleotide:
(1) polynucleotide of the nucleotide sequence shown in 1-164 position in SEQIDNO:1;
(2) polynucleotide of the nucleotide sequence shown in 1-372 position in SEQIDNO:1;
(3) polynucleotide of the nucleotide sequence shown in 1-556 position in SEQIDNO:1;
(4) polynucleotide of the nucleotide sequence shown in 1-883 position in SEQIDNO:1;
(5) polynucleotide of the nucleotide sequence shown in 1-1282 position in SEQIDNO:1;
Those skilled in the art are to be understood that according to (1), (2), (3), (4), the nucleotide sequence shown in (5), it is replaced, lacks and/or increase one or several Nucleotide, also the nucleotide sequence with vascular tissue expression specificity can be obtained, such as, at non-response original paper or effect original paper, replace one or several base.In addition, those skilled in the art can also obtain according to the sequence of SEQIDNO.1 the DNA function fragment that other has controlling gene space-time specifically expressing, this function fragment to be subject to brown paddy plant hopper damage induction, reinforcing gene expression, and the nucleotide sequence with vascular tissue expression specificity.
Another aspect of the present invention, provides the purposes of (1), (2), (3), (4), polynucleotide described in (5), is used to guide goal gene at the intrafascicular specifically expressing of plant vasular.
Another aspect of the present invention, provides the purposes of (3), (4), polynucleotide described in (5), is used to guide goal gene specifically expressing in plant vasular bundle phloem.
In another aspect of this invention, provide a kind of carrier, described carrier contain described (1), (2), (3), (4), (5) polynucleotide any one, as promoter element.
In a preference of the present invention, goal gene is operably connected under promotor of the present invention, builds and obtain expression cassette, this expression cassette can be imported plant expression vector further, obtain the recombinant expression vector of organizing specific expression.Therefore, the present invention also comprises the expression cassette built by above-mentioned promotor, and contains expression vector or the recombinant expression vector of above-mentioned promotor or expression cassette.
Promotor of the present invention may be used for preparing transgenic plant.Such as, transgenic plant are obtained by agriculture bacillus mediated, the mode such as particle bombardment and pollen tube channel.Thus by introducing important agronomic trait gene, the plant of efficient specifically expressing can be cultivated, thus reach the object of improving the breed, such as introduce resistant gene and express in vascular bundle, be used for improving the ability of Genes For Plant Tolerance piercing sucking insect.
By quantitative PCR and semiquantitive PCR, detect rice root, stem and leaf tissue chitin exciton binding-protein gene OsCEBiP has expression in root, stem, leaf, and wherein in spire, expression amount is the highest.
Pass through quantitative PCR technique, detect paddy rice chitin exciton binding-protein gene OsCEBiP takes food time relative expression quantity by brown paddy plant hopper, can see that the expression amount of OsCEBiP raises (as shown in Figure 8) gradually along with brown paddy plant hopper takes food the increase of time.
Advantage of the present invention and effect:
1, promotor of the present invention is organizing specific expression, may be used for the research of the specifically expressing of gene in plant vascular bundle and vascular bundle phloem cell.
2, promotor of the present invention and plant is disease-resistant pest-resistant relevant, may be used for the research improving the pest-resistant reaction of plant disease-resistant.
Accompanying drawing explanation
Fig. 1. promoter sequence, underscore represents 5 ' UTR district, box indicating basal promoter element TATA-box or CAAT-box.
Fig. 2. construct the schematic diagram of 6 total lengths and brachymemma promoter vector according to the substep of cis-acting elements on promoter sequence, this promotor contains 8 functional element.
Fig. 3. the physical map of each length expression vector pCAMBIA1391Z-OsCEBiPP, this carrier contains hygromycin resistance screening-gene, and promotor is fused to gus gene 5 ' and holds transcribed non-translated regions.
Fig. 4 .GUS Activity determination, figure A: callus period, B: seed period, the seedling stage of C:6 days, the growths such as the seedling stage of D:20 days.As figure shows, at callus, the young root young shoot in 6 day seedling stage, has blueness in the spire in 20 day seedling stage.
Paraffin section after the transgenic leaf GUS in Fig. 5 .20 days seedling stage dyes is observed, A-F be followed successively by C0.2, C0.4, C0.6, C0.9, C1.3 and C1.8 blade GUS dye after paraffin section.As figure shows, C0.2, C0.4 can observe the expression of Reporter gene GUS in the vascular bundle of plant, C0.6, C0.9, C1.3 can observe the expression of Reporter gene GUS in the vascular bundle phloem of plant, and C1.8 does not observe the expression of Reporter gene GUS.The position of GUS dyeing represents with arrow.
Fig. 6. protein hybridization analyzes C0.2, C0.4, C0.6, C0.9, C1.3 and C1.8 blade Reporter gene GUS expression amount.As figure shows, C0.2, C0.4, C0.6, C0.9, C1.3, C1.8 expression intensity reduces successively.
Fig. 7. quantitative PCR and semiquantitive PCR detect the expression of OsCEBiP gene in each histoorgan of paddy rice.Actin is crt gene, YR: the young root growing 18 days, YS: the young stem growing 18 days, YL: the spire growing 18 days, MR: the matured root growing 67 days, MS: the ripe stem growing 67 days, ML: the climax leaves growing 67 days.Data presentation OsCEBiP gene is expressed the highest in spire.
Fig. 8. quantitative PCR detection OsCEBiP expresses by brown paddy plant hopper damage induction.Actin is crt gene, the expression amount of gene after inoculation brown paddy plant hopper 0h, 6h, 24h, 48h, 72h, 96h, the one-way analysis of variance data significance level of SPSS, any two groups of data compare, and have the different letter designation of data of significant difference.Data presentation OsCEBiP is after inoculation brown paddy plant hopper, and expression amount obviously raises, and these illustrate OsCEBiP really by brown paddy plant hopper damage induction.
Embodiment
The features and advantages of the invention can be understood further by reference to the accompanying drawings by following detailed description.The embodiment provided is only the explanation to the inventive method, and does not limit the present invention in any way all the other contents of announcement.
If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.
The separation andpreconcentration of [embodiment 1] promotor
The scope that contriver chooses the initiator codon ATG upstream 1807bp of paddy rice chitin exciton binding-protein gene OsCEBiP alternatively promoter region carries out pcr amplification.According to the position of cis-acting elements, design primer is used for vector construction, shown in Table:
With (the CTAB method extracting of the genomic dna of rice material B5, ZhangQF etc., 1992, Geneticdiversityanddifferentiationofindicaandjaponicaric edetectedbyRFLPanaysis.Theor.Appl.Genet.83,495-499) for template carries out pcr amplification, adopt high-fidelity enzyme KOD-Plus-Neo (TOYOBO, Japan) 50 μ l reaction system amplification.PCR condition is: 94 DEG C of denaturation 2min, 98 DEG C of sex change 10s, and 68 DEG C of annealing extend 30s/kb, 40 circulations.PCR system is as follows:
PCR primer is connected on pGEM-T carrier after reclaiming, ligation: PCR primer 1 μ l, pGEM-T0.5 μ l, 1UT4ligase, 5 × buffer2 μ l, total 10 μ l volumes, and 4 DEG C of connections are spent the night; Connect product and intestinal bacteria TOP10 to mix, 42 DEG C of heat shock 90s, add 500 μ lLB, recovery 45min, get 200 μ l and are applied to LB flat board containing ammonia benzyl mycin, 37 DEG C, spend the night.Screening positive clone also checks order.Result is as shown in SEQIDNo.1.By this sequence inputting NEWPLACE and PLACE database, namely give this promotor to comprise and multiple there is spatial and temporal expression specificity and disease resistance response response element (Fig. 1 and Fig. 2), according to other 5 the brachymemma promoter fragments (Fig. 2) of distribution amplification of each functional element.
[embodiment 2] promoter expression activity identification
Embodiments of the invention build the gus gene expression vector of promotor and are transformed into rice varieties, and the organizing specific expression that this promotor is observed in GUS colour developing is active.Concrete operations are as follows:
First by PCR primer HindIII/BamHI and EcoRI double digestion, pCAMBIA1391Z carrier is also cut with same enzyme, and kits reclaims, and connects, order-checking.Correct clone's electricity is turned Agrobacterium EHA105.Adopt the genetic transforming method (Hiei etc. of Agrobacterium EHA105 mediation, 1994, Efficienttransformationofrice (OryzasativaL.) mediatedbyAgrobacteriumandsequenceanalysisoftheboundarie softheT-DNA.PlantJournal6:271-282) by genome vector Introduced into Rice kind.
The positive plant that isozygotys is copied by obtaining list after the rotaring gene breeding of acquisition, its callus, seed, seedling leaf etc. are organized and carries out GUS active coloring (LagardeD etc. respectively, 1996, Tissue-specificexpressionofArabidopsisAKT1geneisconsiste ntwitharoleinK
+nutrition.PlantJ.9,195 – 203).After dyeing, material is observed at stereoscope and is taken pictures.Observations shows, at callus, and the young root young shoot in 6 day seedling stage, within 20 days, seedling leaf has blueness (Fig. 4); Specimens paraffin embedding slices is carried out to the rice leaf tissue in 20 day seedling stage, under slide glass is placed in microscope, (OlympusBX51) microscopy is taken pictures, result shows, C0.2 and C0.4 can observe the expression of Reporter gene GUS in the vascular bundle of plant, and C0.6, C0.9 and C1.3 can observe the expression (Fig. 5) of Reporter gene GUS in the vascular bundle phloem of plant; Get plant 100mg leaf tissue grind into powder in liquid nitrogen, add 750 μ lUgp protein extract (Ciereszko etc., 2001, Phosphatestatusaffectsthegeneexpression, proteincontentandenzymaticactivityofUDP-glucosepyrophosp horylaseinwild-typeandphomutantsofArabidopsis.Planta212: 598-605.), carry out protein hybridization with GUS antibody.Observations shows, C0.2, C0.4, C0.6, C0.9, C1.3, C1.8 expression intensity reduces (Fig. 6) successively.Comparative analysis finds, CGTCA-motif functional element may regulate and control the specifically expressing of gene in phloem cell, 5UTRPy-richstretch and GT1GMSCAM4 functional element have impact on the transcriptional activity of total length promotor.
Embodiment 3: the tissue specific expression of paddy rice chitin exciton binding-protein gene OsCEBiP
Be research material with acceptor material Hejiang 19 (having another name called H1493, purchased from national Rice Germplasm Resources storehouse), to its 18 day seedling stage of growth and 67 day heading stage of growth, get root, stem and leaf tissue 2g respectively and immerse in liquid nitrogen immediately and preserve.Extract total serum IgE with RNAisoPlus (TaKaRa), then use RevertAid
tMfirststrandcDNAsynthesiskit (Fermentas) reversion synthesis cDNA first chain.With CFX96TouchTMReal-TimePCRDetectionSystem (Bio-Rad), quantitative PCR detection is carried out to the OsCEBiP of different tissues.The 8ul reaction system of PCR is: DNase/RNase-FreeddH
2o2.9 μ l, 2 × Supermix4 μ l, primer (5mM) 0.6 μ l, cDNA template 0.5 μ l.Reaction conditions: 95 DEG C of sex change 2min; 95 DEG C of sex change 5-10s, TM annealing extends 10-60s, 40 circulations; 65-95 DEG C, often walk increase by 0.5 DEG C, 5s does solubility curve to determine the specificity of amplified production.
The quantitative primer of OsCEBiP:
F:CCACGCTTCTCACCAGAAAT
R:CTGATTGATGAACGGCACAC product size 97bp.
Semiquantitive PCR detection is carried out with the chitin exciton binding-protein gene OsCEBiP of BIO-RADMyCylerThermalCyler to different tissues.The 10 μ l reaction systems of PCR: cDNA template 0.3 μ l, 1XPCRbuffer (Mg
2+), dNTP1mM, primer 2 μM, FermentasTaqDNAPolymerase0.3U, adds aqua sterilisa to 10ul.Reaction conditions is: 94 DEG C of 4min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 40 circulations.Take actin as reference gene, same PCR system and reaction conditions.
OsCEBiP sxemiquantitative primer:
F:GGGTGACGGAGTCCACGCTTCT
R:CAGGCTGTTGTCTGATTAGTTGC product size 394bp.
Data presentation OsCEBiP gene has expression in root, stem, leaf, and wherein in spire, expression amount is the highest.
[embodiment 4] paddy rice chitin exciton binding-protein gene OsCEBiP is by brown paddy plant hopper abduction delivering
With acceptor material H1493 for research material, sow to two leaves wholeheartedly time inoculation brown paddy plant hopper, and not inoculate in contrast.After 0h, 6h, 24h, 48h, 72h, 96h, get leaf sheath 2g and be encapsulated in liquid nitrogen to preserve.RNA is extracted, reverse transcription, quantitative PCR with aforesaid method.Result display OsCEBiP takes food rear expression by brown paddy plant hopper and obviously raises, and this gene may take part in the responsing reaction (Fig. 8) of paddy rice to brown paddy plant hopper.In inference paddy rice chitin exciton binding-protein gene promotor (OsCEBiPP), disease resistance response response element BIHD1OS and cis-acting elements WUN-motif and WRKY71OS by stress-inducing rise, makes CEBiP gene play effect in disease resistance response and pest-resistant reaction.
SEQUENCELISTING
<110> Wuhan University
<120> paddy rice chitin exciton is in conjunction with gene promoter and application thereof
<160>12
<170>PatentInversion3.3
<210>1
<211>1807
<212>DNA
<213>Oryzasativa
<400>1
ccacccctttcgagaggagctctccacccttactctccgaaccacaaacaaactgacagc60
acaactgtgacctcgtcctcctcatacggagctacgatcacgaacaccgctgaatttacc120
aacgtcgcacccggaaagggataggaaaccaaactaacgtagtttcatcttttaccactt180
gaacacaccttaactaaccaaactcagtctgaacctcttgttttttagtgactttaaagt240
tttaatggctacctttaaactgatgtttgcaatcggtacgtacgtcgaatcgcagaagtt300
cccctcgaactgatgcgattctgaaaccgttgggttcagtccgattaatttaacgtgttc360
tccggttagacctgaagtttcagtgtttacacttgctcatcggagcaggtgccgtcgtgt420
gaacctatgttcgtcctgtctgtccggcctcgacctacgctccttttacctttgtcgtcc480
cgcttcaactgcagagaagcggtgtgtttggttgtcggtttgtctccacaggtgtagcgt540
tccgttacgattttttgcgcacctatagtaactctcgaaagaggaggcaataaatatgcc600
tcgaaaatacgtttttacgtgtacctattcgtatctctgttatactagcgctcggtgact660
aataaagcggattaactagtttgtcgtcaggccttgctattttgcgattcggcgccttcc720
ttttgtacgatgctttcttacttacttggttacttgcgttatgacgccaactaggggaaa780
gatgtttcttacaaggggaatgtccgttttaacctttggatacgtcttttcgaagagaaa840
acatgaccgtgtccatactgagtaaggtctccgcttcctccgtacggaccacctagtagg900
cttccacctcgacctctacttcgcgacttcagttatcaacccatgtgaggaccaccggaa960
agctgtccaacatagctgtcttcaacacaactcagaggttgctgtagtcgggtaggcatt1020
actccgaggcgggattaactgttacgtgtctagttgcggtttaacatttagacttttatg1080
aggcttctacagaccttcttggtttgttctgtattagaatgagcatcatgcagaggagta1140
gttgatggtttagggtcgagagcggtcaacacgagaacggcataaatacttgaaaagact1200
ttatgttctcttgttgtcatagattctttcgatgatgacattacggtccatcatagcaac1260
gttcttcttggtaacgtcttactgtatatcacataatcttttcctgttcgggtacaccaa1320
agttaagtaaataattacagttcacagtcagtttggtttacgctctggtcgcagtactac1380
cttgtatgggtaatggttttacgagaagaggggttcaagaactggtaggactttcatagt1440
ttagtctattcacctaccgttaacctttagtctattcagtattcagtgtgatgctcgcca1500
cgtgtgtaaattgttacgttatttgtcctagattgaagatttggactcatacgtctgtca1560
tctatgtcgagtatatattttcgttgtacaattttataggtcgtatcgaaggttatctaa1620
cgtggtcacacttaaagccggttacgtcgtccgtttgaaaaagatacgtagtttccaggt1680
ttccacgaatcgtaaatacggattatggtcgtaggtttctcttgtttcgggtagtagttc1740
cacctatgacacgtatatatatttactgctactttgaatgctagaggtggtcccctatgt1800
acggtac1807
<210>2
<211>29
<212>DNA
<213> artificial sequence
<400>2
cccaagcttttgatgcaatcaaaccaaag29
<210>3
<211>28
<212>DNA
<213> artificial sequence
<400>3
cccaagcttccagattggcctcttgtgc28
<210>4
<211>30
<212>DNA
<213> artificial sequence
<400>4
cccaagcttttttttagcattgccttgcga30
<210>5
<211>27
<212>DNA
<213> artificial sequence
<400>5
cgcggatcctgcctccttcgcctctgg27
<210>6
<211>31
<212>DNA
<213> artificial sequence
<400>6
cgcggatcccattctgcaatggttcttcttg31
<210>7
<211>28
<212>DNA
<213> artificial sequence
<400>7
cgcggatcccatggcatgtatcccctgg28
<210>8
<211>29
<212>DNA
<213> artificial sequence
<400>8
ccggaattcggtggggaaagctctcctcg29
<210>9
<211>20
<212>DNA
<213> artificial sequence
<400>9
ccacgcttctcaccagaaat20
<210>10
<211>20
<212>DNA
<213> artificial sequence
<400>10
ctgattgatgaacggcacac20
<210>11
<211>22
<212>DNA
<213> artificial sequence
<400>11
gggtgacggagtccacgcttct22
<210>12
<211>23
<212>DNA
<213> artificial sequence
<400>12
caggctgttgtctgattagttgc23
Claims (10)
1. the polynucleotide be separated, it is characterized in that, described polynucleotide are:
(1) polynucleotide of the nucleotide sequence shown in 1-164 position in SEQIDNO:1;
(2) polynucleotide of the nucleotide sequence shown in 1-372 position in SEQIDNO:1;
(3) polynucleotide of the nucleotide sequence shown in 1-556 position in SEQIDNO:1;
(4) polynucleotide of the nucleotide sequence shown in 1-883 position in SEQIDNO:1;
(5) polynucleotide of the nucleotide sequence shown in 1-1282 position in SEQIDNO:1;
In any one, described SEQIDNO:1 is the nucleotide sequence of the promotor OsCEBiPP of paddy rice chitin exciton binding-protein gene.
2. the purposes of polynucleotide according to claim 1, is used to guide goal gene at the intrafascicular specifically expressing of plant vasular.
3. the purposes of the polynucleotide of (3) according to claim 1, (4), (5), is used to guide goal gene specifically expressing in plant vasular bundle phloem.
4. using expression cassette that polynucleotide according to claim 1 build as promotor.
5. the plant expression vector containing expression cassette described in polynucleotide according to claim 1 or claim 4.
6. carrier as claimed in claim 5, it is pCAMBIA1391Z-OsCEBiPP.
7. polynucleotide according to claim 1, expression cassette according to claim 4 or the expression vector described in claim 5 or 6 prepare the application in transgenic plant.
8. application according to claim 7, is characterized in that described plant is paddy rice.
9. polynucleotide according to claim 1, expression cassette according to claim 4 or the expression vector described in claim 5 or 6 are cultivating the application in organizing specific expression plant.
10. polynucleotide according to claim 1, expression cassette according to claim 4 or the expression vector described in claim 5 or 6 are cultivating the application in novel disease-resistant pest-resistant plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109317.8A CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610109317.8A CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105543229A true CN105543229A (en) | 2016-05-04 |
| CN105543229B CN105543229B (en) | 2018-06-19 |
Family
ID=55822787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610109317.8A Active CN105543229B (en) | 2016-02-26 | 2016-02-26 | Rice chitin exciton combination gene promoter and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105543229B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116478998A (en) * | 2023-06-07 | 2023-07-25 | 河北科技大学 | Rice phloem specific expression promoter POs04g0452500 and application thereof |
| CN116515889A (en) * | 2023-05-15 | 2023-08-01 | 北京林业大学 | Plant leaf tissue specific expression DNA regulatory element and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1492925A (en) * | 2001-01-05 | 2004-04-28 | �ձ��̲ݲ�ҵ��ʽ���� | Rice sucrose transporter gene promoter |
| CN1761751A (en) * | 2003-01-23 | 2006-04-19 | 得克萨斯科技大学 | Chitinase encoding DNA molecules from cotton expressed preferentially in secondary walled cells during secondary wall deposition and a corresponding promoter |
| CN103740719A (en) * | 2013-12-30 | 2014-04-23 | 安徽省农业科学院水稻研究所 | Separation and application of rice vascular bundle specific expression promoter POsvas 1 |
-
2016
- 2016-02-26 CN CN201610109317.8A patent/CN105543229B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1492925A (en) * | 2001-01-05 | 2004-04-28 | �ձ��̲ݲ�ҵ��ʽ���� | Rice sucrose transporter gene promoter |
| CN1761751A (en) * | 2003-01-23 | 2006-04-19 | 得克萨斯科技大学 | Chitinase encoding DNA molecules from cotton expressed preferentially in secondary walled cells during secondary wall deposition and a corresponding promoter |
| CN103740719A (en) * | 2013-12-30 | 2014-04-23 | 安徽省农业科学院水稻研究所 | Separation and application of rice vascular bundle specific expression promoter POsvas 1 |
Non-Patent Citations (3)
| Title |
|---|
| AKIRA AKAMATSU ET AL.: "An OsCEBiP/OsCERK1-OsRacGEF1-OsRac1 module is an essential early component of chitin-induced rice immunity", 《CELL HOST & MICROBE》 * |
| HANAE KAKU ET AL.: "Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor", 《PNAS》 * |
| 戴景程 等: "病原菌保守性特征分子及其介导的植物抗病性", 《微生物学通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116515889A (en) * | 2023-05-15 | 2023-08-01 | 北京林业大学 | Plant leaf tissue specific expression DNA regulatory element and application thereof |
| CN116478998A (en) * | 2023-06-07 | 2023-07-25 | 河北科技大学 | Rice phloem specific expression promoter POs04g0452500 and application thereof |
| CN116478998B (en) * | 2023-06-07 | 2024-01-23 | 河北科技大学 | Rice phloem specific expression promoter POs04g0452500 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105543229B (en) | 2018-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L. | |
| Yasmin et al. | Transient gene expression in rose petals via Agrobacterium infiltration | |
| CN103740731B (en) | Alfalfa stress response gene M sNAC3 and application thereof | |
| CN105524925B (en) | Plant inducible promoter and its application | |
| CN104995301B (en) | Plant control element and application thereof | |
| CN107099535A (en) | A kind of promoter HLP4 induced by low temperature, high salt, arid or ABA | |
| CN105861501B (en) | Brown Planthopper cause harm inducible promoter region separation and expression pattern identification | |
| CN105505932B (en) | A kind of plant inducible promoter and its application | |
| CN104561053A (en) | Wheat salt-tolerant gene TaBASS2 and application thereof | |
| CN105543229A (en) | OsCEBiP (oryza sativa-Chitin elicitor binding protein) gene promoter and application thereof | |
| CN105112418B (en) | The clone of upland cotton seed-globulin gene promoter and Function Identification | |
| CN103255165B (en) | Application of SOAR1 protein and encoding gene thereof to regulation of plant adversity stress resistance | |
| CN102965374B (en) | Preparation method and applications of rape BnRabGDI3 promoter | |
| CN104087588A (en) | Rice drought-induced promoter POsDro4 responding to environmental water stress | |
| CN105586342B (en) | A kind of wheat specific expression promoter and its application | |
| CN107904238A (en) | Thick boisiana high salt, drought-inducible promoter IpLEA PRO and its application | |
| JP2022075843A (en) | Plant regulatory elements and uses thereof | |
| CN105985956B (en) | A kind of adverse circumstance induced expression GhiWRKY40 promoters and its application | |
| CN104293792B (en) | Paddy rice stamen and lodicules expression promoter STA4 and its application | |
| CN103224552B (en) | Application of CPN20 protein and coding gene thereof in regulating drought resistance of plant | |
| CN102634516B (en) | Brassica napus BnCP51 promoter as well as preparation method and application of promoter | |
| CN105274106A (en) | Peanut AhWRI-1 promoter and preparation method and application | |
| CN105177008B (en) | II type H of corn+The deletion mutant of pyrophosphatase gene promoter and its application | |
| CN103224553B (en) | Application of CPN20 protein and coding gene thereof in regulating ABA (abscisic acid) tolerance of plant | |
| CN104087587A (en) | Plant drought stress induction expression promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |