CN103966244A - DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase - Google Patents
DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase Download PDFInfo
- Publication number
- CN103966244A CN103966244A CN201310044362.6A CN201310044362A CN103966244A CN 103966244 A CN103966244 A CN 103966244A CN 201310044362 A CN201310044362 A CN 201310044362A CN 103966244 A CN103966244 A CN 103966244A
- Authority
- CN
- China
- Prior art keywords
- dna polymerase
- archaeal dna
- application
- dna
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of gene engineering, and relates to a DNA polymerase gene separated from Hyperthermophilic Archaeon, a plasmid thereof, a DNA polymerase coded thereby, a preparation method of the DNA polymerase, and an application of the DNA polymerase, and concretely relates to DNA polymerase coding DNA separated from Pyrococcus yayanosii, and an application and a preparation method thereof. The sequence of the DNA polymerase coding DNA is one of a nucleotide sequence represented by SEQ ID NO.1in a sequence table, and a nucleotide sequence obtained by deleting, inserting and substituting one or more nucleotides into the sequence represented by SEQ ID NO.1. The encoded DNA polymerase has the advantages of super strong high-temperature resistance, high fidelity performance, excellent anti-inhibitor ability, and realization of a direct PCR reaction by using crude samples.
Description
Technical field
The invention belongs to genetically engineered field, relate to the DNA of coding DNA polysaccharase and the archaeal dna polymerase of coding, application and preparation method separated from super hyperthermophilic archaeon strain, relate to more specifically the DNA of coding DNA polysaccharase and the archaeal dna polymerase of coding, application and the preparation method that from Pyrococcusyayanosii separation, obtain.
Background technology
Along with molecular biological development, polymerase chain reaction (Polymerase Chain Reaction is called for short PCR) is applied to the fields such as gene clone, genetic diseases and pathogenic micro-organism diagnosis, individual somatotype and criminal investigation, archaeology more and more widely.Different application has different demands to PCR, as gene clone need guarantee verily to increase, obtain sensitivity, criminal investigation and genetic diseases that goal gene, molecular diagnosis need guarantee amplification and detect and need again amplification can tolerate certain inhibitor, guarantee that the template in all kinds of sources can increase smoothly.PCR reaction is at present mainly to use heat-resisting archaeal dna polymerase, as the separated Taq archaeal dna polymerase (U.S. Patent number: 4 obtaining from heat resistant microbe Thermusaquaticus YT1,889,818), its amplification efficiency is high, and useful primer probe carrys out testing goal fragment, be the conventional archaeal dna polymerase of current all kinds of detection kit, but its amplification fidelity is poor, easily occurs non-specific amplification and sudden change, simultaneously responsive to various inhibitor, as impure in template easily causing increases unsuccessfully.Another Pfu archaeal dna polymerase, its amplification mutation rate greatly reduces and specificity is greatly improved, but this enzyme efficiency is low, amplified production is few, the extension time long (1kb/2min), has limited its application (U.S. Patent number: 5 in a lot of fields, 545,552).
Blood is one of conventional biological specimen, be mainly used in genetic diseases, pathogenic micro-organism diagnosis and blood grouping, protoheme wherein, oxyphorase, IgG, lactoferrin etc. have extremely strong restraining effect to archaeal dna polymerase, whole blood as 0.2% just can suppress the amplification of Taq archaeal dna polymerase completely, adds BSA, T4gp32 albumen etc. and also only can in 2% whole blood, increase.By mutation T aq archaeal dna polymerase, can improve its counter inhibitor ability, and the specific DNA fragments that can increase in 20% whole blood system (PCT patent, WO2005/113829).Plant tissue contains the materials such as a large amount of polysaccharide, polyphenol, can suppress general dna polymerase activity, each proteinoid and secondary metabolite in animal tissues also have extremely strong restraining effect to DNA polymerase activity, and the nucleic acid in animal vegetable tissue is difficult to discharge.In order to remove the inhibitor in different sources template, at present mostly by loaded down with trivial details step purification of nucleic acid such as cracking tissue, organic solvent extracting, precipitate nucleic acids, with an organic solvent there is certain toxic action, and waste time and energy and the too many easy crossed contamination of sample room, therefore use the direct nucleic acid amplification of rough sample to have great advantage.The Direct PCR test kit based on Taq archaeal dna polymerase using on the market, can not tolerate high denaturation temperature, cannot effectively discharge nucleic acid, and can not increase well for high GC template; Another kind is lacked high-fidelity enzyme 3 '-5 ' 5 prime excision enzyme activity or is mixed by different ratios with Taq archaeal dna polymerase by sudden change, can in whole blood, increase, owing to having lost proofreading activity, amplification error rate improves greatly, to animal vegetable tissue also cannot increase well (PCT patent, WO2009/140497).
Summary of the invention
In view of this, the object of the invention is to for the deficiencies in the prior art, provide a kind of from super hyperthermophilic archaeon strain the DNA of isolated coding DNA polysaccharase, its protein of encoding out is that archaeal dna polymerase has superpower thermostability (99 ℃ of transformation period are 3h), in PCR reaction, there is higher fidelity ability, higher amplification efficiency, and there are anti-various inhibitor abilities, can utilize the directly amplification object fragment such as whole blood, hemocyte, the dry bloodstain of trace, animal vegetable tissue, its counter inhibitor ability can be received into the amplification of 25% whole blood.
For realizing object of the present invention, the present invention adopts following technical scheme:
The DNA of isolated coding DNA polysaccharase from super hyperthermophilic archaeon strain, it has one of following sequence:
(i) there is the nucleotide sequence described in SEQ ID NO.1 in sequence table;
(ii) in the nucleotide sequence (i) limiting, lack, insert, replace one or more Nucleotide.
The present invention also provides a kind of archaeal dna polymerase, and it has following aminoacid sequence:
(i) there is the aminoacid sequence shown in SEQ ID NO.2 in sequence table;
(ii) in the aminoacid sequence (i) limiting, lack, insert, replace one or more amino acid.
The 3rd object of the present invention is to provide the expression vector of a kind of DNA that comprises aforementioned coding DNA polysaccharase.
The 4th object of the present invention is to provide a kind of method of preparing aforementioned archaeal dna polymerase, comprises the expression vector transformed host cell with the DNA that comprises aforementioned coding DNA polysaccharase, cultivates transformant, obtains archaeal dna polymerase.Concrete steps are as follows:
(1) analyzing gene structure, amplification mature protein coding sequence, obtains the gene fragment as described in SEQID NO.1 by overlapping PCR, builds up to the expression vector containing promotor;
(2) expression vector is converted into Host Strains, obtains producing the reconstitution cell of the archaeal dna polymerase that is applicable to PCR reaction;
(3) this reconstitution cell of enlarged culturing, after induction for the preparation of this archaeal dna polymerase;
(4) utilize gel media, for example nickel and heparin chromatography column this archaeal dna polymerase of purifying successively.
The 5th object of the present invention is to provide the application of a kind of aforesaid archaeal dna polymerase in nucleic acid amplification.
Further, the present invention preferably adopts described archaeal dna polymerase to directly apply to unpurified sample system.The archaeal dna polymerase that DNA encoding of the present invention goes out can directly apply in unpurified sample system, comprises blood, bloodstain, hemocyte, animal vegetable tissue, and animal and plant cells, microorganism etc. go out the sample of nucleic acid without purification.
The 7th object of the present invention is to provide a kind of pcr amplification test kit, and it includes aforesaid archaeal dna polymerase.
Super hyperthermophilic archaeon strain of the present invention refers to Pyrococcus yayanosii, this Gu bacterium is purchased from Japanese microbial strains preservation center (deposit number: JCM:16557), the hydrothermal solution mouth of its separation one from Mid-Atlantic Ridge 4100m depths " Ashadze " by name, grow in 80-108 ℃, optimum growth temperature is 98 ℃, has superpower thermophilic growth characteristics (Jean-Louis Birrien etc., IJSEM, 2011,61(12): 2827-2881).Accompanying drawing explanation
Fig. 1 shows archaeal dna polymerase Pya purified product SDS-PAGE detected result of the present invention.Swimming lane 1 is Unstained Protein Molecular Weight Marker (Thermo), the archaeal dna polymerase Pya of swimming lane 2 for obtaining after dialysing.
Fig. 2 shows archaeal dna polymerase Pya thermostability of the present invention.
Fig. 3 shows the application of archaeal dna polymerase Pya amplification different templates of the present invention.Swimming lane 1 is human genome 1.5kb fragment, and 2 is the 2kb fragment that Thermus thermophilus HB8GC content is 71%, and 3 is intestinal bacteria 16srDNA fragment, and 4 is people β-Actin0.7kb fragment, and M is Trans2k plus II DNAmarker.
Fig. 4 shows the different archaeal dna polymerase whole blood of the present invention pcr amplification result.Swimming lane 1,2 is SNOVamp
tM5 * PCR Premix(Snova), 3,4 is 10 * Pya buffer, 5,6 is 5 * Pya direct PCR buffer, and 7,8 is that Taq archaeal dna polymerase (day root), 9,10 is Pfu archaeal dna polymerase (day root), and M is Trans2k plus II DNA marker.
Fig. 5 shows the result of archaeal dna polymerase Pya amplification different concns whole blood of the present invention.Swimming lane 1,2 is 10%, 15% people's whole blood, and 3～8 is 25%, 20%, 15%, 10%, 5%, 2.5% rabbit whole blood, and M is Trans2k plus II DNA marker.
Fig. 6 shows the result of archaeal dna polymerase Pya amplification different sources crude samples of the present invention.Swimming lane 1 is dry bloodstain, and 2 is hemocyte, and 3 is whole blood, and M is Trans2k plus II DNA marker.
Fig. 7 shows the application of archaeal dna polymerase Pya of the present invention in whole blood pcr amplification different fragments.Swimming lane 1 is β-Actin fragment, and 2 is high GC fragment, and 3 is GAPD fragment; 4～6 is genome amplification, and M is 100bp DNA Ladder.
Fig. 8 shows the application of archaeal dna polymerase Pya of the present invention in different animal vegetable tissues directly increase.Swimming lane 1,2 is rape and the cabbage leaf about 70bp fragment of 18srDNA that directly increases, and 3,4 be about 100bp plastosome fragment, and 5 be the direct about 300bp fragment that increases of mousetail.
Embodiment
In order to make those skilled in the art understand better technical scheme of the present invention, below in conjunction with specific embodiment, the present invention is described in further detail.
The cloning and expression of embodiment 1.Pyrococcus yayanosii DNA polymerase gene
Bacterial classification is bought in Japanese microbial strains preservation center (deposit number: JCM16557), the bacterial classification of buying, with the centrifugal 5min of 12000rpm, is abandoned to supernatant; Cell precipitation reference
genomic DNAPurification kit (Promega company) extracts genomic dna, and concise and to the point step is as follows: cell precipitation is with 600 μ L Nuclei Lysis Solution(karyorhexis liquid) resuspended, 80 ℃ of water-bath 5min lysing cell; Be cooled to after room temperature, add 200 μ L Protein Preciptitation Solution(albumen precipitation liquid), concussion mixes, ice bath 5min; The centrifugal 5min of 12000rpm; Draw supernatant to another clean centrifuge tube, add 600 μ L Virahols, mix rear ice bath 10min; The centrifugal 5min of 12000rpm; Nucleic acid precipitation, with 700 μ L70% washing with alcohol twice, after the centrifugal 5min of 12000rpm, is abandoned supernatant, and 10min is to alcohol-free taste for drying at room temperature nucleic acid precipitation, adds 50 μ L elution buffers to dissolve.
According to Pyrococcus yayanosii whole genome sequence, analyze and to obtain its DNA polymerase gene, its complete sequence comprises 3942bp, coding 1313aa, by with other species in archaeal dna polymerase compare, obtain its maturation protein and encoded by two segment DNAs, altogether 776aa.Design by raw work biotechnology (Shanghai) limited-liability company synthetic primer: BamH I PyaWF:cgc
gGATCCatgattctggatgctgacta, Pya493R:cataatagctgttggccaggattttgatggcgcgctg, Pya3085F:caaaatcctggccaacagctattatggctattatggttatgcg, PyaWR:tcc
gTCGACggcattctggaagtgctggag.Underscore part GGATCC represents BamH I restriction enzyme site, and GTCGAC represents Sal I restriction enzyme site.First the upstream and downstream that increases coding region fragment, with primer BamH I PyaWF and the Pya493R about 1.5kb fragment that increases; With primer Pya3085F and the PyaWR about 0.9kb fragment that increases, by following system preparation PCR reaction solution, in 50 μ L systems, comprise: genomic dna 50ng, each 400nM of primer, dNTPs200 μ M, 5 *
buffer(Mg
2+plus) 10 μ L,
hS0.5 μL(Bao biotech firm).Pcr amplification program is: 98 ℃ of 2min, (94 ℃ of 10s; 55 ℃ of 20s; 68 ℃ of 1.5min or 1min) 25cycles, 68 ℃ are extended 5min.PCR product electrophoresis also reclaims object band, adds same amount upstream and downstream fragment, with gene two ends primer BamH I PyaWF and PyaWR, carries out overlapping PCR, and splicing obtains full length coding region.The about 2.5kb fragment of total length that recovery obtains, cuts with BamH I and Sal I enzyme, be connected to that same enzyme cuts containing in T7 promoter vector, be converted in DH5 α competent cell.
By bacterium liquid PCR and enzyme, cut evaluation, after the positive plasmid sequence verification obtaining, be converted into and express in bacterium Rosetta (DE3) cell.Picking list bacterium colony is cultured to OD
600=0.4, add 0.1mM IPTG induction 4h, collect thalline ultrasonic disruption, the expression of SDS-PAGE electrophoresis detection target protein.
The purifying of embodiment 2.DNA polysaccharase Pya
The bacterial classification of energy correction archaeal dna polymerase Pya is seeded to 500mL containing in the Erlenmeyer flask of 200mL LB substratum by 1:100, the kantlex and the 34mg/L paraxin that add final concentration 30mg/L, 37 ℃ of 200rpm shaking culture are to OD600=0.4, adding final concentration is the IPTG induction target protein expression of 0.1mM, in 30 ℃ of induction 4h; Collect bacterium liquid after induction, the centrifugal 2min of 12000rpm, abandons supernatant, 20mL buffer A(20mM Tris-HCl (pH7.8) for cell, 0.1M KCl, 50mM NaCl) to add 30mM imidazoles resuspended, frozen 12h in-80 ℃ of refrigerators; 37 ℃ of dissolved cells, process 30min, the centrifugal 10min of 12000rpm in 70 ℃ of water-baths after ultrasonic disruption; Supernatant is crossed nickel affinity media (IDA, National Engineering Research Center for Biotechnology), with the buffer A wash-out containing 400mM imidazoles; Elutriant is crossed heparin affinity media (National Engineering Research Center for Biotechnology), with the buffer A wash-out containing 200mM, 400mM, 600mM, 1M NaCl; Collect each protein peak and detect through SDS-PAGE, containing the bufferA energy wash-out part target protein of 200mM NaCl, containing a large amount of wash-out target proteins of buffer A of 400mM, purity reaches more than 95% (Fig. 1).The product obtaining is dialysed to Storage buffer:20mM Tris HCl (pH7.4), 0.1mM EDTA, 0.1%Tween20,0.5%Nonidet P40,0.1M KCl, 50% glycerine.
The application of embodiment 3.DNA polysaccharase Pya in nucleic acid amplification
The Nucleotide amount that the enzyme obtaining in embodiment 2 mixes with 72 ℃ of 30min is determined active, dilutes the L for 2.5u/ μ, with fluorescent probe method, tests its 3 '-5 ' 5 prime excision enzyme activity, and result Pya has stronger proofreading activity, and its amplification fidelity better performances is described.For the thermostability of test dna polysaccharase Pya, enzyme to be hatched in 99 ℃, the enzyme of get 0,1,2,3,4h processing is surveyed DNA polymerase activity, and result archaeal dna polymerase Pya has high thermostability, its 99 ℃ of transformation period are 3h(Fig. 2).
Test dna polymeric enzyme reaction condition, take pUC19 plasmid as template, and the design primer PCR about 2.7kb fragment that increases is determined optimal pH and the K of its reaction
+, NH4
+, Mg
2+ionic concn.Preparation 10 * buffer B:500mM Tris-HCl (pH7.4～8.8), 15mM MgCl
2, add respectively different concns KCl, (NH
4)
2sO
4, MgCl
2reaction system is that 20 μ L contain: 10 * buffer B (pH7.4～8.8), 2 μ L, dNTPs (2.5mM) 1.6 μ L, each 0.5 μ L of primer PAs and PAa (10 μ M), Pya0.2 μ L, pUC19 (15ng/ μ L) 0.5 μ L, by 98 ℃ of 2min, (98 ℃ of 10s, 60 ℃ of 20s, 68 ℃ of 2min40s) 25cycles, last 68 ℃ are extended 5min, and electrophoresis detection is determined the suitableeest buffer.The optimal reaction buffer of result archaeal dna polymerase Pya is: 10 * Pya buffer:500mM Tris-HCl (pH8.4), 150mMKCl, 5mM (NH
4)
2sO
4, 20mM MgCl
2.With 10 * Pya buffer and Pya increase the respectively high GC fragment of the about 2kb of Thermusthermophilus HB8 (approximately 72%), the about 0.7kb β-Actin of human gene group DNA, with 1.5kb fragment, Escherichia coli bacteria liquid be the about 1.5kb fragment of template amplification 16srDNA, result all can increase well and obtain object fragment (Fig. 3).
Directly the increase application of rough sample of embodiment 4.DNA polysaccharase Pya
The people's whole blood of BD vacutainer vacuum test tube collection of take is template, test Pya is for whole blood Direct PCR expanding effect, to the BSA and the Betaine that add different concns in system, result BSA optimal final concentration is 0.01%, Betaine final concentration is 0.35M, according to test result preparation 5 * Pya directPCR buffer:250mM Tris-HCl (pH8.4), 75mM KCl, 2.5mM (NH
4)
2sO
4, 10mMMgCl
2, 0.05%BSA, 1.75M Betaine; Use respectively SNOVamp
tM5 * PCR Premix(Snova), Taq archaeal dna polymerase (day root), Pfu archaeal dna polymerase (day root) and the about 100bp fragment of Pya archaeal dna polymerase (10 * Pya buffer and 5 * Pya direct PCR buffer) amplification people's whole blood, whole blood final concentration is 2.5% and 5%.Result is except Pya, and other enzymes all can not increase, 10 * Pyabuffer, 2.5% whole blood that can increase well, and 5% whole blood expanding effect is poor, uses 5 * Pya direct PCRbuffer all can increase well and obtains object band (Fig. 4).
The rabbit whole blood gathering of take is template, adding respectively final concentration is 2.5%, 5%, 10%, 15%, 20%, 25% whole blood, or final concentration is 10%, 15% people's whole blood, use 5 * Pya direct PCR buffer about 100bp fragment that increases, result all can increase and obtain object band, illustrates that archaeal dna polymerase Pya can tolerate approximately 25% whole blood (Fig. 5).
Respectively with 5% hemocyte (after whole blood is centrifugal, with same volume, TE is resuspended), the dry bloodstain on filter paper (is cut to 1mm fragment, directly add PCR system) and the about 750bp fragment of 5% whole blood amplification people β-Actin, result all can obtain object band, and archaeal dna polymerase Pya has the ability (Fig. 6) of amplification trace blood sample.
The 5% people's whole blood of take is template, amplification β-Actin about 100bp fragment, and the high GC fragment of about 100bp (GC content 70%) and the about 100bp fragment of GAPD, equal can the amplification of result Pya obtains object band, to template complex also can increase well (Fig. 7).
With 10 μ L rifle head stamps, get fritter rape, cabbage leaf, directly add to PCR system, about 70bp18srDNA and 100bp mitochondria DNA fragment increase; Stamp is got fritter mousetail tissue, adds to the directly about 300bp fragment of amplification of reaction system, and result different sources is organized all can increase well and obtained object fragment (Fig. 8).
Below be only the preferred embodiment of the present invention, it should be pointed out that above-mentioned preferred implementation should not be considered as limitation of the present invention, protection scope of the present invention should be as the criterion with claim limited range.For those skilled in the art, without departing from the spirit and scope of the present invention, can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (8)
1. a DNA for coding DNA polysaccharase, is characterized in that: it has one of following sequence:
(i) there is the nucleotide sequence shown in SEQ ID NO.1 in sequence table;
(ii) in the nucleotide sequence (i) limiting, lack, insert, replace one or more Nucleotide.
2. an archaeal dna polymerase, is characterized in that: it has following aminoacid sequence:
(i) there is the aminoacid sequence shown in SEQ ID NO.2 in sequence table;
(ii) in the aminoacid sequence (i) limiting, lack, insert, replace one or more amino acid.
3. the expression vector that comprises DNA claimed in claim 1.
4. the method for preparation archaeal dna polymerase claimed in claim 2, is characterized in that: comprise with expression vector transformed host cell claimed in claim 3, cultivate transformant, obtain archaeal dna polymerase.
5. the application of archaeal dna polymerase claimed in claim 2 in nucleic acid amplification.
6. the application of archaeal dna polymerase according to claim 5 in nucleic acid amplification, is characterized in that: described archaeal dna polymerase directly applies to unpurified sample system.
7. the application of archaeal dna polymerase according to claim 6 in nucleic acid amplification, is characterized in that: described unpurified sample system is any one in blood, bloodstain, hemocyte, animal tissues, zooblast, plant tissue, vegetable cell.
8. a pcr amplification test kit, is characterized in that including archaeal dna polymerase claimed in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310044362.6A CN103966244A (en) | 2013-02-04 | 2013-02-04 | DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310044362.6A CN103966244A (en) | 2013-02-04 | 2013-02-04 | DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103966244A true CN103966244A (en) | 2014-08-06 |
Family
ID=51236248
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310044362.6A Pending CN103966244A (en) | 2013-02-04 | 2013-02-04 | DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966244A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011100A (en) * | 2016-08-08 | 2016-10-12 | 吴江近岸蛋白质科技有限公司 | Pfu DNA polymerase and preparation method thereof |
| CN106868180A (en) * | 2017-03-30 | 2017-06-20 | 浙江中迪生物科技有限公司 | The method that the direct amplification of nucleic acid of whole blood detects folic acid metabolism related gene polymorphism |
| CN107058530A (en) * | 2017-03-30 | 2017-08-18 | 浙江中迪生物科技有限公司 | The kit and its application method of folic acid medication sensitive gene are directly detected for blood |
| CN113151213A (en) * | 2021-04-30 | 2021-07-23 | 上海交通大学 | High-fidelity DNA polymerase, preparation method and PCR application thereof |
-
2013
- 2013-02-04 CN CN201310044362.6A patent/CN103966244A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| JEAN-LOUIS BIRRIEN等: "Pyrococcus yayanosii sp.nov.,an obligate piezophilic hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent", 《INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY》 * |
| QUERELLOU,J.等: "登录号：CAB81809.1", 《GENBANK》 * |
| SOUTHWORTH,M.W.等: "登录号：U47108.1", 《GENBANK》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011100A (en) * | 2016-08-08 | 2016-10-12 | 吴江近岸蛋白质科技有限公司 | Pfu DNA polymerase and preparation method thereof |
| CN106868180A (en) * | 2017-03-30 | 2017-06-20 | 浙江中迪生物科技有限公司 | The method that the direct amplification of nucleic acid of whole blood detects folic acid metabolism related gene polymorphism |
| CN107058530A (en) * | 2017-03-30 | 2017-08-18 | 浙江中迪生物科技有限公司 | The kit and its application method of folic acid medication sensitive gene are directly detected for blood |
| CN113151213A (en) * | 2021-04-30 | 2021-07-23 | 上海交通大学 | High-fidelity DNA polymerase, preparation method and PCR application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543193A (en) | N-acyle homoserine lactonase and encoding gene and recombinant bacteria thereof | |
| CN110055273B (en) | Application of GhMAH1 protein and coding gene thereof in regulating and controlling cotton fiber length | |
| CN104250641B (en) | A kind of high-fidelity DNA polymerase and its preparation and application | |
| CN102732517B (en) | PCR (polymerase chain reaction) walking technology and kit used in same | |
| CN111893202A (en) | Method for rapidly identifying medlar based on DNA bar code | |
| CN103966244A (en) | DNA polymerase coding DNA, enzyme coded thereby, and application and preparation method of DNA polymerase | |
| CN103898131A (en) | DNA of coded DNA polymerase separated from thermophilic bacteria | |
| CN109609524A (en) | Protein and the application of a kind of lactobacillus plantarum nitrite reductase gene and its coding | |
| CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
| CN109593743A (en) | Novel C RISPR/ScCas12a albumen and preparation method thereof | |
| CN109486779B (en) | DNA methyltransferase and soluble heterologous expression and separation and purification method thereof | |
| CN104878036B (en) | A kind of models fitting and genetic modification improve method and the application of protein expression efficiency | |
| CN106367407A (en) | Preparation method and application of phi29 DNA polymerase | |
| WO2023028348A1 (en) | Enzymes with ruvc domains | |
| CN102392000A (en) | High-temperature-resistant Pyrolobus polymerase and efficient expression plasmid and application thereof | |
| CN104894150B (en) | Saussurea involucrate cell phenylalanine ammonia lyase gene SiPAL and encoding product and application thereof | |
| CN114230644A (en) | GP32 protein mutant, recombinant vector, and construction method and application thereof | |
| KR20140128555A (en) | Primers for amplifying Microcystis sp Gene, and detection method of Microcystis sp using the same | |
| CN101709334B (en) | DNA molecular mark and application thereof of SXI inbred line mouse | |
| CN102965367B (en) | Method for acquiring plant candidate anti-disease gene sequence | |
| US10351857B2 (en) | Marine bacterial gene LfliZ and use | |
| KR101811737B1 (en) | Method for Screening Useful Gene Products via Metagenomics-based Mega-throughput Screening System and Uses Thereof | |
| Sharrnlla et al. | Cloning and Sequencing of Phytoplasma Ribosomal DNA (rONA) Associated with Kerala Wilt Disease of Coconut Palms | |
| AU2021100409A4 (en) | Recombinant low-temperature catalase, recombinant vector and engineered strain thereof | |
| CN117683755B (en) | C-to-G base editing system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140806 |