CN104928293B - The promoter of wheat root specifically expressing expansin and its application - Google Patents

Abstract

The present invention relates to a kind of promoter of expansin of wheat root specifically expressing and its application, and the purpose is to provide a kind of promoter that specifically expressing (is particularly in root hair) in monocotyledon root.The promoter starts target gene specifically expressing in root, it can be merged with the promoter with some salt tolerants, drought resisting and root secreted protein gene, root specific expression carrier is built, is had great importance to plant particularly wheat salt tolerance, drought stress tolerance engineering breeding and acquisition root-specific expressing protein product.

Description

The promoter of wheat root specifically expressing expansin and its application

Technical field

The invention belongs to field of plant genetic, is related to a kind of startup of wheat root specifically expressing expansin Son and its application.

Background technology

Promoter is important gene expression regulation element.The spatial and temporal expression feature and expression quantity of gene are directly decide, Therefore the important research content that suitable promoter is genetic engineering breeding is separated.The promoter of tissue specific expression is a kind of Special inducible promoter, under the regulation and control of these promoters, gene often only carries out table in some specific organ-tissues Reach.The shortcomings of waste caused by furtheing investigate these promoters and can not only avoiding composition type expression promoter continuous expression, And help to illustrate the basic theories such as phytomorph, development, metabolic pathway, it is with a wide range of applications.Example Dapena et Al. (2006) start small heat shock protein GFP using the promoter DS10 of seed specific expression（HaHSFA9）Conversion is too Sun flower, exogenous gene expression can improve the longevity of transgenic line seed in the case where not influenceing transfer-gen plant conditions of growth and development Life.Research root-specific expression promoter can not only analyze the physiological function of specific expression gene in root, it is often more important that because There are other tissues to have the advantage that for root specific expression systems.Example, root specific expression systems turn base available for research The problems such as because of the hypertonic of plant, stress-tolerance, rhizosphere secretion.It can be secreted using destination protein caused by root specific expression systems Into fluid nutrient medium, it is more beneficial for reclaiming（Borisjuk et al.,1999）.Larkin et al. (1996) are with growth The promoter for the GH3 genes that element induction is mainly expressed in root and in spending starts the expression of gus gene, for studying the geotropism of root With the development of lateral root.

At present, although the promoter for having many inducible promoters and tissue specific expression is cloned, due to Patent protection and the not high limiting factor of expression activity, really using more induction type and the number of organizing specific expression promoter Amount is also very limited, and the promoter for the organizing specific expression cloned in wheat is less.And with the continuous depth of genetic engineering breeding Enter, applicable promoter but increasingly seems awkward.Therefore, the separation about promoter and research turn into recent years One of focus studied both at home and abroad.

Swollenin is also known as cell wall expansion protein, and the expansion to cell membrane in cell growth process is worked.In recent years, The expansin that several hairs specifically develop correlation is cloned and identified in succession in Different Crop.Functional study shows, this A little expansins take part in the resistance of plants against abiotic stress and the morphogenesis of root hair（Guo et al., 2011; Ma et al., 2013）, promoter research shows that the promoter of these genes can startGUSGene specifically expressing in root hair.Cause This function of cloning and study these promoters has important to the form generation for cultivating the crops such as salt tolerant, drought resisting and research root system Meaning and application value.But the clone of the promoter of the current expansin about wheat root hair specifically expressing and application are also not Appear in the newspapers.

The content of the invention

It is an object of the invention to provide the promoter of one kind specifically expressing (particularly in root hair) in monocotyledon root TaREXP。

The technical scheme is that：Using the expansin sequence for the Barley Roots specifically expressing delivered, using same The method of source gene cloning, using wheat root cDNA as template, PCR obtains the total length of the expansin of wheat root specifically expressing CDNA sequence；Then according to the cDNA sequence of acquisition, nested primers is designed at 5 ˊ ends, using Wheat volatiles DNA as template, is utilized GenomeWalker obtain wheat root specifically expressing expansin promoter sequence；Then build using GUS as report base The stable expressed vector of cause, the expression activity and expressive site of target promoter are determined by the method for GUS histochemical stains.

Expansin TaExpansin of the promoter provided by the present invention from wheat root specifically expressing upstream sequence Row, are named as TaREXP.It is the SEQ ID NO.1DNA sequences of sequence in sequence table.

Present invention also offers the plant expression vector pCAM1391Z/TaREXP containing above-mentioned promoter.

Applications of the promoter TaREXP of the present invention in salt tolerant, drought-resistant plant is cultivated.The plant is preferably common Wheat.

Application of the plant expression vector in salt tolerant, drought-resistant plant is cultivated is also within the scope of the present invention.

Application of the promoter TaREXP promoters of the present invention in root specific expression protein is produced, the above-mentioned different table of Gent Preferentially refer to the albumen for having medical value up to albumen.

The downstream that any gene is connected to of the present invention specific expression promoter is transcribed.It is and any Foreign gene can be imported in plant to the carrier expressed to be applied.

Application of the promoter in the application in cultivating wheat and plant expression vector in wheat is cultivated is stated, also Protection scope of the present invention.

Beneficial effects of the present invention：Shown by GUS histochemical stains research, the promoter cloned of the present invention can be In transfer-gen plant root（Particularly in root hair）Specifically expressing.The promoter can start table of any external cause gene in root Reach, can be widely used for cultivating salt tolerant, drought resisting new crop varieties and for producing root specific expression protein.Should with important With value.

Brief description of the drawings

RT-PCRs of the 1 specifically expressing expansin TaExpansin of accompanying drawing in the seedling different tissues of wheat 3338 Analysis；

The TaExpansin promoter sequences and start contained by block that accompanying drawing 2 expands from the genomic DNA of wheat 3338 Cis-acting elements is analyzed；

ABRE:ABA response elements；ARE：Anaerobic induction response element；Box-W1：Fungal induction response element；CAAT- box：The general enhancer of promoter region；CGTCA：Methyl jasmonate response element；GC-motif：Anoxic specificity induction enhancing Son；LTR：Low temperature response element；P-box：GA response elements；TATA-box：The core parts of promoter；W box：WRKY is transcribed Factor binding member；RHE：Root hair specifically expressing element.

Accompanying drawing 3 compares and turned the arabidopsis GUS coloration results of pCAM1391Z/TaREXP carriers；

A：Non- non-transgenic control seedling GUS coloration results, B：Transgenic seedlings GUS coloration results, C：B figures root amplification effect Fruit is schemed, D：Part amplification effect figure, E shown in C figure arrows：Transfer-gen plant inflorescence GUS coloration results, F：Transfer-gen plant fruit Pod GUS coloration results.

Embodiment

Embodiment 1

Wheat root specifically expressing expansinTaExpansinExpression analysis

Material

The normal seed germination of wheat breed 3338, the root and leaf of wheat seedling are collected after one week.At the heading stage of wheat （When young fringe extracts leaf sheath half out）, take and 0-1cm separate living tissues and young fringe saved under wheatear, preserved in liquid nitrogen.

Trizol methods extraction wheat Total RNA

1. organization material is put into the mortar of Liquid nitrogen precooler, powder is fully ground into liquid nitrogen；

2. treating that liquid nitrogen volatilization is dry, it is immediately transferred in 2ml centrifuge tube, about adds 1ml's per 100mg materials The TRIzol extract solutions of Invitrogen companies, acutely vibration mix sample, sample is fully cracked, and room temperature is placed 5 minutes；

3. adding 0.2ml chloroforms (chloroform), acutely vibration is mixed 15 seconds, and room temperature is placed 10 minutes；

4.4 DEG C, 12000rpm is centrifuged 15 minutes；

5. carefully suctioning out upper strata aqueous phase with pipettor, add in new 1.5ml centrifuge tube, add 500 μ l isopropanol (1:1 volume), fully mix, -20 DEG C, precipitate 30min；

6.4 DEG C, 12000rpm centrifugation 10min, careful abandoning supernatant；

7.RNA precipitations are washed with 1ml 75% ethanol.4 DEG C, 8000rpm centrifugations 10min collects precipitation；

8. repeat to washed once RNA precipitate with 75% ethanol；

9. removing supernatant, for RNA precipitate in being dried on aseptic operating platform about 10-15 minutes, RNA shows slightly transparent, adds appropriate bulk Product（30-50μl）RNase-free water fully dissolve (can be placed on -80 DEG C long-term preserve)；

10. ultraviolet specrophotometer and 1%Agrose detected through gel electrophoresis RNA concentration and quality.

Note：A) UV spectrophotometer measuring RNA yield, the absorbance at 260nm, 1OD=40ug/ml are used.According to Light absorption value at 260nm and 280nm, detect RNA purity, the OD of pure rna₂₆₀/OD₂₈₀Ratio should (ratio be best close to 2.0 Between 1.9~2.1).

B) with 1%Agrose gel electrophoresises inspection side RNA quality and size.Draw the RNase- that 1 μ l RNA add 3 μ l Free water, 65 DEG C of 1 μ l sample-loading buffers are added to be denatured 5 minutes.Dyed after electrophoresis with EB, separately take 3 μ l 1kb DNAMarker to make For control.

First chain cDNA synthesis

Using PrimeScript^TMRT-PCR Kit are carried out.

Reactions steps are as follows:

1. following mixed liquor is prepared in Microtube pipes.

dNTP Mixture (10 mM) 1 μl

Oligo dT Primer (2.5μM) 1μl

Total RNA 4 μl

Rnase free H₂O 4 μl

2. it is denatured in PCR instrument, annealing reaction.

65℃ 5 min

4℃ 1 min

3. the centrifugation several seconds makes the mixed liquor of RNA/ primers etc. be gathered in Microtube bottom of the tube.

4. prepare following inverse transcription reaction liquid in above-mentioned Microtube pipes.

The μ l of reaction solution 10 after above-mentioned denaturation, annealing

5×PrimerScript^TM Buffer 4 μl

RNase Inhibitor (40U/μl) 0.5 μl

PrimScript^TM RTase 0.5 μl

Rnase Free dH₂O 5 μl

5. carry out reverse transcription reaction by following condition in PCR instrument

42℃ 15-30 min

95℃ 5 min

4℃

PCR reacts and electrophoresis

1. using cDNA as template, enter performing PCR reaction.Primer is as follows

TaAct-S：5’- GTTCCAATCTATGAGGGATACACGC -3’

TaAct-A：5’- GAACCTCCACTGAGAACAACATTACC -3’

TaEXP-S：5′- CTCCAAGCCCCGTTCTCGTTC -3′

TaEXP-A：5′- CGCGGCCGCTCACAATTCC -3′

2. PCR systems：

ddH₂O 4.7μl

10× buffer 2μl

Primer1（2μM） 1μl

Primer2（2μM） 1μl

dNTP（10mM each） 0.2μl

rTaq polymerase（5U/μl） 0.1μl

The μ l of reverse transcription cDNA templates 1

Total Volume 10μl

3. PCR programs：

94 DEG C of 5min, 25~30 94 DEG C of cycles 20s, 57 DEG C of 60s, 72 DEG C of 45s；72℃ 5min.

PCR period is determined according to internal reference Actin amplification situation, adjusts the addition of cDNA templates.

4. 1% agarose gel electrophoresis.

As a result only when using wheat root cDNA as template specific band has been expanded, saved under wheat leaf, fringe and young fringe There is no amplified band in cDNA, this shows, the expansin is that root specifically expressing obtains expansin.As a result see attached Fig. 1.

Embodiment 2

Wheat root specifically expressing expansin promoter TaREXP clone

Wheat volatiles DNA extraction

1. using CTAB methods extraction wheat spire genomic DNA.Step is：

(1) take wheat root about 0.5g to be ground in liquid nitrogen, be placed in 1.5ml centrifuge tubes, add 700 μ l Extraction buffers （100 mmol/L Tris-HCl, 50 mmol/L EDTA-Na₂, 100mmol/L NaCl, 1.5%CTAB, 2% mercaptoethanols）, 65 ^o30-60min is incubated in C water-baths, overturns mix 3-4 times therebetween；

(2) centrifuge tube is taken out, 700 μ l phenol are added into every pipe：Chloroform：Isoamyl alcohol（25:24:1）Solution, mix 10min；

(3) 10000rpm centrifuges 10min；

(4) pipette tips are used（Cut off front end 1/3）Supernatant is slowly extracted into another 1.5ml centrifuge tube；

(5) isometric chloroform is added：Isoamyl alcohol（24:1）Repeat above-mentioned extractive process.Slowly take out supernatant；

(6) isopropanol precipitating of 0.6 times of volume is added, is gently mixed, stands a period of time；

(7) DNA precipitations are chosen with 200 μ l pipette tips；

(8) 70% alcohol flushing 2 ~ 3 times, DNA was in drying at room temperature 10 minutes；

(9) 500 μ l deionized waters are added, 4 ^oC dissolves.

2. Wheat volatiles DNA purifying

(1) 1-5 μ lRNA enzymes are added in the DNA of dissolving（10mg/ml）, 37 ^oC is incubated 1h；

(2) isometric phenol is added：Chloroform：Isoamyl alcohol（25:24:1）Solution, mix；

(3)4 ^oC 10000rpm centrifuge 10min；

(4) supernatant is taken into another centrifuge tube；

(5) isometric chloroform is added：Isoamyl alcohol（24:1）Repeat above-mentioned extractive process；

(6) supernatant is taken to move on to a new 1.5ml centrifuge tubes；

(7) the 3mol/L NaAc of 1/10 volume are added, the cold absolute ethyl alcohol of 2 times of volumes is added after mixing, is gently mixed；

(8) it is stored at room temperature 10 minutes, chooses DNA precipitations with toothpick；

(9) with 70% alcohol flushing 2 ~ 3 times, room temperature is placed to alcohol-free taste；

(10) DNA adds 100 μ l deionized water dissolvings, determines DNA concentration with ultraviolet specrophotometer, and pass through agarose Detected through gel electrophoresis DNA quality, sample is -20^oC is preserved.Finally according to DNA concentration, a part is diluted, 4 ^oC is preserved and treated With.

Wheat root specifically expressing expansin promoter（TaREXP）Clone

Using GenomeWalker method（Clontech,CA,USA）Clone wheat expansin promoter TaREXP, detailed process by specification are carried out.The primer sequence of gene specific is：

RExp-1: 5ˊ-GAGGACCAGGACCGGCGGCTGCTAG-3ˊ

RExp-2: 5ˊ-CCGGAGATGGGGCTTACGAAAATTG-3ˊ

The agarose gel electrophoresis detection and recovery of pcr amplification product

Pcr amplification product finds to amplify the band of a treaty 1kb with 1% agarose gel electrophoresis detection, to expanding bar Band uses the agarose gel QIAquick Gel Extraction Kit of Tiangen companies, and step by specification is carried out.

PCR primer is connected with pGEM-T (Promega) carrier

Following component is sequentially added in PCR pipe：

The μ l of PCR primer 7 of recovery

The μ l of 10 × T4 ligase buffer solutions 1

The μ l of pGEM-T carriers (50ng/ μ l) 1

T4DNA ligases（3U/μl）(Takara) 1μl

dH₂O to 10 μ l

In 16 DEG C of water-bath connections overnight.

The clone for reclaiming fragment and sequencing

1. the preparation of competent escherichia coli cell

(1) take out and be stored in glycerine from -80 DEG C of refrigeratorsE.coliDH5a bacterial strains（It is that epoch biology is public purchased from day Department）, it is placed on ice slowly defrosting.

(2) rule on superclean bench with oese（LB solid mediums, without Amp）.

(3) by flat board in 37 DEG C of incubated carton upside down overnight incubations.

(4) single bacterium colony on picking flat board is inoculated in the test tube of the fluid nutrient mediums of LB containing 5ml, 37 DEG C of shaken cultivations 14-16 hours.

(5) 0.5ml bacterium solutions are taken to be inoculated in the 250ml of the fluid nutrient mediums of LB containing 50ml triangular flask, 37 DEG C of vibrations （260rpm）Cultivate 2-3 hours（OD₂₆₀=0.5）.

(6) bacterium solution of culture is put 1 hour on ice.

(7) 4 DEG C centrifuge 4 minutes（4000rpm）, remove supernatant.

(8) thalline is gently suspended with the solution A of 25ml ice precoolings, then is placing 40-45 minutes on ice.

(9) repeat step（8）.

(10) thalline is gently suspended with the solution B of 2.5ml ice precoolings, bacterium solution is then dispensed into 1.5ml centrifugations Guan Zhong（The often μ l of pipe 100）, it is standby to be put into -80 DEG C of refrigerators.

The conversion of connection product

(1) 1 pipe is taken out from -80 DEG C of refrigerators（100μl）Competent cell, put and slowly thaw 30 minutes on ice.

(2) 5 μ l ligation reactions are added on superclean bench into pipe, are gently shaken up, are put 30 minutes on ice.

(3) 42 DEG C of water-bath heat shocks 90 seconds, put rapidly 3-5 minutes on ice.

(4) 1ml LB fluid nutrient mediums are added into centrifuge tube on superclean bench（Without Amp）, 37 DEG C are shaken after mixing Swing culture 1 hour（260rpm）.

(5) 5000rpm is centrifuged 6 minutes at room temperature, discards 900 μ l supernatants, by remaining 100 μ l supernatants again suspended bacteria Body, 40 μ l X-gal and 4 μ l IPTG are added, mix, be then uniformly coated onto it on flat board of preparation with spreader, placed 30 minutes.

(6) flat board is inverted to take out overnight, during obvious single bacterium colony to appear in 37 DEG C of constant incubators.

(7) 4 DEG C of refrigerator a few hours are put into, make blue hickie color clearly demarcated.

(8) with the toothpick picking hickie of sterilizing in equipped with 10ml LB fluid nutrient mediums（Containing 60 μ g/mlAmp）Test tube in, 37 DEG C are shaken bacterium and stayed overnight.

The PCR identifications and sequencing of recombinant plasmid

There are T7 promoters the upstream of the cloning site of this experiment pGEM-T carriers used, and there are SP6 promoters in downstream, so Primer pair Insert Fragment can be made of the two promoter sequences to be expanded, and recombinant plasmid is identified, evaluation program is such as Under：

(1) the shaken μ l of bacterium solution 50 are taken in 1.5ml centrifuge tubes with pipettor on superclean bench, then is added into centrifuge tube 50 μ l ultra-pure waters.

(2) 100 DEG C after denatured by boiling 10 minutes, are placed on ice.

(3) the μ l of PCR amplification cumulative volumes 20：Including the 2 μ l of μ l, 10 × buffer of plasmid template 10（Containing MgCl₂）, dNTP Each 20ng/ μ l, 1U Taq enzyme of 10mmol/L, T7 and SP6 primer.Reaction condition is：94 DEG C, 5 minutes；30 circulations：94 DEG C, 1min；56 DEG C, 1min；72 DEG C, 2min；72 DEG C of extension 5min.

Amplified production is detected with 1% agarose electrophoresis, takes the bacterium solution of positive colony to send company to be sequenced.Sequencing result table The fragment that bright PCR amplifications obtain has the nucleotide sequence of sequence 1 in sequence table.Sequence alignment is carried out to sequence, the results showed that Gene-specific primer used when 3 ' ends of the sequence are containing amplification promoter, and 3 ' ends are swollen with the wheat of this laboratory clone Swollen plain geneTaEXP5 ' terminal sequences it is identical, it was demonstrated that above-mentioned cloned sequence fragment isTaEXPThe promoter sequence of gene Row.Utilize plantCARE databases and reference literature（Kim et al., 2006）Described root hair specifically expressing cis acting Element sequences feature carries out cis-acting elements prediction to gained promoter sequence, it is found that promoter region contains contained by promoter TATA-box, CAAT-box, root hair specifically expressing cis-acting elements RHE and response hormone and adverse circumstance ABRE, W box Deng cis-acting elements（Accompanying drawing 2）.The different expression pattern of function and Gent of this and the gene of supposition is consistent.

Embodiment 3

Wheat expansin promoter expression vector（pCAM1391Z/TaREXP）Structure

Contained respectively according to promoter TaREXP sequences DesignsHindIII andEcoRI promoter upstream and downstream primer, primer Title and sequence are REXP1: 5ˊ-CCCAAGCTTCCTTCTGGTCCGAATTGGAC-3ˊ (HindIII),

REXP2:5ˊ-CGGAATTCTGATAATCTAGCTATCAGTCAG-3ˊ(EcoRⅠ)。

Using the plasmid containing promoter sequence as template enter performing PCR amplification, pcr amplification product through electrophoresis, recovery after with PGEM-T easy carriers connect, and convert Escherichia coli, extract plasmid.WithHindIII andEcoRI is respectively to pCAM1391Z carriers With containing TaREXP promoters pGEM-T easy carriers carry out double digestion, be separately recovered pCAM1391Z carriers large fragment and TaREXP promoter small fragments, bacillus coli DH 5 alpha competent cell, extraction restructuring matter are converted after being connected with T4 DNA ligases Digestion identification recon, digestion products the purpose promoter band of visible suitable size and incision after electrophoresis detection are carried out after grain Carrier ribbon, show that constructed plant expression vector is correct.

Plasmid pCAM1391Z carriers and pGEM-T easy carriersHindIII andEcoRI double digestions

Alkaline lysis method of extracting pCAM1391Z empty carriers and pGEM-T easy plasmids, 10 μ g digestions are respectively taken, digestion system is such as Under：

HindⅢ 1μl

EcoRⅠ 1μl

PCAM1391Z carriers/μ the l of pGEM-T easy plasmids 4

10×Buffer M 1μl

ddH₂O To 20μl

In 37 DEG C of thermostat water bath digestions more than 3 hours.Using 1 × TAE as electrophoretic buffer after double digestion, digestion is produced Thing carries out 0.8% agarose gel electrophoresis, the large fragment of pCAM1391Z carriers in being cut under ultraviolet transilluminator with clean blade With the target gene band of about 1kb in pGEM-T, the band is reclaimed.

The connection of digestion products

PCAM1391Z carrier vectors fragment and pGEM-T easy double digestions recovery fragment through digestion（About 1kb）To rub That ratio 1:4 ratio carries out 16 DEG C of connections overnight.

The conversion of connection product

Connection product heat shock method converts bacillus coli DH 5 alpha competent cell, LB of the transformed bacteria in the μ g/ml containing Kan 50 Cultivated 16 hours or so for 37 DEG C on solid plate.

The identification of recon

Plasmid enzyme restriction is identified

Positive colony plasmid is extracted, plasmid is carried outHindIII HeEcoRI double digestion, digestion system are same as above.0.8% fine jade The promoter purpose band and the carrier segments of incision that sepharose electrophoresis detection is cut open, two stripe sizes are correct, show to carry Body structure is correct.

Embodiment 4

The preparation and conversion of Agrobacterium competence

The preparation of Agrobacterium GV3101 competence

(1) from picking Agrobacterium tumefaciems single bacterium colony on YEP flat boards (containing 50 μ g/ml rifampins), it is inoculated in containing 50 μ g/ml

In the YEP fluid nutrient mediums of rifampin, 200rpm/min, 28 DEG C of overnight incubations；

(2) take 2ml to be incubated overnight liquid to be inoculated in YEP fluid nutrient mediums of the 50ml containing identical antibiotic in identical bar Part

It is lower to cultivate to OD₆₀₀Up to 0.5；

(3) bacterium solution ice bath 30min, 4 DEG C, 5000rpm centrifugation 10min, thalline is collected；

(4) thalline is resuspended in the 10ml 0.15mol/L NaCl of ice bath, thalline is collected by centrifugation；

(5) it is resuspended in the CaCl of 1ml 20mmol/L ice precoolings₂In solution, bacterium solution is divided in 200 μ l/ pipes 1.5ml

In Eppendorf pipes, quick-frozen 1min in liquid nitrogen is put, -70 DEG C save backup.

Freeze-thaw method conversion Agrobacterium tumefaciems GV3101

(1) melt Agrobacterium competent cell at room temperature, add 1 μ g expression vector DNAs, ice bath after mixing

30min；

(2) liquid nitrogen flash freezer 1min is put, moves to 37 DEG C of insulation 3min rapidly；

(3) YEP 800 the μ l, 28 DEG C of concussion and cultivate 3hr of antibiotic-free are added；

(4) 7000rpm centrifuges 30s and collects thalline, is applied to the YEP containing 50 μ g/ml rifampins, 50 μ g/ml Kan On flat board, 28 DEG C are inverted light culture 2-3 days.

Thalline PCR is identified and electrophoresis

Thalline PCR methods and program and electrophoresis adjust PCR72 DEG C of extension of time 1min with 1.4 according to expanding fragment length 30sec。

Embodiment 5

Functional verification-transformation of Arabidopsis thaliana of promoter and GUS histochemical stains identification

Arabidopsis is planted

By wildtype Arabidopsis thaliana seed with 7.5% liquor natrii hypochloritis（Including 7.5% sodium hypochlorite and 0.01% Triton-X 100）Sterilization 15 minutes, then with rinsed with sterile water 5-6 time, put and be sowed on MS flat boards, in 4 °C of vernalization 2-3 days, then transplant Into nutritive cube（Nutrition Soil is mixed with vermiculite by equal proportion）, 23 °C of cultures, 16/8 h photoperiods, 30-40 μm ol μm of light intensity^-2 μ s^-1；Plant to be planted Post flowering, its major branch top is cut off, promote side shoot to develop, in 4-6 days after beta pruning, carried out Agrobacterium and turn Change.

The preparation of Agrobacterium

The GV3101 Agrobacteriums containing pCAM1391Z/TaREXP carriers are inoculated with respectively in 10mLYEB culture mediums（100 Mg/L rifampins, 25 mg/L celebrating greatly and 100 mg/L cards that）In, 28 DEG C of culture shaken overnights, turn to be inoculated in 500 after so containing Expand culture in YEB culture mediums of the ml containing identical antibiotic, 5 000 rpm centrifuge 15 min precipitation thalline, by Agrobacterium weight It is suspended from 200 ml conversion buffer solutions（MS a great number of elements, 3% sucrose, 0.03%Silwet-77）, OD600 ≈ 0.8-1.

Transformation of Arabidopsis thaliana

200 ml bacterium solutions are poured into tray.By the arabidopsis back-off trimmed and all inflorescences are made to immerse suspension bacteria liquid In, it is gently agitated for being stained with and spends 30 sec^-1 Min, take out flowerpot side and be put in pallet, wrapped up with freshness protection package with moisturizing, pallet is put secretly 24 h of place's culture, then take out nutritive cube and uprightly place, recover illumination, continue to cultivate plant to maturation.

The screening of positive plant

T0 is for seed with 7.5% liquor natrii hypochloritis（Including 7.5% sodium hypochlorite and 0.01% Triton-X 100）Sterilization Afterwards, program request is on MS selection culture plates (50 mg/L kanamycins), vernalization 2-3 days at 4 DEG C, moves into culturing room and trains Support, about 10 days or so, select kalamycin resistance plant（1-2 pairs of true leaf is grown, root is extended into culture medium）And it is transplanted to In nutritive cube, culture is until seed maturity.

The PCR identifications of transgenic arabidopsis

The extraction of arabidopsis thaliana genomic dna is the same as embodiment 2；

PCR system, program and deposition condition are the same as embodiment 4.Testing result shows visible in transgenic arabidopsis strain To the foreign gene band of suitable size.Show that exogenous promoter has been transferred to Arabidopsis plant.

GUS is dyed

(1) draw materials：Collect the control and the whole strain seedling of non-transgenosis, blooming flower sequence, prematurity of T1 generation growths 1-2 weeks And ripe Fruit pod, it is put into rapidly in 90% acetone equipped with precooling in test tube, 30 min of room temperature decolouring；

(2) material is transferred to the dye solution without X-gluc of precooling（0.2% Triton X-100,2 mmol/ L potassium ferrocyanides, the 2mmol/L potassium ferricyanides, 50 μm of ol/L sodium phosphate buffers, pH7.2）Middle washing；

(3) dye：Washing dye solution is removed, adds the dye solution containing X-gluc（0.2% Triton X- 100,2 mmol/L potassium ferrocyanides, the 2 mmol/L potassium ferricyanides, 2 mmol/L X-gluc, 50 μm of ol/L sodium phosphates delay Fliud flushing, pH7.2）, and sample is put into vacuum filtration 15-20 min on ice, until all material is immersed in solution；

(4) 37 DEG C of stained over night are transferred material into or are dyed two days；

(5) it is dehydrated：When occurring blue Deng tissue, dyeing liquor is removed, with 20%, 35%, 50% Gradient elution using ethanol, is often walked 30 min。

(6) it is fixed：Material is placed on FAA（50% ethanol, 10% glacial acetic acid, 5% formaldehyde）In in room temperature fix 30 min；

(7) FAA is removed, adds 70% ethanol；

(8) material is directly observed under the microscope and is taken a picture.As a result find：GUS is had no in non-non-transgenic control lines Gene expression, and gus gene is detected in transfer-gen plant and is expressed.And GUS coloration results show, the Expansin genes Promoter there is expression activity, it is specific expressed in root gus gene to be started（Accompanying drawing 3）, more specifically in root hair Area is specific expressed（Accompanying drawing 3D）, do not express at the tip of a root（Accompanying drawing 3B, C）.Simultaneously at the vascular bundle of leaf, flower, Fruit pod and root Have no expression（Accompanying drawing 3B, E, F）.This is also with the function of the homologous gene of the gene reported in barley " with rising for roots development There is relation beginning " it is consistent.

Sequence table

<110>University Of Ji'nan

<120>The promoter of wheat root specifically expressing expansin and its application

<141>2015-5-8

<160> 1

<210> 1

<211>963

<212>DNA

<213>Wheat

<221>The promoter of wheat root specifically expressing expansin and its application

<222>（1）…（963）

<400>1

1 CGACGGCCCG GGCTGGTCCT GCGCCCCCCT TCTGGTCCGA ATTGGACAAG GGAGGTAGCC

61 CACTTTTCCT TCTCCCTCTC CTCCTCTTTC CCTCTCCAAC AAGGAAAGGA GGAGTCCTAC

121 TCCTCCTCTT TCCTTCTCCA ACAAGGAAAG GAGGAGTCCT GGCGCGCCTC CTCCATAGGC

181 CGGCCGCCTG CCCCCTTGCT CCTATATATA CGGGGGCAGG GGGACACCCC AAAGACACAA

241 CAACAATTGA TCCTTGAGAT CTATTAGCCG TGTGCGGTGC CCCCCTCCAC CATAGTCCTC

301 CTCGATAATA TTGTAGCGGT GCTTAGGCGA AGCCTTGCGA CGGTAGAACA TCTAGATCGT

361 CACCATGCCG TCGTGCTGAC GGAACTCTCC CTCGACACTC GGCTGGATCG GAGTTCGAGG

421 GACGTCATCG AGCTGAACGT GTGCTAGAAC TCGGAGGTGC CGTAGTTTCG GTGCTTGATC

481 GGTCGGGCCG TGAAGACGTA CAACTACATC AACCGCGTTG TTCTAAAAAA AAAAACAGTT

541 TGTATGACCA ATTTGCTCGA GATGGGCCGT TTGAGTATTT GACCCCACGC GCACATATGG

601 ACGCAATCAC GCAACTAACC CGGCCGGATG AGTCATCTTT ACCCAAAATC TCCGGAGTTG

661 ACAGAGCCTT CAGCGCCATG GCCCCGTCAT CAAAGGATCG CCCGCTCCGT CTGAGTTGAC

721 CACAGTGCAA GCATGTATGC GCGCCCTCTC CCTAAACCTC AGTAGTCGCC AGCACGTTCG

781 CCTCCATAAT TCGTGTGTGC ACGACTAAAC GTATTCGCTC CCACGTTTAT AACACGTAAA

841 CCATCCTATA TATACCACCC CGAATCGCAC TAGTCCTGCA AGCAACACCG AGTTCTTGGT

901 ACTACCCAAC AAACCTAGCT AGCCCATTGG CTTTCTGTCT CCTGACTGAT AGCTAGATTA

961 TCA

Primer sequence

TaAct-S：5′- GTTCCAATCTATGAGGGATACACGC -3′

TaAct-A：5′- GAACCTCCACTGAGAACAACATTACC -3′

TaEXP-S：5′- CTCCAAGCCCCGTTCTCGTTC -3′

TaEXP-A：5′- CGCGGCCGCTCACAATTCC -3′

RExp-1: 5ˊ-GAGGACCAGGACCGGCGGCTGCTAG-3ˊ

RExp-2: 5ˊ-CCGGAGATGGGGCTTACGAAAATTG-3ˊ

REXP1: 5′- CCCAAGCTTCCTTCTGGTCCGAATTGGAC-3ˊ

REXP2: 5′-CGGAATTCTGATAATCTAGCTATCAGTCAG-3ˊ

Claims (5)

1. A kind of 1. promoter of wheat root specifically expressing expansin, it is characterised in that：

   The nucleotide sequence of the promoter is as shown in SEQ ID No.1.
2. 2. the plant expression vector pCAM1391Z/TaREXP containing promoter described in claim 1.
3. 3. application of the promoter described in claim 1 in root specific expression protein is produced.
4. 4. application of the promoter described in claim 1 in wheat is cultivated.
5. 5. application of the plant expression vector in wheat is cultivated described in claim 2.