CN101709334B - DNA molecular mark and application thereof of SXI inbred line mouse - Google Patents
DNA molecular mark and application thereof of SXI inbred line mouse Download PDFInfo
- Publication number
- CN101709334B CN101709334B CN2010100333463A CN201010033346A CN101709334B CN 101709334 B CN101709334 B CN 101709334B CN 2010100333463 A CN2010100333463 A CN 2010100333463A CN 201010033346 A CN201010033346 A CN 201010033346A CN 101709334 B CN101709334 B CN 101709334B
- Authority
- CN
- China
- Prior art keywords
- mouse
- dna
- sequence
- mark
- sxi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention obtains four specific SSR locus band of an SXI inbred line mouse which is domestically cultivated by the Shanxi province by sieving SSR molecular marks, a DNA sequence of the four SSR loci of the mouse is obtained by cloning, sequencing and comparing the homology, and the sequence can be used as a molecular genetics mark and is used for the identification of the SXI inbred line mouse. The invention overcomes the defects of an identifying method of the conventional shape mark, a cell mark and a biochemical mark and provides a molecular mark method for quickly and accurately identifying an experimental mouse.
Description
Technical field
The present invention relates to dna sequence dna, be specifically related to the little satellite of SX1 inbred mouse (SSR) the site dna molecular marker and the application thereof of cultivating voluntarily the Shanxi Province.
Background technology
Laboratory animal is increasingly extensive in the application in biomedical and scientific research field, and the standardization issue of laboratory animal also needs to be resolved hurrily.Understand the genetic purity and the background information of different strains or inbred lines in advance, all have very great help for choosing of experiment material and interpretation.All formulated the relevant detection standard to the quality of heredity control of inbred lines laboratory animal both at home and abroad, but detection method focuses mostly in morphology, karyomit(e) and protein level.Identify comparatively difficulty for the identical mouse morphology of hair color, and the required sample size of the evaluation of karyomit(e) and protein level is big, the inbred mouse bigger to feeding cost is difficult to popularization and application.
Summary of the invention
The objective of the invention is from the mouse genome, to clone the special SSR site of SX1 inbred mouse, and be used for the evaluation of SX1 inbred mouse.
The present invention is through a large amount of screening SSR molecule markers; Obtain the SSR site characteristic DNA band of 4 SX1 inbred mouses,, confirm D2Mit17 through relatively to its clone, order-checking and homology; D9Mit18; The characteristic dna sequence dna in D12Mit136 and four sites of DXMit186, these site dna sequence dnas can be used as the molecular genetics mark, are used for the SX1 inbred mouse and differentiate.
The SX1 inbred mouse dna molecular marker that the present invention obtains is formed (seeing sequence table) by nucleotide sequence 1, sequence 2, sequence 3 and sequence 4.
The present invention finds this mouse at 4 site D2Mit17, D9Mit18, and little satellite fragment length of D12Mit136 and DXMit186 and two international standard strain BALB/c and C57BL/6 are inconsistent at the fragment length in these sites.Through further clone, order-checking, obtain the characteristic sequence information of SX1 inbred mouse in these sites: D2Mit17 comprises 28 TG repeating units and 19 AG repeating units; D9Mit18 comprises 20 GT repeating units; D12Mit136 comprises 28 CA repeating units; DXMit186 comprises 23 CA repeating units.
With 4 SSR site primers mouse tail point genomic dna sample that increases, through 8% native polyacrylamide gel electrophoresis (PAGE) screening, cloning and sequencing if obtain 4 characteristic sequences, is the SX1 inbred mouse.
These 4 SSR site primers are following:
D2Mit17
Upstream primer AGGCAATTACAAGGCCTGG
Downstream primer CACCCATCTCCCTCAGTCAT
D9Mit18
Upstream primer TCACTGTAGCCCAGAGCAGT
Downstream primer CCTGTTGTCAACACCTGATG
D12Mit136
Upstream primer TTTAATTTTGAGTGGGTTTGGC
Downstream primer TTGCTACATGTACACTGATCTCCA
DXMit186
Upstream primer ATCAATGCATAGTATTTGGGCC
Downstream primer AATTTGTCACTGCGGGTAGG
The present invention has overcome conventional morphological markers, and the deficiency of cell marking and biochemical marker authentication method provides laboratory animal mouse molecule marking method quick, that accurately identify.
Embodiment
Embodiment 1SX1 inbred mouse SSR site dna molecular marker sequence obtains and uses
1, adopt conventional phenol-chloroform method to extract SX1 inbred mouse and two standard strain BALB/c, C57BL/6 tail point total genomic dna.Be clip mouse tail point 2-3mm, 9g/L saline water is cleaned, and shreds, and adds 360 μ l TES, 40 μ l10%SDS, and 4 μ l Proteinase K (20mg/ μ l), 4 μ l RNase (10mg/ μ l), fully behind the mixing, 55 ℃ of digestion are spent the night.Add slowly mixing 20min of the saturated phenol of equal-volume (pH7.6).10, the centrifugal 10min of 000r/min.Get supernatant in another EP pipe, add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) is extracting 20min slowly, and 10, the centrifugal 10min of 000r/min.Get supernatant in another EP pipe, add the equal-volume chloroform: primary isoamyl alcohol (24: 1) is extracting 20min slowly, and 10, the centrifugal 10min of 000r/min.Get supernatant in another EP pipe, add 2 times of volume precooling absolute ethyl alcohols-20 ℃ placement 2h.10, the centrifugal 5min of 000r/min.DNA is deposited in the pipe end, with 70% pre-cooled ethanol washing 2 times.37 ℃ of oven dry.Be dissolved in an amount of TE.
2,, obtain 19 pairs of micro-satellite primers and synthetic by the prompt basic biological ltd in the English Weihe River, Shanghai with reference to Relational database Mouse Genome Database (http//www.informatics.jax.org).
3, PCR reaction system optimization.The present invention adopts the grads PCR method that PCR reaction system and cycling program are optimized.The PCR circulating system is: behind 94 ℃ of preparatory sex change 3min, through 94 ℃ of 45s, 50-65 ℃ of 1min, 72 ℃ of 90s circulate 40 times, and last 72 ℃ are extended 10min, 10 ℃ of preservations.
4, the detection of PCR product.Behind ethidium bromide staining, gel is to resemble does further somatotype checking with 8% native polyacrylamide gel electrophoresis (PAGE).Carry out interpretation as a result according to DNA swimming distance on the polyacrylamide gel, the band that the swimming distance is the longest is set English alphabet a, is followed successively by b, c, d ...If find that SX1 is different with two standard strains at the amplified fragments in a certain SSR site.Just the pcr amplification product with this site reclaims.
5, the PCR product reclaims.According to the amplified production of 4 microsatellite locus of above method selection recovery, Application of DNA glue reclaims test kit and reclaims the PCR product.
6, the Application of DNA recombinant technology reclaims cloned dna sequence.To reclaim product and insert pGEM-T easy vector, transformed into escherichia coli is cloned, and enzyme is sent to the order-checking of Beijing AudioCodes biotech firm after cutting checking, further sequence is Blast on NCBI and analyzes.
(1) in the centrifuge tube of 0.5ml low DNA bonding force, will reclaim the DNA band according to the explanation of T carrier and be connected with the T carrier, concrete Connection Step is following: contain 5 μ l T in the 10 μ l reaction systems
4Dna ligase 2 * connect damping fluid fast, 1 μ lpGEM-T Easy vector (50ng), 3 μ l PCR products, 1 μ l T
4Dna ligase (3Weiss/ μ l).Make it mixing with pipettor piping and druming ligation liquid, 4 ℃ of incubated overnight, for use.
(2) conversion reaction and microbial culture
1) from-70 ℃ of refrigerators, take out 50 μ l competent cell DH5 α, frozen water thaws, and gently brushes lightly tube wall with the mixing cell;
2) (4,000g 30s), gets in the competent cell of ligation thing after thawing of half volume of short duration centrifugal ligation pipe, gently brushes lightly mixing, ice-water bath 30min;
3) take out centrifuge tube, in 42 ℃ of water-bath 50-90s;
4) ice-water bath 2min;
5) add 950 μ l SOC liquid nutrient mediums in the centrifuge tube;
6) 37 ℃, leniently jolting 1.5h (150 rev/mins) makes bacteria resuscitation, and plasmid-encoded resistant gene is expressed;
7) 1; 000g, normal temperature 10min is centrifugal, removes most supernatants (retaining about 150 μ l); Again the bacterium that leniently suspends is applied on the plate culture medium of anticipating and (is coated with 100 μ l 100mM IPTG and 20 μ l50 μ g/ml X-gal in advance half a hour in plate culture medium).Be inverted into after waiting to absorb in 37 ℃ of baking ovens, observe blue, white bacterium colony about 16h, can put 4 ℃ of short-terms and preserve for use;
8) learn from else's experience the sterilization test tube some, add the liquid LB substratum (containing 0.1% ammonia benzyl microbiotic) about about 4ml;
9) with the careful picking white colony of sterilization toothpick, lose in test tube;
10) 37 ℃, 250 rev/mins of shaking culture are spent the night, and are muddy to solution.
(3) the application enzyme is cut identification method and is further identified positive colony.Method and step: plasmid reclaims, and through blue hickie and the screening of ammonia benzyl, the recombinant plasmid enlarged culturing adopts the quick extracting and purifying test kit of product a small amount of plasmid of Shanghai China Shun biotechnology ltd to reclaim plasmid according to its step; The plasmid that obtains is carried out enzyme with EcoR I cut evaluation, the enzyme of 10ul is cut in the system and is contained: 1ul 10 * buffer, 5ul PCR product, 0.208ul EcoR I (12U/ul) and 3.792ul H
2O.37 ℃ of temperature are bathed 120min, get 5ul and are used for the detection of 1.5% agarose gel electrophoresis.The dna fragmentation length and the recovery of cutting according to enzyme are the corresponding to positive colonies of confirming as of dna fragmentation length.
(4) will contain the about 1.5ml of the segmental bacterium liquid of purpose is sent to Beijing AudioCodes biotech firm and checks order.The special primer sequence that when pcr amplification is found at the dna sequence dna two ends that obtain, adopts, the further verity of definite positive colony.
7, sequential analysis.To the dna sequence dna that obtains, in the Mouse Genome Resources of NCBI website, carry out the BlastN search, confirm as SX1 mouse microsatellite locus sequence.
8, the SSR site sequence is used for the evaluation of SX1 inbred mouse
(1) obtains 4 microsatellite locus primers (D2Mit17, D9Mit18, D12Mit136 and DXMit186) with reference to Relational database Mouse Genome Database (http//www.informatics.jax.org).These 4 microsatellite locus primers are following:
D2Mit17
Upstream primer AGGCAATTACAAGGCCTGG
Downstream primer CACCCATCTCCCTCAGTCAT
D9Mit18
Upstream primer TCACTGTAGCCCAGAGCAGT
Downstream primer CCTGTTGTCAACACCTGATG
D12Mit136
Upstream primer TTTAATTTTGAGTGGGTTTGGC
Downstream primer TTGCTACATGTACACTGATCTCCA
DXMit186
Upstream primer ATCAATGCATAGTATTTGGGCC
Downstream primer AATTTGTCACTGCGGGTAGG
(2) adopt conventional phenol-chloroform method to extract SX1 inbred mouse tail point total genomic dna, utilize the PCR method to obtain the PCR product in above 4 SSR sites.The PCR circulating system is: behind 94 ℃ of preparatory sex change 3min, and through 94 ℃ of 45s, 57-61 ℃ of 1min (D2Mit17, DXMit186,57 ℃; D9Mit18,61 ℃; D12Mit136,59 ℃), 72 ℃ of 90s circulate 40 times, and last 72 ℃ are extended 10min, 10 ℃ of preservations.
The PCR product is reclaimed, carry out the DNA reorganization, the clone transforms and order-checking.Be the SX1 inbred mouse if obtain following distinctive sequence fragment.D2Mit17 expanding fragment length 233bp, sequence signature (TG) 28 (AG) 19; D9Mit18 expanding fragment length 206bp, sequence signature (GT) 20; D12Mit136 expanding fragment length 194bp, sequence signature (CA) 28; DXMit186 expanding fragment length 112bp, sequence signature (CA) 23.Therefore these 4 microsatellite locus can be used as the evaluation of SX1 mouse.
SEQUENCE?LISTING
< 110>University Of Shanxi
< 120>dna molecular marker of SX1 inbred mouse and application thereof
<160>4
<210>1
<211>233
<212>DNA
< 213>SX1 inbred mouse SSR site D2Mi " 7 dna sequence dna
<400>1
aggcaattac?aaggcctggg?agatggtcta?aactttacag?tttctcggct?ggtgtggatg 60
ccctcacaaa?cattctaagt?gaatctagat?gtgtgtgtgt?gtgtgtgtgt?gtgtgtgtgt 120
gtgtgtgtgt?gtgtgtgtgt?gtgtgagaga?gagagagaga?gagagagaga?gagagagaga 180
gagggagaga?gggagagttc?aggtgatgaa?gagatgactg?agggagatgg?gtg 233
<210>2
<211>206
<212>DNA
< 213>dna sequence dna of SX1 inbred mouse SSR site D9Mit18
<400>2
tcactgtagc?ccagagcagt?catttctctt?tcaaattagg?tggcatttta?tcctttagta 60
cttatcatag?tgtgtgtgtg?tgtgtgtgtg?tgtgtgtgtg?tgtgtgtgta?tgtgtgtgtg 120
tgtgaaggtg?cacatacaag?agtgtacatt?tgcatgtgga?atctaagtgt?tgacatcagg 180
tgatgacatc?aggtgttgac?aacagg 206
<210>3
<211>194
<212>DNA
< 213>dna sequence dna of SX1 inbred mouse SSR site D12Mit136
<400>3
tttaattttg?agtgggtttg?gctcgcttta?tctatctatc?tatctatcta?tctatctatc 60
tatctatcta?tctatctatc?tatctaatct?atctatctac?acacacacac?acacacacac 120
acacacacac?acacacacac?acacacacac?acacatatat?atgttcaact?tggagatcag 180
tgtacatgta?gcaa 194
<210>4
<211>112
<212>DNA
< 213>dna sequence dna of SX1 inbred mouse SSR site DXMit186
<400>4
atcaatgcat?agtatttggg?cctacattag?tgtttccccc?aacacacaca?cacacacaca 60
cacacacaca?cacacacaca?cacacacaga?gttgatccta?cccgcagtga?ca 112
Claims (2)
1. one group of SX1 inbred mouse dna molecular marker, the nucleotide sequence that it is characterized in that described dna molecular marker is shown in nucleotide sequence 1, sequence 2, sequence 3 and sequence 4.
2. the application of SX1 inbred mouse dna molecular marker as claimed in claim 1 in identifying the SX1 inbred mouse.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100333463A CN101709334B (en) | 2010-01-05 | 2010-01-05 | DNA molecular mark and application thereof of SXI inbred line mouse |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100333463A CN101709334B (en) | 2010-01-05 | 2010-01-05 | DNA molecular mark and application thereof of SXI inbred line mouse |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101709334A CN101709334A (en) | 2010-05-19 |
| CN101709334B true CN101709334B (en) | 2012-01-11 |
Family
ID=42402140
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010100333463A Expired - Fee Related CN101709334B (en) | 2010-01-05 | 2010-01-05 | DNA molecular mark and application thereof of SXI inbred line mouse |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101709334B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109706247B (en) * | 2017-10-25 | 2022-04-19 | 上海斯莱克实验动物有限责任公司 | Method for monitoring genetic quality of inbred mouse by using microsatellite technology |
| CN111718999B (en) * | 2020-06-03 | 2022-11-22 | 广州赛库生物技术有限公司 | Multiple amplification system and detection kit for mouse short tandem repeat sequence |
-
2010
- 2010-01-05 CN CN2010100333463A patent/CN101709334B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101709334A (en) | 2010-05-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102912012B (en) | Marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer and design and amplification method thereof | |
| CN102757960B (en) | Semi-random polymerase chain reaction (PCR) technique for amplifying unknown sequence and primer and kit used for technique | |
| CN102732517B (en) | PCR (polymerase chain reaction) walking technology and kit used in same | |
| CN102140450B (en) | Method for separating long terminal repeats of retrotransposons | |
| Santosa | Rapid extraction and purification of environmental DNA for molecular cloning applications and molecular diversity studies | |
| CN110734994A (en) | Specific primer pair, probe and detection kit for detecting aeromonas hydrophila | |
| CN104480202A (en) | Towel gourd reference gene and application thereof | |
| CN107151690A (en) | A kind of molecular labeling for detecting pig up to 100kg body weight ages in days and its application | |
| CN102876677A (en) | Double-stranded RNA (ribonucleic acid) preparation method | |
| CN101709334B (en) | DNA molecular mark and application thereof of SXI inbred line mouse | |
| CN103397028B (en) | Semi-random primer based on PCR walking technology, and kit thereof | |
| CN117210437A (en) | Enzyme identification of two gene editing tools and application of enzyme identification in nucleic acid detection | |
| CN103966244A (en) | DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase | |
| CN101550449B (en) | Method for analyzing diversity of biological enzyme genes in compost | |
| CN103397029B (en) | PCR walking method, and primer and kit thereof | |
| CN104293962A (en) | Method for screening general primers | |
| CN104073562B (en) | A kind of molecular marker for cutter long-tailed anchovy different ecological type population identification | |
| CN103074335B (en) | Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method | |
| CN103074336B (en) | Goby mitochondrion ND1 gene complete sequence amplimer, design and amplification method | |
| KR101811737B1 (en) | Method for Screening Useful Gene Products via Metagenomics-based Mega-throughput Screening System and Uses Thereof | |
| CN101724703B (en) | Oxya specific molecular marker DNA sequence and application thereof | |
| CN103993006A (en) | Cloning method and real time PCR (polymerase chain reaction) method of jian carp house-keeping gene 18sRNA (soluble ribonucleic acid) gene partial sequences | |
| Afzal et al. | Phylogenetic analysis of methanogenic archaea by mcrA gene in anaerobic digester. | |
| CN108048457B (en) | Nested amplification primer for mitochondrial control region of Baijixi myna and amplification, cloning and sequencing methods | |
| Goudarzi et al. | Genetic diversity of gastrointestinal tract fungi in buffalo by molecular methods on the basis of polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120111 Termination date: 20150105 |
|
| EXPY | Termination of patent right or utility model |