CN113881699B

CN113881699B - Application of MAC3A and MAC3B in plant organ size regulation

Info

Publication number: CN113881699B
Application number: CN202111306225.6A
Authority: CN
Inventors: 郭思义; 王亚楠; 郭晓鹏; 乔鑫; 周玉森; 杨开幻; 张鑫
Original assignee: Henan University
Current assignee: Henan University
Priority date: 2021-11-05
Filing date: 2021-11-05
Publication date: 2024-01-09
Anticipated expiration: 2041-11-05
Also published as: CN113881699A

Abstract

The application belongs to the technical field of plant genetic engineering, and in particular relates to two Arabidopsis genesMAC3AAndMAC3Bthe application in plant organ size regulation. These two genes are related to plant organ size, where MAC3A and MAC3B can form heterodimers, MAC3B can form homodimers by itself, but MAC3A cannot form homodimers by itself; in terms of specific phenotypic effects: after overexpression of these two genes, the overexpressed strain showed a phenotype of organ enlargement compared to the wild type. In the present application, by the method ofMAC3AAndMAC3Bfurther studies of the genes prove that the two genes are involved in the regulation of plant organ sizes, and particularly after the two genes are overexpressed, the overexpressed strain material shows a typical organ-enlarged phenotype. Based on the result, a certain technical foundation can be laid for plant organ growth regulation, crop breeding or other commercial crop variety breeding.

Description

Application of MAC3A and MAC3B in plant organ size regulation

Technical Field

The application belongs to the technical field of plant genetic engineering, and in particular relates to two Arabidopsis genesMAC3AAndMAC3Bthe application in plant organ size regulation.

Background

Plant organ size is one of the important traits of plants and is also a key agronomic trait of crops. Organ size is closely related to plant biomass and crop yield. The growth and development research shows that the size of plant organ is controlled by the complex and precise coordination of external environment factor and internal signal molecule, and the control of internal signal molecule is dominant. In the breeding process, breeders often select good traits according to organ sizes, thereby improving crop yield. Therefore, the excavation of more genes involved in the regulation of plant organ size has important theoretical significance and breeding application value.

Studies have shown that MAC3A (MOS 4-associated complex A, also known as AT1G 04510) and MAC3B (MOS 4-associated complex 3B, also known as AT2G 33340) belong to the E3 ubiquitin ligase family members comprising the U-box domain, are two core subunits of the MOS4 (modifier of snc1 (snc 1: suppressor of npr1-1 diagnostic 1 (npr: nonexpresser of PR (disease-associated genes, non-expressible genes)) related complex).

According to the structural characteristics of U-box proteins in Arabidopsis thaliana, the U-box proteins are classified into 9 classes, wherein MAC3A and MAC3B belong to class VI PUB, and contain C-terminal WD40 repetitive sequences which regulate protein-protein interactions. Meanwhile, both the MAC3A and the MAC3B belong to nucleoprotein, have E3 ligase activity, play an important role in plant immunity and development, and are directly related to miRNA biosynthesis. In view of the pleiotropic effect of the gene, the method has positive scientific research application value for further research and discussion of specific roles of the MAC3A/3B protein in the plant growth and development process, further analysis and definition of functions of the two genes and cultivation of new varieties of crops.

Disclosure of Invention

For two U-box family proteins in Arabidopsis (MAC 3A、Based on the existing research, the MAC 3B) gene is further researched on the biological development function, and the application aims to provide new application of the two genes in the aspect of regulating and controlling the plant organ size, so that a certain technical basis is laid for regulating and controlling the plant growth and development, cultivating new plant varieties and the like.

The technical scheme adopted by the application is described in detail below.

MAC3AAndMAC3Bthe application of the genes in regulating and controlling the plant organ size is that the two genes are related to the plant organ size, wherein MAC3A and MAC3B can form heterodimers, MAC3B can also form homodimers, but MAC3A can not form homodimers;

in terms of specific phenotypic effects:

the two genes are divided into [ ]MAC3AAndMAC3Bgene) over-expression, the over-expression strain (or the new variety of gene over-expression) shows a phenotype of organ enlargement compared with the wild type;

the organ specifically refers to cotyledons, petals and seeds;

the specific phenotypes are as follows: in contrast to the wild-type species,MAC3AandMAC3Bthe cotyledons of the overexpressing plants are all enlarged; the petal organ and seed organ of the MAC3A overexpressing plant also become larger.

The saidMAC3AAndMAC3Bthe preparation method of the gene adopts a PCR amplification method to prepare the gene, and during PCR amplification, the Arabidopsis cDNA is used as a template for PCR amplificationMAC3AIn this case, the primer sequences were designed as follows:

AT1G04510-F：5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGAATTGTGCAATTTCCGGCG -3’，

AT1G04510-R：5’- GGGGACCACTTTGTACAAGAAAGCTGGGTGACTGAAGATTCAGCACAAGATTCA-3’，

PCR amplificationMAC3BIn this case, the primer sequences were designed as follows:

AT2G33340-F：5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGAACTGTGCAATTTCAGGAG -3’，

AT2G33340-R：5’- GGGGACCACTTTGTACAAGAAAGCTGGGTGCGAGTCTTGCGCAGAGTCATC-3’。

by using the saidMAC3AAndMAC3Bmethod for cultivating new plant variety by gene engineering technologyMAC3AAnd/orMAC3BAfter the gene is over-expressed, the gene is used for cultivating a new plant variety with enlarged organs;

the organ is cotyledon and/or petal and/or seed;

the plant is specifically, for example, arabidopsis thaliana.

In specific overexpression, the super-expression vector Myc containing 35S promoter is utilizedpCMV-Myc) And (5) performing gene overexpression.

The development regulation of plant organ size is an important research field of development biology, and researches and discusses related genes involved in the plant organ size regulation, so that the understanding of the plant organ size molecular regulation mechanism can be enhanced, and the plant organ size molecular regulation method has important scientific research value for crop variety cultivation.

Based on the genome research of Arabidopsis thaliana, part of genes directly related to plant development have been found, and preliminary knowledge of the regulation network and regulation pathways thereof has been provided.MAC3AAndMAC3Bgenes are the genes that were newly discovered to be related to plant development, but the profound effects of these two genes on plant development remain unclear and unequivocal. In the present application, by the method ofMAC3AAndMAC3Bfurther studies of the genes prove that the two genes are involved in the regulation of plant organ sizes, and particularly after the two genes are overexpressed, the overexpressed strain material shows a typical organ-enlarged phenotype. Based on the result, a certain technical foundation can be laid for plant organ growth regulation, crop breeding or other commercial crop variety breeding.

Drawings

FIG. 1 is a schematic view ofMAC3AAndMAC3Bidentifying the over-expression plants; wherein:

（A）WT、MAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3B-expression level of MAC3A/3B protein in OE9 plants;

（B）WT、MAC3A-OE14 andMAC3Ain OE15 plantsMAC3AQuantitative PCR analysis;

（C）WT、MAC3B-OE4 andMAC3B-in OE9 plantsMAC3BIs a quantitative PCR analysis of (2); * P<0.01 (t-test);

FIG. 2 is a schematic view ofMAC3AAndMAC3Bphenotypic analysis of the overexpressing transgenic plants; wherein:

(A) WT (Col-0) germinated for 7 days,MAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3Bcotyledon size of OE 9; scale = 1cm;

（B）WT（Col-0）、MAC3A-OE14 andMAC3Apetal size of OE 15; scale = 1cm;

（C）WT（Col-0）、MAC3B-OE4 andMAC3Bpetal size of OE 9; scale = 1cm;

（D）WT（Col-0）、MAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3Bseed size of OE 9; scale = 200 μm;

(E) WT (Col-0) germinated for 7 days,MAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3B-cotyledon area comparison of OE9 (n=50);

(F) WT grown for 20 days,MAC3A-OE14 andMAC3B-a distribution comparison of the number of epidermal hair branches of the first pair of true leaves of OE4 seedlings (n=20);

（G）WT（Col-0）、MAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3B-seed area comparison of OE9 (n=320);

（H）WT（Col-0）、MAC3A-OE14 andMAC3A-statistical comparison of Petal Length (PL), petal Width (PW) and Petal Area (PA) of OE15 (n=27);

（I）WT（Col-0）、MAC3B-OE4 andMAC3B-statistical comparison of Petal Length (PL), petal Width (PW) and Petal Area (PA) of OE9 (n=31); values are mean ± standard deviation. * P<0.01 (t-test);

FIG. 3 shows the results of MAC3A/B in subcellular localization by observing the fluorescence using a laser confocal microscope; wherein the mCherry group fluorescent signal is indicative of a nucleus; scale bar in the figure = 10 μm;

FIG. 4 is an interaction verification of MAC 3A/B; wherein:

(A) Bimolecular fluorescence complementation analysis; observing YFP fluorescence by using a laser scanning confocal microscope; scale = 10 μm;

(B) Co-immunoprecipitation analysis; the total protein extracts were incubated with GFP-Trap-A agarose beads and immunoblotted with GFP and HA antibodies, respectively.

Detailed Description

The technical scheme of the application is further explained below by combining examples. Before describing the embodiments, some experimental materials are described below in the examples to facilitate a detailed understanding of the development of the present application.

Biological material:

super expression vector Myc containing 35S promoterpCMV-Myc）、pGWB417、pGWB405BiFC recombinant vectorpSPY-NEYFP、pSPY-CEYFPCo-IP vectors and the like are common plasmids in the prior art of transgenosis and can be obtained from public channels;

agrobacterium (Agrobacterium)GV3101Competent cells, purchased from Shanghai Biotechnology Co., ltd.

Example 1

In the present embodiment, the method mainly comprises the following steps ofMAC3AAndMAC3Bgene overexpression on plant phenotype Effect analysis of the effect of the two genes on plant growth phenotype, specificallyMAC3AAndMAC3Bthe construction of the overexpressed strain of the gene is outlined below.

Construction of a 35S promoter-driven overexpression vector35S::MAC3A/MAC3B-Myc(i.e.:35S::MAC3A- Mycand35S::MAC3B-Myc）

the specific construction procedure is referred to below.

Firstly, an Arabidopsis RNA is extracted and obtained by a TRIZol method (TRIZol reagent, product of Thermo company), and cDNA is synthesized by reverse transcription (refer to the conventional operation in the prior art, and the description is omitted).

Subsequently, reference was made to the Arabidopsis cDNA database and the vector sequence (over-expression vector Myc containing 35S promoterpCMV-Myc) Designing corresponding PCR amplification primers, and constructing a vector by using Gateway vector construction technology. Specifically:

first, BP reaction is carried out: firstly, designing target gene amplification primers containing attB1 and attB2 locus sequences, then, performing PCR amplification by using high-fidelity polymerase, detecting PCR products by using gel electrophoresis, and purifying and recycling target bands;

during PCR amplification, specific primer sequences were designed as follows:

AT2G33340-R：5’- GGGGACCACTTTGTACAAGAAAGCTGGGTGCGAGTCTTGCGCAGAGTCATC-3’。

specific BP reaction system is referred as follows:

PCR product, length of target gene (bp) x 0.0165 ng;

pDONR-Vector，75 ng；

5 × BP-Clonase Ⅱ，1 μL；

ddH ₂ o, add to 4. Mu.L;

after the solution is uniformly mixed, the mixture is reacted in a constant temperature water bath kettle at 25 ℃ for 1 h, then 0.5 mu L of protease K is added into the system for uniform mixing, the reaction is carried out for 10 min at 37 ℃, and then the mixture is placed on ice for 5 min, so that competent transformation of escherichia coli is carried out.

Second, LR reaction: extracting BP fusion carrier containing target gene fragment after first step transformationpENTR- MAC3A(A)pENTR-MAC3B) Carrying out subsequent experiments and selecting an expression vectorpGWB417Carrying out LR reaction; the specific reference design of the reaction system is as follows:

pENTR-MAC3A(orpENTR-MAC3B），25 ng；

pGWB417，50 ng；

5 × LR-Clonase Ⅱ，1 μL

ddH ₂ O, add to 4. Mu.L;

mixing the solution, reacting in a water bath at 25deg.C for 1 h, adding 0.5 μl protease K into the system, mixing, reacting at 37deg.C for 10 min, and standing on ice for 5 min to obtain Escherichia coliDH5αCompetent transformation.

Subsequently, the post-transformation bacterial solution was spread on LB-resistant plates containing 100 ng/. Mu.L of spectinomycin, and cultured overnight in an incubator at 37℃to conduct resistance screening. After screening, randomly picking smooth and flat milky white positive bacterial plaque, marking, and carrying out bacterial plaque PCR identification, wherein a specific 15 mu l identification system is designed as follows:

for the followingpGWB417-MAC3AThe plaque assay system of (2) is as follows:

2 × Taq Mix，7.5 μL；

AT1G04510-F，0.5 μL；

AT1G04510-R，0.5 μL；

ddH ₂ O，6.5 μL。

for the followingpGWB417-MAC3BThe plaque assay system of (2) is as follows:

2 × Taq Mix，7.5 μL；

AT2G33340-F，0.5 μL；

AT2G33340-R，0.5 μL；

ddH ₂ O，6.5 μL。

after PCR amplification, the electrophoresis detection is carried out, and whether the target sequence is recombined in the transformed bacterial plaque is preliminarily judged according to the brightness of the strip and the electrophoresis detection result. And then picking the corresponding bacterial plaque into a liquid LB culture medium containing 100 ng/mu L of spectinomycin, carrying out shake culture at 37 ℃ overnight, extracting plasmids the next day, and carrying out sequencing identification on the extracted plasmids to ensure that the plasmids are recombined correctly.

It should be construed that the present application relates toMAC3AAndMAC3Bthe coding frame base sequences of the genes are shown in SEQ ID No.1 and SEQ ID No.2, or specifically referred to as follows:

MAC3A(AT1G04510，1572bp，SEQ ID No.1)：

ATGAATTGTGCAATTTCCGGCGAAGTTCCGGAGGAGCCTGTGGTTTCTAAGAAGTCGGGTTTGCTTTACGAGAAGCGGCTAATCCAGACGCATATATCCGATTATGGGAAATGCCCGGTTACTGGTGAGCCACATACTCTTGATGACATTGTTCCCATCAAAACTGGGAAGATCGTAAAGCCGAAACCATTACACACAGCTAGCATCCCTGGATTGCTTGGAACGTTTCAGACTGAATGGGACAGTTTGATGCTATCAAATTTTGCTTTGGAACAACAACTGCATACTGCGAGGCAAGAGCTAAGTCACGCTTTGTATCAGCATGATGCTGCTTGTCGTGTGATTGCTAGGCTTAAAAAAGAAAGAGACGAATCACGACAATTGCTTGCAGAGGCTGAAAGGCAGTTGCCTGCAGCCCCCGAAGTTGCCACATCGAATGCTGCTCTTAGTAATGGTAAACGAGGTATCGATGATGGTGAGCAGGGGCCTAATGCAAAGAAAATGCGTCTTGGAATTTCGGCTGAAGTTATCACAGAACTCACAGATTGTAATGCTGCTCTTTCTCAGCAGCGTAAAAAGAGACAGATCCCTAAAACATTGGCTTCAGTCGATGCTCTGGAGAAGTTCACCCAACTCTCAAGCCACCCCCTTCACAAGACCAACAAACCTGGAATTTTTTCAATGGACATCCTACATTCTAAGGATGTCATCGCTACGGGAGGAATTGATACAACTGCCGTTCTCTTTGATCGTCCTTCAGGACAAATCTTATCAACGCTGACTGGTCACTCAAAGAAGGTTACAAGCATCAAGTTCGTTGGTGACACTGATCTTGTGTTAACTGCTTCATCCGACAAGACAGTCCGCATCTGGGGATGTTCCGAGGATGGGAACTATACCTCTAGACATACACTGAAAGATCATTCTGCCGAGGTGCGAGCTGTAACTGTCCACGCAACGAATAAATACTTTGTGTCAGCATCACTTGACAGTACATGGTGCTTCTATGATCTGTCCTCCGGTTTATGCCTTGCTCAGGTGACAGATGCTTCCGAAAACGACGTGAATTACACGGCTGCTGCTTTTCATCCTGATGGTCTCATTCTTGGAACTGGTACCGCTCAATCTATTGTTAAGATTTGGGATGTAAAAAGTCAGGCAAATGTGGCAAAGTTTGGTGGACACAATGGAGAAATCACCTCTATATCATTCTCTGAAAACGGTTATTTCCTTGCGACTGCTGCACTGGATGGTGTTAGGTTGTGGGACTTGCGCAAGTTAAAGAACTTCCGAACCTTTGACTTTCCAGATGCAAACTCGGTGGAGTTTGACCATAGCGGATCTTATCTTGGCATTGCTGCTTCAGATATAAGAGTATTCCAAGCAGCTAGTGTAAAAGCAGAATGGAACCCAATCAAGACTCTTCCCGATCTGTCCGGTACAGGTAAAGCAACAAGTGTTAAGTTTGGACTCGACTCCAAATACATAGCAGTCGGTTCAATGGACCGTAATCTCAGGATATTTGGTTTACCTGATGATGACAATACTGAAGATTCAGCACAAGATTCATGA。

MAC3B (AT2G33340，1578bp，SEQ ID No.2)

ATGAACTGTGCAATTTCAGGAGAAGTTCCCGTGGAGCCAGTGGTTTCGACGAAGTCAGGATTACTCTTCGAGAGACGACTAATCGAAAGACATATATCGGATTATGGGAAGTGCCCGGTTACTGGCGAACCACTTACCATTGATGACATTGTTCCCATCAAAACTGGGGAGATCATAAAGCCGAAAACATTGCATACAGCTAGTATCCCTGGATTGCTCGGAACGTTCCAGAATGAATGGGACGGTTTGATGCTATCAAATTTTGCACTGGAGCAACAACTACATACTGCAAGGCAAGAGCTAAGTCATGCCTTGTATCAGCATGATTCTGCTTGTCGTGTGATTGCTAGACTTAAAAAAGAAAGAGACGAAGCACGCCAATTACTGGCCGAGGTTGAGAGACATATACCTGCGGCCCCTGAAGCTGTGACAGCTAATGCTGCTCTGAGTAATGGTAAACGAGCTGCCGTTGACGAGGAACTGGGTCCTGATGCAAAGAAATTGTGTCCTGGAATTTCAGCTGAAATTATTACGGAATTGACTGATTGTAATGCTGCTCTTTCCCAGAAGCGAAAAAAGCGACAGATTCCTCAAACATTGGCGTCAATAGATACTTTGGAGAGGTTCACTCAGCTATCAAGCCACCCACTTCACAAGACCAACAAACCAGGCATTTGTTCGATGGACATTCTACATTCTAAGGATGTCATTGCTACTGGAGGAGTTGATGCAACTGCTGTTCTCTTTGATCGCCCTTCTGGACAAATCTTGTCAACACTGACTGGTCACTCGAAGAAGGTTACAAGCGTAAAATTTGTAGGCGACTCTGATCTTGTTTTGACTGCTTCTGCTGACAAGACAGTCCGTATCTGGCGGAATCCTGGGGATGGGAATTATGCTTGTGGGTATACATTGAATGATCATTCTGCGGAGGTGCGAGCTGTAACTGTGCATCCCACAAATAAATACTTTGTCTCGGCATCTCTTGATGGTACATGGTGCTTCTACGATCTGTCCTCTGGCTCATGCCTTGCACAGGTATCAGATGATTCAAAGAATGTAGATTACACGGCTGCTGCTTTTCATCCCGATGGTCTCATTCTCGGAACCGGTACTTCTCAATCTGTTGTTAAGATTTGGGACGTTAAAAGTCAGGCAAATGTGGCTAAGTTTGATGGACACACTGGGGAAGTTACAGCTATATCTTTCTCTGAAAATGGTTACTTCCTCGCGACAGCTGCAGAGGATGGTGTTAGGTTGTGGGATCTGCGCAAGTTAAGGAACTTCAAATCATTTTTATCTGCAGATGCGAACTCTGTGGAGTTTGATCCTAGCGGATCTTATCTCGGTATTGCTGCATCAGATATCAAAGTATACCAGACGGCAAGTGTGAAAGCTGAATGGAACCTTATCAAGACACTCCCAGATCTCTCCGGCACTGGTAAAGCTACGTGTGTGAAGTTTGGTTCAGATGCACAGTACGTTGCAGTCGGTTCGATGGACCGTAACCTACGGATATTTGGTCTTCCTGGTGATGAAAAAGCCAACGTCGATGATGACTCTGCGCAAGACTCGTGA。

(II) Agrobacterium transformation

At 25. Mu.L of AgrobacteriumGV31012. Mu.L of the recombinant overexpressing plasmid identified in step (one) above was added to competent cells to carry out transformation procedures, specifically:

agrobacterium is transformed intoGV3101After the competent cells and the recombinant overexpression plasmid are uniformly mixed, standing and incubating on ice for 5 minutes, then quick-freezing with liquid nitrogen for 5 minutes, then rapidly standing in a water bath at 37 ℃ for 5 minutes, and then standing on ice for 5 minutes; then adding 1 mL of YEP liquid culture medium, and placing the mixture in a shaking table at 28 ℃ for shaking incubation for 2 h; then, the bacterial solution was uniformly spread on a YEP solid plate containing 100 ng/. Mu.L of spectinomycin and 100 ng/. Mu.L of rifampicin using a sterile spreading bar, and the incubator at 28℃was invertedCulturing for 2 days. And finally, carrying out colony PCR identification, selecting 2-3 positive single colonies with correct identification, mixing and shaking, and directly applying, or preserving the cultured bacterial liquid at the temperature of minus 80 ℃ for later use.

(III) transformation and preparation of transgenic materials of overexpressing strains

The method comprises the following steps of carrying out agrobacterium infection transformation when an arabidopsis wild type plant grows to a flowering period, and specifically comprises the following steps:

transferring the agrobacterium in the second step into a liquid YEP culture medium of which 5 mL contains 100 ng/. Mu.L of spectinomycin and 100 ng/. Mu.L of rifampicin, and performing shake culture at a constant temperature of 28 ℃ overnight; transferring the bacterial liquid into a 10 mL bacterial collecting tube, and centrifuging at room temperature for 10 min at 5000 g; after discarding the supernatant, the pellet was gently swirled to homogeneity with a heavy suspension containing 1/2 of MS salt and 5% sucrose, and OD was adjusted ₆₀₀ About 0.8-1.0, adding 0.01% silwet L77 as an aggressive liquor; the procedure was then followed using the inflorescence-infected transformation method.

The wild type plants of arabidopsis thaliana continue to be cultivated and seeds harvested after infestation. After further planting the harvested seeds, resistance selection and PCR identification were performed on MS solid medium containing 50 ng/. Mu.L kanamycin resistance, and finally obtainedMAC3AAndMAC3Band (5) overexpressing transgenic strain plants.

(IV) identification of overexpressing transgenic lines

For the obtainedMAC3AAndMAC3Bthe overexpressing material of the stably inherited transgenic lines (designated asMAC3A-OE14、MAC3A-OE15、MAC3B-OE4 andMAC3B-OE 9) molecular characterization and protein level detection, respectively, for the purposes of the present inventionMAC3A AndMAC3Bthe gene expression was evaluated, and the specific procedure is described below.

Firstly, respectively planting seeds of wild type and over-expression plants on an MS solid culture medium, extracting total RNA of 7-day seedlings, and performing reverse transcription to synthesize cDNA;

subsequently, based on qRT-PCR technology, designMAC3AAndMAC3Bquantitative detection primer pairs to detect transcript levels of the overexpressed transgenic lines;

in qRT-PCR detection, the primer sequence was designed as follows:

MAC3A-qRT-F：5’- GCTGACTGGTCACTCAAAGAA -3’，

MAC3A-qRT-R：5’- GTTCCCATCCTCGGAACATC -3’；

MAC3B-qRT-F：5’- TCAAGACACTCCCAGATCTCTC -3’，

MAC3B-qRT-R：5’- TATCCGTAGGTTACGGTCCATC -3’；

ACTIN-qRT-F：5’-GTAACATTGTGCTCAGTGGTGGTA-3’，

ACTIN-qRT-R：5’-GATAGAACCACCAATCCAGACACT-3’。

the qRT-PCR analysis result shows that the super-expression transgenic plantMAC3AAndMAC3Bthe transcript levels of the genes were significantly higher than for the wild type (FIGS. 1 (B) and (C)), which indicated that the construction of the transgenic lines was successful.

Further, total proteins of 7-day seedlings are extracted respectively, actin proteins are used as internal references, and Myc antibodies are utilized to detect expression conditions of the MAC3A-Myc and MAC3B-Myc fusion proteins. The results showed that the expression of the fusion protein of MAC3A-Myc or MAC3B-Myc was found in the over-expressed plants, but not in the wild-type plants (FIG. 1 (A)), and the results further showed that the expression of the fusion protein was found in the transgenic plantsMAC3AAndMAC3Bgenes are capable of normal transcriptional expression and function biologically.

(V) specific phenotypic Difference identification

For the obtained T ₃ Seeds homozygous for the generation of the overexpressing strain, after further cultivation, were studied and defined by comparing them with wild-type plantsMAC3AAndMAC3Bthe influence of the gene on the specific growth of plants. The specific experimental conditions are outlined below.

First, T is taken ₃ Sterilizing and cleaning the seed of the generation over-expression homozygote and the wild type seed in the same period, putting the seed on an MS solid culture medium, vernalizing the seed at 4 ℃ for 3 days, and then transferring the seed to the same illumination culture room for culture and growth (the plant growth temperature is 22 ℃, the illumination period is 16h, and the dark period is 8 h).

For leaf phenotyping, cotyledons of 7-day seedlings were selected for phenotyping, specifically: cotyledons of plant materials to be observed at the same development stage were cut out and placed on an MS plate, photographed with a camera (a ruler is placed), the cotyledon area was measured with imageJ (version 1.4.3.67) software, 50 cotyledons were counted for each material, and a few representative photographs were taken.

After statistical analysis, the results indicate that, compared with the wild type,MAC3AandMAC3Bthe overexpressing materials all show a phenotype of enlarged cotyledons,MAC3A-OE14 andMAC3AOE15 is increased by 25% and 27% respectively,MAC3B-OE4 andMAC3BOE9 was increased by 5.8% and 9%, respectively (fig. 2 (a) and fig. 2 (E)).

Then, the first pair of true leaves of the plant growing for 20 days are cut, placed under a split microscope to observe the epidermal hair branches and photographed, the number of different epidermis Mao Fencha is counted, and 20 true leaves are counted for each material.

The results of the statistical analysis showed that, compared to the wild type,MAC3AandMAC3Bthe overexpressing materials all exhibited a binary branch increase (9.9% and 9.3%, respectively), a three-pronged, four-pronged slightly reduced phenotype (5.3% and 3.2%,4.6% and 6.1%, respectively) (fig. (F)).

When the flower organ is observed, specifically: after the plants enter the flowering stage, 30 petals of each plant in the same flowering stage are cut and placed on a common MS culture medium, photographed and measured on the length, width and area of the petals by imageJ software.

The results show that, compared to WT,MAC3Athe petals of the overexpressing plants were all longer, wider and larger in area than WT (3.3% and 5.1%,4.4% and 6%,7.3% and 10.6%, respectively) (fig. 2 (B) and fig. 2 (H)), butMAC3BPetals of the overexpressing plants did not show significant differences (fig. 2 (C) and fig. 2 (I)).

When observing seeds, specifically: after the pods of the plants are mature, seeds of the fourth to eleventh horned fruits on the main stems of the various plants from bottom to top are selected for collection and drying, then the seeds are placed under a split microscope for shooting, the area of the seeds is measured by using imageJ software, and 320 seeds are counted for each material.

The results of the statistical analysis showed that, compared to the wild type,MAC3Athe seed area of the overexpressing plants was larger than that of WT (4% and 9.5%, respectively), butMAC3BThe overexpressing plants did not show significant differences (fig. 2 (D) and fig. 2 (G)).

Based on the above results, it can be seen that,MAC3A and MAC3BThe genes and plant organ size regulation have a direct relationship, in particular: in contrast to the wild-type species,MAC3Athe cotyledon, flower and seed of the over-expression plant are all obviously increased, butMAC3BThe overexpressing plants only show a phenotype of cotyledon enlargement. From this, it can be preliminarily presumed thatMAC3AHas a dominant role in regulating the organ size of arabidopsis thaliana.

Example 2

Based on example 1, to further intuitively studyMAC3AAndMAC3Bby using subcellular localization, biFC and Co-IP experiments, the inventors further constructed related recombinant plasmid vectors and conducted related analyses. The detailed experimental procedure is outlined below (relevant operations, not described in detail, reference is made to the foregoing examples or to conventional operations of the prior art).

Subcellular localization

First, the inventors constructed by using Gateway vector construction techniqueMAC3AAndMAC3Bthe relevant overexpression vectors are subjected to subcellular localization experiments, in particular: the BP fusion vector containing the desired gene fragment of example 1 was selected by the procedure of example 1pENTR-MAC3A/MAC3BPerforming LR reaction experiment while selecting expression vectorpGWB405Constructing and obtaining a fusion expression vector:35S::MAC3A-GFPand35S::MAC3B-GFP。

subsequently, subcellular localization of MAC3A and MAC3B was observed by transient transformation of tobacco, specifically, the foregoing construction was performed separately35S::GFP、35S::MAC3B-GFP、35S::MAC3A-GFPTransient transformation of about 40 days oldN. benthamianaFluorescence was observed after 48 hours in tobacco.

As a result, as shown in FIG. 3, nuclei were identified by mCherry fluorescent signal when the nuclei were to be identified35S::GFPWhen injected into tobacco leaves, fluorescence is observed in the cell nucleus, cytoplasm and membrane of epidermal cells, when the tobacco leaves are respectively injected into the tobacco leaves35S::MAC3B- GFP、35S::MAC3A-GFPWhen injected into tobacco leaves, GFP fluorescence was only observed in the nuclei, and the green fluorescence signal and the nucleus-specific fluorescence mCherry signal were completely coincident, indicating that both MAC3A and MAC3B were localized to the nuclei.

The results indicate that both MAC3A, MAC3B are nuclear localization proteins, which also provides a theoretical basis for the possible functioning of both in the nucleus.

(II) BiFC experiments

First, amplification was performed using Arabidopsis cDNA as a templateMAC3AAndMAC3Bthe base sequences of the coding frames of the genes are shown as SEQ ID No.1 and SEQ ID No. 2. Designing a primer sequence for PCR amplification based on a one-step cloning construction technology, and carrying out PCR amplification; the specific primer sequences for PCR amplification were designed as follows:

MAC3A-nYFPF: 5’- GAGAACACGGGGGACTCTAGAATGAATTGTGCAATTTCCGGCG-3’ ，

MAC3A-nYFPR: 5’- CCCGGGAGCGGTACCCTCGAGACTGAAGATTCAGCACAAGATTCA-3’ ；

MAC3A-cYFPF: 5’- GAGAACACGGGGGACTCTAGAATGAATTGTGCAATTTCCGGCG-3’ ，

MAC3A-cYFPR: 5’- CCCGGGAGCGGTACCCTCGAGACTGAAGATTCAGCACAAGATTCA-3’ ；

MAC3B-nYFPF: 5’- GAGAACACGGGGGACTCTAGAATGAACTGTGCAATTTCAGGAGAA-3’ ，

MAC3B-nYFPR: 5’- CCCGGGAGCGGTACCCTCGAGCGAGTCTTGCGCAGAGTCATC-3’ ；

MAC3B-cYFPF: 5’- GAGAACACGGGGGACTCTAGAATGAACTGTGCAATTTCAGGAGAA-3’ ，

MAC3B-cYFPR: 5’- CCCGGGAGCGGTACCCTCGAGCGAGTCTTGCGCAGAGTCATC-3’ 。

second, for transient expression vectorsPSPY-NEYFPAndPSPY-CEYFPrespectively doXbaI、XhoI double cleavage (37 ℃,3 h) and recovery of the cleavage product (the procedure is carried out using the purification recovery kit from OMEGA, reference to the instructions).

Subsequently, a seamless cloning method (a one-step cloning method) is used for carrying out connection recombination on the target gene and the digested carrier fragment, and a 20 mu L reaction system is designed as follows during connection recombination:

5 × CE II Buffer，4 μL；

linearizing the cloning vector after digestion, 160 ng;

PCR amplification product, 60 ng;

ddH ₂ o, add to 20. Mu.L;

1 h was attached at 37 ℃.

And then, transforming the connection product into escherichia coli for screening and detection, so as to ensure that the plasmid recombination of the constructed BiFC recombinant vector is correct.

Finally, in vitro experiments were performed by a bimolecular fluorescence complementation (bimolecular fluorescence complementation, biFC) experiment, in particular: respectively constructed as described above35S::nYFPAnd35S::cYFP、35S:: MAC3A-nYFPand35S::MAC3B-cYFP、35S::MAC3A-nYFPand35S::MAC3A-cYFP、35S::MAC3B-nYFPand35S::MAC3B-cYFPinjecting into the patients for about 40 daysN. benthamianaFluorescence was observed after 48 hours in tobacco leaves.

The results are shown in FIG. 4 (A), and it can be seen that: when it is to35S::MAC3A-nYFPAnd35S::MAC3B-cYFPwhen co-transferred into tobacco leaves, yellow fluorescence is observed in the nuclei of epidermal cells, and similarly, when co-transferred35S::MAC3B-nYFPAnd35S::MAC3B-cYFPfluorescence was also observed at this time. But co-rotate35S::nYFPAnd35S::cYFPand35S::MAC3A- nYFPAnd35S::MAC3A-cYFPno fluorescence phenomenon occurs at all.

The results indicate that MAC3A and MAC3B may form heterodimers, and MAC3B may also form homodimers by itself, but MAC3A may not form homodimers by itself.

(III) Co-IP experiments

First, the subcellular localization vector constructed as described above was used35S::MAC3A-GFPAnd35S::MAC3B-GFPexperiments were performed as Co-IP support

At the same time, refer toThe operation and amplificationMAC3BThe coding frame base sequence of the gene is shown as SEQ ID No.2, and is constructed and obtained by a one-step cloning method:35S::MAC3B-HAfusion expression vector. In the construction process, the primer sequence is designed as follows:

MAC3BHAInF: 5’- GGTACCGCGGGCCCGGGATCCATGAACTGTGCAATTTCAGGAGAA-3’ ，

MAC3BHAInR: 5’- TGGGTAACCTGCCATGGATCCCACGAGTCTTGCGCAGAGTCA-3’ 。

subsequently, respectively35S::MAC3B-HAAnd35S::MAC3B-GFP、35S::MAC3B-HAand35S::MAC3A- GFPtransient transformation of about 40 days oldN. benthamianaAnd extracting protein from tobacco after 48 hours for Co-IP experiment.

The results showed that, with total protein as Input, immunoblotting with GFP and HA antibodies, respectively, bands of corresponding sizes (about 70 kDa) were detected for both MAC3A and MAC3B, indicating successful protein expression. The total protein extract was then incubated with GFP-Trap-A agarose beads and immunoblotted with GFP and HA antibodies, respectively, and the bands for MAC3B-HA were detected in Output, demonstrating the interaction between MAC3A and MAC3B and between MAC3B and MAC3B (FIG. 4 (B)).

The experimental data in summary show that: MAC3A and MAC3B may form a heterodimer, whereas MAC3B may form a homodimer itself, but MAC3A may not form a homodimer itself.

In combination with the results of examples 1, 2, the inventors analyzed to consider: transgenic plantsMAC3AThe overexpressing material exhibits a phenotype of organ enlargement, butMAC3BThe phenotype of the super-expression material with only cotyledons enlarged indicatesMAC3AHas a dominant role in regulating the organ size of arabidopsis thaliana. The interaction experiments demonstrated that MAC3A and MAC3B can form heterodimers, MAC3B itself can form homodimers, but MAC3A itself cannot form homodimers. Such differences may be the resultMAC3AAndMAC3Bone of the reasons why the organ phenotypes of the overexpressing material are not identical.

SEQUENCE LISTING

<110> university of Henan

<120> application of MAC3A and MAC3B in plant organ size control

<130> none

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1572

<212> DNA

<213> Arabidopsis thaliana

<400> 1

atgaattgtg caatttccgg cgaagttccg gaggagcctg tggtttctaa gaagtcgggt 60

ttgctttacg agaagcggct aatccagacg catatatccg attatgggaa atgcccggtt 120

actggtgagc cacatactct tgatgacatt gttcccatca aaactgggaa gatcgtaaag 180

ccgaaaccat tacacacagc tagcatccct ggattgcttg gaacgtttca gactgaatgg 240

gacagtttga tgctatcaaa ttttgctttg gaacaacaac tgcatactgc gaggcaagag 300

ctaagtcacg ctttgtatca gcatgatgct gcttgtcgtg tgattgctag gcttaaaaaa 360

gaaagagacg aatcacgaca attgcttgca gaggctgaaa ggcagttgcc tgcagccccc 420

gaagttgcca catcgaatgc tgctcttagt aatggtaaac gaggtatcga tgatggtgag 480

caggggccta atgcaaagaa aatgcgtctt ggaatttcgg ctgaagttat cacagaactc 540

acagattgta atgctgctct ttctcagcag cgtaaaaaga gacagatccc taaaacattg 600

gcttcagtcg atgctctgga gaagttcacc caactctcaa gccaccccct tcacaagacc 660

aacaaacctg gaattttttc aatggacatc ctacattcta aggatgtcat cgctacggga 720

ggaattgata caactgccgt tctctttgat cgtccttcag gacaaatctt atcaacgctg 780

actggtcact caaagaaggt tacaagcatc aagttcgttg gtgacactga tcttgtgtta 840

actgcttcat ccgacaagac agtccgcatc tggggatgtt ccgaggatgg gaactatacc 900

tctagacata cactgaaaga tcattctgcc gaggtgcgag ctgtaactgt ccacgcaacg 960

aataaatact ttgtgtcagc atcacttgac agtacatggt gcttctatga tctgtcctcc 1020

ggtttatgcc ttgctcaggt gacagatgct tccgaaaacg acgtgaatta cacggctgct 1080

gcttttcatc ctgatggtct cattcttgga actggtaccg ctcaatctat tgttaagatt 1140

tgggatgtaa aaagtcaggc aaatgtggca aagtttggtg gacacaatgg agaaatcacc 1200

tctatatcat tctctgaaaa cggttatttc cttgcgactg ctgcactgga tggtgttagg 1260

ttgtgggact tgcgcaagtt aaagaacttc cgaacctttg actttccaga tgcaaactcg 1320

gtggagtttg accatagcgg atcttatctt ggcattgctg cttcagatat aagagtattc 1380

caagcagcta gtgtaaaagc agaatggaac ccaatcaaga ctcttcccga tctgtccggt 1440

acaggtaaag caacaagtgt taagtttgga ctcgactcca aatacatagc agtcggttca 1500

atggaccgta atctcaggat atttggttta cctgatgatg acaatactga agattcagca 1560

caagattcat ga 1572

<210> 2

<211> 1578

<212> DNA

<213> Arabidopsis thaliana

<400> 2

atgaactgtg caatttcagg agaagttccc gtggagccag tggtttcgac gaagtcagga 60

ttactcttcg agagacgact aatcgaaaga catatatcgg attatgggaa gtgcccggtt 120

actggcgaac cacttaccat tgatgacatt gttcccatca aaactgggga gatcataaag 180

ccgaaaacat tgcatacagc tagtatccct ggattgctcg gaacgttcca gaatgaatgg 240

gacggtttga tgctatcaaa ttttgcactg gagcaacaac tacatactgc aaggcaagag 300

ctaagtcatg ccttgtatca gcatgattct gcttgtcgtg tgattgctag acttaaaaaa 360

gaaagagacg aagcacgcca attactggcc gaggttgaga gacatatacc tgcggcccct 420

gaagctgtga cagctaatgc tgctctgagt aatggtaaac gagctgccgt tgacgaggaa 480

ctgggtcctg atgcaaagaa attgtgtcct ggaatttcag ctgaaattat tacggaattg 540

actgattgta atgctgctct ttcccagaag cgaaaaaagc gacagattcc tcaaacattg 600

gcgtcaatag atactttgga gaggttcact cagctatcaa gccacccact tcacaagacc 660

aacaaaccag gcatttgttc gatggacatt ctacattcta aggatgtcat tgctactgga 720

ggagttgatg caactgctgt tctctttgat cgcccttctg gacaaatctt gtcaacactg 780

actggtcact cgaagaaggt tacaagcgta aaatttgtag gcgactctga tcttgttttg 840

actgcttctg ctgacaagac agtccgtatc tggcggaatc ctggggatgg gaattatgct 900

tgtgggtata cattgaatga tcattctgcg gaggtgcgag ctgtaactgt gcatcccaca 960

aataaatact ttgtctcggc atctcttgat ggtacatggt gcttctacga tctgtcctct 1020

ggctcatgcc ttgcacaggt atcagatgat tcaaagaatg tagattacac ggctgctgct 1080

tttcatcccg atggtctcat tctcggaacc ggtacttctc aatctgttgt taagatttgg 1140

gacgttaaaa gtcaggcaaa tgtggctaag tttgatggac acactgggga agttacagct 1200

atatctttct ctgaaaatgg ttacttcctc gcgacagctg cagaggatgg tgttaggttg 1260

tgggatctgc gcaagttaag gaacttcaaa tcatttttat ctgcagatgc gaactctgtg 1320

gagtttgatc ctagcggatc ttatctcggt attgctgcat cagatatcaa agtataccag 1380

acggcaagtg tgaaagctga atggaacctt atcaagacac tcccagatct ctccggcact 1440

ggtaaagcta cgtgtgtgaa gtttggttca gatgcacagt acgttgcagt cggttcgatg 1500

gaccgtaacc tacggatatt tggtcttcct ggtgatgaaa aagccaacgt cgatgatgac 1560

tctgcgcaag actcgtga 1578

Claims

1.MAC3AThe application of the gene in regulating the size of the seed organ of arabidopsis thaliana is characterized in thatMAC3AAfter overexpression of the gene, the overexpressed strain shows a phenotype of a larger seed organ than the wild type.

2. By means ofMAC3AA method for breeding a variety of a genetic Arabidopsis thaliana, characterized in that the method comprises the steps ofMAC3AAfter over-expression, the strain is used for cultivating arabidopsis varieties with enlarged seed organs.

3. The method for breeding Arabidopsis thaliana variety according to claim 2, wherein the gene is overexpressed by using an overexpression vector pCMV-Myc containing a 35S promoter in specific overexpression.