CN104293962A - Method for screening general primers - Google Patents
Method for screening general primers Download PDFInfo
- Publication number
- CN104293962A CN104293962A CN201410556794.XA CN201410556794A CN104293962A CN 104293962 A CN104293962 A CN 104293962A CN 201410556794 A CN201410556794 A CN 201410556794A CN 104293962 A CN104293962 A CN 104293962A
- Authority
- CN
- China
- Prior art keywords
- primer
- consensus
- template
- pcr
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for screening general primers. The method particularly comprises the following steps: selecting a to-be-amplified target sequence as a template; designing a pair of specific primers, m positive public primers and n reverse public primers; respectively connecting public primers, restriction enzyme cutting sites and protection base at the 5' ends of the specific primers to combine into a 'long primer'; carrying out PCR amplification on the 'long primer' to obtain a PCR product which is homogenous with the public primers; leading the template sequence into a plasmid vector; transferring plasmids into competent escherichia coli cells by transformation to obtain a plasmid template of the public primers; and achieving sensitive screening of m*n pairs of public primers through permutation and combination by using the plasmid template. Therefore, the target of efficiently screening the public primers can be achieved, and the method has the advantages of being high in efficiency, rapid and simple in operation.
Description
Technical field
The invention belongs to field of biology, be specifically related to a kind of method of screening consensus primer.
Background technology
Multiplex PCR (multiplex polymerasechainreaction, MPCR) be improve on Standard PCR basis and a kind of novel PC R amplification technique grown up, namely can add two to above primer in a reaction system, amplify multiple nucleic acid fragment simultaneously.But due to the restriction (as dimer probability increase between primer, product size are difficult to distinguish) of various condition, the primer pair quantity that can increase in each reaction system is limited.For the technical bottleneck of multiplex PCR, now have and hold the method for adding consensus primer to improve its detection flux at multi-primers 5'." consensus primer " namely adds the single strand oligonucleotide acid fragment of one section of 10-30 base at the 5' end of every bar multiple PCR primer, the special primer of consensus primer and amplified target sequence connects and composes chimeric primers.In conventional multi-PRC reaction mixed system (PCR reaction solution, Taq enzyme, dNTP), add consensus primer, chimeric primers, template, carry out pcr amplification.The use of consensus primer reduces the consumption of chimeric primers, decreases dimeric formation between primer, therefore can improve the detection flux of multiplex PCR.This multiple PCR method finally carries out a large amount of amplification by consensus primer, and consensus primer is as the core technology of whole system, and its quality determines the success or failure of whole multiplex PCR system, and therefore, design and the selection of consensus primer are most important to multiplex PCR system.
The design of current primer is mostly undertaken by computer program, use corresponding software and database, as Primer5.0, oligo6, ncbi database etc., follow fundamental principle and the precaution of design of primers, through the base sequence of blast compare of analysis determination primer, then carry out synthesizing and experimental verification.But in experimentation, due to a variety of causes (as template problem, primer feasibility, Sensitivity and Specificity etc.), the theoretical primer of synthesis and the result of actually operating always there will be and are not inconsistent.
At present, for the analysis of primer, all to there is clear and definite target sequence, just can build plasmid template and carry out detection analysis.The design of consensus primer does not rely on target sequence, and therefore, existing analytical procedure is not suitable for the screening of consensus primer.Simultaneously, in multi-PRC reaction, consensus primer runs through whole experiment, whole PCR system is played a decisive role, when setting up the multiplex PCR system that " consensus primer " mediates, first need the selection considering consensus primer, generally can not change consensus primer easily, if but in experimentation, find that consensus primer is improper, except changing consensus primer, also will the transfer of other special primer in consideration system, be easy to " pulling one hair and move the whole body ", therefore, for consensus primer, if there is no suitable screening method, both easily expended financial resources, wasted time and energy again.
Summary of the invention
The object of this invention is to provide a kind of method of screening consensus primer, the consensus primer of applicable concrete multiplexed PCR amplification system can be selected thus efficiently, accurately.
To achieve the above object of the invention, the technical solution used in the present invention is: a kind ofly screen the right method of consensus primer, comprises the following steps:
(1) for target sequence to be amplified, 1 pair of special primer and m bar forward consensus primer and the reverse consensus primer of n bar is designed; M+n is 3 ~ 10;
(2) connect m bar forward consensus primer, restriction enzyme site sequence, protection base sequence successively at the 5' end of the right forward primer sequence of special primer, obtain the forward primer of long primer centering;
Connect the reverse consensus primer of n bar, restriction enzyme site sequence, protection base sequence successively at the 5' end of the right reverse primer sequences of special primer, obtain the reverse primer of long primer centering;
The forward primer of long primer centering and the reverse primer of long primer centering form long primer pair;
(3) with target sequence to be amplified for template, with the special primer of step (1) to carrying out first time pcr amplification, obtain the first PCR primer; Then with the first PCR primer for template, with the long primer of step (2) to carrying out second time pcr amplification, obtain the second PCR primer; Then the second PCR primer is imported plasmid vector; By transforming, this plasmid vector is proceeded to competent escherichia coli cell again; Then cultivate bacterial classification, then extract plasmid template;
(4) by permutation and combination, the m bar forward consensus primer of step (1) and the reverse consensus primer of n bar are paired into m × n to consensus primer;
(5) with the plasmid template of step (3) for template, respectively to each consensus primer of step (4) to carrying out sensitivity analysis, complete the screening of consensus primer.
In technique scheme, in step (1), special primer is designed to prior art, common rule according to design of primers designs, if base number is at 15-30bp, GC content is generally 40%-60%, 3' end is avoided with base A ending as far as possible, and annealing temperature is basically identical, avoids in primer or dimeric generation etc. between primer; A pair Auele Specific Primer is designed for the target sequence that will increase.
In technique scheme, in step (1), the design of consensus primer is with reference to the consensus primer principle of design in Chinese patent application CN201410153342.7 and method.
In such scheme; the selection of step (2) restriction enzyme site and protection base; with reference to method and the principle of general double digestion; as goal gene fragment internal can not containing the restriction enzyme site be allowed a choice; the carrier used should containing the restriction enzyme site be allowed a choice; it is too near that two restriction enzyme sites can not lean on, and avoids selecting isocaudarner, use the enzyme etc. having common buffer as far as possible.
In technique scheme, in step (3), first time, pcr amplification was with pcr amplification condition is the same for the second time, all adopted 25 μ L reaction systems: the Taq polymerase 0.15 μ L of the forward primer of 10 μMs and each 1 μ L, the 5U/ μ L of reverse primer, the MgCl of 25mM
2the dNTP 0.5 μ L of 2 μ L, 10mM, 10xTaqBuffer 2.5 μ L, DNA profiling 1 μ L, sterilizing ddH
2o16.85 μ L; PCR reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; Last 72 DEG C extend 10min.
In technique scheme, in step (3), described plasmid vector is pMD19-T.Second PCR primer is imported plasmid vector be specially: first carry out double digestion, agarose gel electrophoresis to the second PCR primer of pMD19-T carrier and recovery, purifying reclaims carrier large fragment and object fragment, then the two is coupled together.Adopt 50 μ l enzymes to cut system, comprising: 10 × buffer 5 μ l, DNA 2 μ g, XbaI 1 μ l, SphI 1 μ l, sterilizing ddH
2o to 50 μ l, 37 DEG C of water-bath 1.5-2h; Adopt 25 μ l linked systems, comprising: 10 × T4 DNA ligase buffer 2.5 μ l, target DNA 0.3pmol, carrier DNA 0.1pmol, T4 DNA ligase 1 μ l, sterilizing ddH
2o to 25 μ l, 16 DEG C of connections are spent the night.
In technique scheme, by conversion, plasmid vector transfer is entered competent escherichia coli cell in step (3) and be specially: get 10 μ l ligation liquid and add in 50 μ l DH5 α competent cells, in ice, place 15min.Then 42 DEG C of heating 45s, then 5min is placed in ice, add in the negative LB liquid nutrient medium of 800 μ l Amp, 1h is cultivated in 37 DEG C of concussions.Then whole converted product is coated on the LB solid medium containing Amp, after bacterium liquid blots, be inverted culture dish, overnight incubation in 37 DEG C of thermostat containers.The single bacterium colony of picking, be inoculated in the positive LB liquid nutrient medium of 5ml Amp respectively, 37 DEG C of concussion overnight incubation, then get 2 μ l bacterium liquid and carry out PCR detection, the bacterium liquid getting the result positive carries out sequence verification.
In technique scheme, extract plasmid template in step (3) and operate according to the specification sheets of extraction of plasmid DNA test kit.
In technique scheme, in step (5), sensitivity analysis is specially: consensus primer is obtained after permutation and combination m × n to consensus primer, carry out sensitivity Detection respectively to m × n to consensus primer.More specifically after being extracted from intestinal bacteria by the plasmid containing consensus primer sequence, obtain plasmid template, then carry out 10 times of gradient dilutions with deionized water, obtain 10 successively
7, 10
6, 10
5, 10
4, 10
3, 10
2, the dilution plasmid template solution of 10 copies/ μ l.Each extent of dilution gets 1 μ l as template, carries out PCR reaction respectively to m × n to consensus primer.Reaction system 25 μ l comprises: the Taq polymerase 0.15 μ L of the forward consensus primer of 10 μMs and each 1 μ l, the 5U/ μ L of reverse consensus primer, the MgCl of 25mM
2the dNTP 0.5 μ L of 2 μ L, 10mM, 10xTaqBuffer 2.5 μ L, DNA profiling 1 μ L, sterilizing ddH
2o 16.85 μ L.Reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 50 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; 72 DEG C extend 10min.
In technique scheme, the sensitivity analysis result right according to each consensus primer of step (4) can screen applicable consensus primer pair.In order to make result more accurate, to each consensus primer to carrying out 2 ~ 5 sensitivity analyses respectively, result can be filtered out closest, especially identical consensus primer pair, being the consensus primer pair of applicable multiplexed PCR amplification system.
Because technique scheme is used, the present invention compared with prior art has the following advantages:
(1), the present invention makes public for the first time and a kind ofly screens the right method of consensus primer, by a small amount of consensus primer number (m+n bar), just can realize, to the screening operation of most consensus primer to (m × n to), reaching and reducing costs, high frequency zone object.
(2), many consensus primer sequences import in same plasmid vector by the present invention, while avoiding template differentia influence, can the susceptibility of disposable differentiation multipair consensus primer amplification, according to the consensus primer pair that the order of excellence Effective selection of analytical results is suitable, both workload was decreased, shorten the time again, there is the advantages such as simple to operate, quick, effective.
Accompanying drawing explanation
Fig. 1 is the structural representation containing the target DNA fragment of consensus primer sequence in embodiment one;
Fig. 2 is the plasmid template part sequencing result figure built in embodiment one;
Fig. 3 is the PCR primer agarose gel electrophoresis figure that in embodiment one, A consensus primer is right;
Fig. 4 is the PCR primer agarose gel electrophoresis figure that in embodiment one, B consensus primer is right;
Fig. 5 is the PCR primer agarose gel electrophoresis figure that in embodiment one, C consensus primer is right;
Fig. 6 is the PCR primer agarose gel electrophoresis figure that in embodiment one, D consensus primer is right;
Fig. 7 is the PCR primer agarose gel electrophoresis figure that in embodiment one, E consensus primer is right;
Fig. 8 is the PCR primer agarose gel electrophoresis figure that in embodiment one, F consensus primer is right;
Fig. 9 is the PCR primer agarose gel electrophoresis figure that in embodiment one, G consensus primer is right;
Figure 10 is the PCR primer agarose gel electrophoresis figure that in embodiment one, H consensus primer is right;
Figure 11 is the PCR primer agarose gel electrophoresis figure that in embodiment one, I consensus primer is right.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the invention will be further described
Embodiment one, using mankind β-actin gene order as target sequence to be amplified, screens consensus primer
1. the design and synthesis of primer
Select one section of mankind β-actin gene order as template, design a pair special primer, i.e. SEQ ID No.1 and SEQ ID No.2, product size is 553bp.With reference to consensus primer principle of design in Chinese patent application CN201410153342.7 and method design 3 forward consensus primers (SEQ ID No.3, SEQ ID No.4, SEQ ID No.5) and 3 reverse consensus primers (SEQ ID No.6, SEQ ID No.7, SEQ ID No.8), connect SEQ ID No.5, SEQ ID No.3, SEQ ID No.4 totally 3 consensus primer sequences, restriction enzyme SphI and protection bases respectively successively at the 5 ' end of special primer SEQ ID No.1, form long primer SEQ ID No.9; SEQ ID No.8, SEQ ID No.6, SEQ ID No.7 totally 3 consensus primer sequences, restriction enzyme XbaI and protection bases are connected respectively successively at the 5 ' end of special primer SEQ ID No.2; form long primer SEQ ID No.10; the protection base of SphI and restriction enzyme site are the protection base of ACATGCATGC, XbaI and restriction enzyme site is GCTCTAGA.Consensus primer, special primer and long primer sequence are in table 1.
Table 1 consensus primer, special primer and long primer sequence
2. the amplification of target gene and the preparation of object fragment
First, with special primer SEQ ID No.1 and SEQ ID No.2, pcr amplification is carried out to mankind β-actin gene order, obtain the first PCR primer with specific primer sequences, then with the first PCR primer for template, carry out second time pcr amplification with long primer SEQ ID No.9 and SEQ ID No.10, obtain the second PCR primer with long primer sequence, finally reclaim the second PCR primer, obtain the target DNA fragment containing consensus primer sequence, accompanying drawing 1 is its structural representation.
The reaction system of twice PCR amplification is consistent with reaction conditions, and 25 μ l reaction volumes comprise: the Taq polymerase 0.15 μ L of the forward primer of 10 μMs and each 1 μ l, the 5U/ μ L of reverse primer, the MgCl of 25mM
2the dNTP 0.5 μ L of 2 μ L, 10mM, 10xTaqBuffer 2.5 μ L, DNA profiling 1 μ L, sterilizing ddH
2o 16.85 μ L.Reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; Last 72 DEG C extend 10min.
3. the structure of plasmid template
adopt double digestion method, respectively enzyme is carried out to the second PCR primer of pMD19-T carrier and recovery with XbaI and SphI and cut, with T4 ligase enzyme, the two is linked together after reclaiming digestion products.The 50 μ l enzyme systems of cutting comprise: 10 × buffer 5 μ l, DNA 2 μ g, XbaI 1 μ l, SphI 1 μ l, sterilizing ddH
2o to 50 μ l, 37 DEG C of water-bath 1.5-2h.25 μ l linked systems comprise: 10 × T4 DNA ligase buffer 2.5 μ l, target DNA 0.3pmol, carrier DNA 0.1pmol, T4 DNA ligase 1 μ l, sterilizing ddH
2o to 25 μ l, 16 DEG C of connections are spent the night.
Transform after connection, the concrete steps of conversion are as follows: get 10 μ l ligation liquid and add in 50 μ l DH5 α competent cells, place 15min in ice.Then 42 DEG C of heating 45s, then 5min is placed in ice, add in the negative LB liquid nutrient medium of 800 μ l Amp, 1h is cultivated in 37 DEG C of concussions.Then whole converted product is coated on the LB solid medium containing Amp, after bacterium liquid blots, be inverted culture dish, overnight incubation in 37 DEG C of thermostat containers.The single bacterium colony of picking, be inoculated in the positive LB liquid nutrient medium of 5ml Amp respectively, 37 DEG C of concussion overnight incubation, then get 2 μ l bacterium liquid and carry out PCR detection, the bacterium liquid getting the result positive carries out sequence verification, obtains the plasmid template containing consensus primer sequence.The plasmid template sequencing result extracted is shown in accompanying drawing 2.Extract plasmid template to operate according to the specification sheets of extraction of plasmid DNA test kit (AxyPrepTM plasmid Miniprep Kit).
4. the sensitivity Detection of consensus primer
article 6, consensus primer obtains 9 pairs of consensus primers after combination, for:
A：SEQ ID No.3/SEQ ID No.6
B：SEQ ID No.4/SEQ ID No.7
C：SEQ ID No.5/SEQ ID No.8
D：SEQ ID No.3/SEQ ID No.7
E：SEQ ID No.4/SEQ ID No.6
F：SEQ ID No.5/SEQ ID No.7
G：SEQ ID No.3/SEQ ID No.8
H：SEQ ID No.4/SEQ ID No.8
I：SEQ ID No.5/SEQ ID No.6
Respectively sensitivity Detection is carried out to often pair of consensus primer.Carry out 10 times of gradient dilutions with deionized water after being extracted from intestinal bacteria by plasmid template containing consensus primer sequence, obtain 10 successively
7, 10
6, 10
5, 10
4, 10
3, 10
2, the dilution plasmid template solution of 10 copies/ μ L.Each extent of dilution gets 1 μ L as template, carries out PCR reaction respectively to 9 pairs of consensus primers, the sensitivity analysis of every a pair consensus primer by same analyst's repetitive operation 2 times, with avoid test randomness.
Reaction system 25 μ L comprises: the Taq polymerase 0.15 μ L of the forward consensus primer of 10 μMs and each 1 μ L, the 5U/ μ L of reverse consensus primer, the MgCl of 25mM
2the dNTP 0.5 μ L of 2 μ L, 10mM, 10xTaqBuffer 2.5 μ L, DNA profiling 1 μ L, sterilizing ddH
2o 16.85 μ L.Reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 50 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; 72 DEG C extend 10min.Detect amplified production with agarose gel electrophoresis, accompanying drawing 3-11 is respectively twice agarose gel electrophoresis figure of above-mentioned 9 pairs of consensus primers, and wherein the concentration of the plasmid template that 1-7 swimming lane is corresponding is respectively 10copies/ μ L, 10
2copies/ μ L, 10
3copies/ μ L, 10
4copies/ μ L, 10
5copies/ μ L, 10
6copies/ μ L, 10
7copies/ μ L, N are negative control, and M is 100bp DNA standard molecular weight; The left side is first time agarose gel electrophoresis figure, and the right is second time agarose gel electrophoresis figure.
The susceptibility of nine pairs of consensus primers repeats experimental result display, F with I primer pair twice detected result is consistent, and sensitivity all reaches 10copies/ul, relatively better.Twice detected result of E, A, G primer pair is also consistent, and sensitivity all reaches 10
2copies/uL.The sensitivity of C primer pair is poor, and twice experimental result is all 10
3copies/uL.D, B, H primer pair, repeating experimental result inconsistent, is all 10
2copies/uL and 10copies/uL.According to actual needs, first-selected F and I primer pair, then E, A, G primer pair, can preferentially get rid of C primer pair.Result represents, the method can distinguish the right susceptibility of multipair consensus primer, can be used for the screening of consensus primer, and has simple to operate, efficient, quick, effective, economic dispatch advantage.
SEQUENCE LISTING
<110> University Of Suzhou
<120> mono-kind screens the method for consensus primer
<160> 10
<210> 1
<211> 20
<212> DNA
<213> synthetic
<400> 1
GGGAAATCGTGCGTGACATT 20
<210> 2
<211> 20
<212> DNA
<213> synthetic
<400> 2
AGTGAGGACCCTGGATGTGA 20
<210> 3
<211> 17
<212> DNA
<213> synthetic
<400> 3
GTGCTTGTGGTTATCCT 17
<210> 4
<211>17
<212> DNA
<213> synthetic
<400> 4
AACTGCTGTGTATCTCG 17
<210> 5
<211> 17
<212> DNA
<213> synthetic
<400> 5
ATTGCCTCTATGCCTCT 17
<210> 6
<211> 16
<212> DNA
<213> synthetic
<400> 6
TGGTCGTCTCATCTCT 16
<210> 7
<211> 17
<212> DNA
<213> synthetic
<400> 7
ATGGTCGTCATCTTCTC 17
<210> 8
<211>17
<212> DNA
<213> synthetic
<400> 8
ATGCTGGTGCTTCTATC 17
<210> 9
<211> 81
<212> DNA
<213> synthetic
<400> 9
ACATGCATGCAACTGCTGTGTATCTCGGTGCTTGTGGTTATCCTATTGCCTCTATGCCTCTGGGAAATCGTGCGTGACATT 81
<210> 10
<211>78
<212> DNA
<213> synthetic
<400> 10
GCTCTAGAATGGTCGTCATCTTCTCTGGTCGTCTCATCTCTATGCTGGTGCTTCTATCAGTGAGGACCCTGGATGTGA 78
Claims (4)
1. screen a method for consensus primer, it is characterized in that, comprise the following steps:
(1) for target sequence to be amplified, 1 pair of special primer and m bar forward consensus primer and the reverse consensus primer of n bar is designed; M+n is 3 ~ 10;
(2) connect m bar forward consensus primer, restriction enzyme site sequence, protection base sequence successively at the 5' end of the right forward primer sequence of special primer, obtain the forward primer of long primer centering;
Connect the reverse consensus primer of n bar, restriction enzyme site sequence, protection base sequence successively at the 5' end of the right reverse primer sequences of special primer, obtain the reverse primer of long primer centering;
The forward primer of long primer centering and the reverse primer of long primer centering form long primer pair;
(3) with target sequence to be amplified for template, with the special primer of step (1) to carrying out first time pcr amplification, obtain the first PCR primer; Then with the first PCR primer for template, with the long primer of step (2) to carrying out second time pcr amplification, obtain the second PCR primer; Then the second PCR primer is imported plasmid vector; By transforming, this plasmid vector is proceeded to competent escherichia coli cell again; Then cultivate bacterial classification, then extract plasmid template;
(4) by permutation and combination, the m bar forward consensus primer of step (1) and the reverse consensus primer of n bar are paired into m × n to consensus primer;
(5) with the plasmid template of step (3) for template, respectively to each consensus primer of step (4) to carrying out sensitivity analysis, complete the screening of consensus primer.
2. screen the method for consensus primer according to claim 1, it is characterized in that: in step (3), first time, pcr amplification was with pcr amplification condition is the same for the second time, all adopt 25 μ l reaction systems: the forward primer of 10 μMs and each 1 μ l of reverse primer, the Taq polymerase 0.15 μ L of 5U/ μ L, the MgCl of 25mM
2the dNTP 0.5 μ L of 2 μ L, 10mM, 10xTaqBuffer 2.5 μ L, DNA profiling 1 μ L, sterilizing ddH
2o 16.85 μ L; PCR reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; Last 72 DEG C extend 10min.
3. screen the right method of consensus primer according to claim 1, it is characterized in that: in step (3), described plasmid vector is pMD19-T plasmid vector.
4. screening the right method of consensus primer according to claim 1, it is characterized in that: in step (5), each consensus primer is to carrying out 2 ~ 5 sensitivity analyses.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410556794.XA CN104293962B (en) | 2014-10-20 | 2014-10-20 | Method for screening general primers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410556794.XA CN104293962B (en) | 2014-10-20 | 2014-10-20 | Method for screening general primers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293962A true CN104293962A (en) | 2015-01-21 |
| CN104293962B CN104293962B (en) | 2017-01-11 |
Family
ID=52313908
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410556794.XA Active CN104293962B (en) | 2014-10-20 | 2014-10-20 | Method for screening general primers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293962B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105734164A (en) * | 2016-05-06 | 2016-07-06 | 苏州大学 | Multiplex PCR kit for detecting bacterial meningitis pathogens |
| CN106995841A (en) * | 2017-03-20 | 2017-08-01 | 苏州大学 | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method |
| CN107177693A (en) * | 2017-07-19 | 2017-09-19 | 中山大学 | A kind of many times of PCR amplification methods |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006031061A1 (en) * | 2004-09-18 | 2006-03-23 | Korea Research Institute Of Standards And Science | Fret gene probe selection method using pcr screening |
| CN103937891A (en) * | 2014-04-16 | 2014-07-23 | 苏州大学 | Multiplex PCR (polymerase chain reaction) kit for detecting leukemia fusion genes |
-
2014
- 2014-10-20 CN CN201410556794.XA patent/CN104293962B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006031061A1 (en) * | 2004-09-18 | 2006-03-23 | Korea Research Institute Of Standards And Science | Fret gene probe selection method using pcr screening |
| CN103937891A (en) * | 2014-04-16 | 2014-07-23 | 苏州大学 | Multiplex PCR (polymerase chain reaction) kit for detecting leukemia fusion genes |
Non-Patent Citations (1)
| Title |
|---|
| WHITCOMBE D ET AL: "detection of pcr products using selfprobing amplicons and fluorescence", 《NATURE BIOTCHNOLOGY》, vol. 17, 31 August 1999 (1999-08-31), pages 804 - 807, XP002226672, DOI: doi:10.1038/11751 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105734164A (en) * | 2016-05-06 | 2016-07-06 | 苏州大学 | Multiplex PCR kit for detecting bacterial meningitis pathogens |
| CN105734164B (en) * | 2016-05-06 | 2019-05-17 | 苏州大学 | A kind of multiple PCR reagent kit of detection bacterium meningitis pathogen |
| CN106995841A (en) * | 2017-03-20 | 2017-08-01 | 苏州大学 | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method |
| CN107177693A (en) * | 2017-07-19 | 2017-09-19 | 中山大学 | A kind of many times of PCR amplification methods |
| CN107177693B (en) * | 2017-07-19 | 2020-11-06 | 中山大学 | Multiple PCR amplification method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293962B (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6745599B2 (en) | Preparation of molecule | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| CN109666684A (en) | A kind of CRISPR/Cas12a gene editing system and its application | |
| CN102703424B (en) | A kind of method of genome of E.coli point mutation of recombined engineering mediation | |
| CN102337284A (en) | Plasmid for preparing DNA Marker, and construction method and application thereof | |
| CN102140450B (en) | Method for separating long terminal repeats of retrotransposons | |
| CN102732517B (en) | PCR (polymerase chain reaction) walking technology and kit used in same | |
| CN104293962A (en) | Method for screening general primers | |
| CN105087517B (en) | A method of recombination multienzyme complex and the seamless clone of external homologous recombination | |
| US8846343B2 (en) | High-expression promoter derived from Kluyveromyces marxianus | |
| CN104059913A (en) | Temperature-regulated promoter derived from Serratia marcecens strain having high prodigiosin yield | |
| CN102321643B (en) | Optimized DNA (Deoxyribonucleic Acid) molecule for coding ADI (Aiginine Deiminase) and engineering bacteria for expressing ADI | |
| CN104212827B (en) | It is independent of the rapid molecular cloning process of bioengineered enzyme | |
| CN103540587B (en) | Targeted integration exogenous DNA array is to the method in rat and mouse Rosa26 site and application thereof | |
| CN102321660A (en) | Method for cloning deoxyribonucleic acid (DNA) | |
| CN101709334B (en) | DNA molecular mark and application thereof of SXI inbred line mouse | |
| CN103232994A (en) | Method for screening unmarked gene knockout bacterial strain of acidithiobacillus thiooxidans | |
| CN104498516B (en) | Highly effective hydrogen yield functional gene carrier pETD-SL and its structure and application | |
| CN104857529A (en) | Application of EGR-1 (early growth response-1) gene in preparation of medicine for resisting bladder cancer | |
| CN103146785B (en) | Production process for producing antiviral medicament ribavirin through bacillus amyloliquefaciens precursor addition fermentation method | |
| CN103405784B (en) | Use of c-Fos gene in preparation of anti-cancer drugs | |
| CN101195830B (en) | Construction method for large fragment DNA clone carrier | |
| CN103740684B (en) | Lambda phage Int recombinant protein of a kind of rite-directed mutagenesis and preparation method thereof | |
| Wang et al. | Primed acquisition and microhomology-mediated end-joining cooperate to confer specific CRISPR immunity against invasive genetic elements | |
| CN108220314A (en) | DNA segment quickly connect new method and its application of conversion with carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |