CN109593743A - Novel C RISPR/ScCas12a albumen and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of novel C RISPR/ScCas12a albumen and preparation methods.The research of the invention finds that a kind of novel ScCas12a albumen with DNA cleavage activity, novel C RISPR/ScCas12a system be can be used as applied to detection of nucleic acids, gene editing, gene modification, provide a kind of new essential tool selection for gene editing, modification and Molecular Detection based on Cas12a.Nucleic acid detection system based on ScCas12a albumen can in 25 DEG C -37 DEG C of realization at room temperature highly sensitive, high-precision Molecular Detection, detect specific good, high sensitivity, it is low in cost、It is easy to operate、Fast, have a wide range of application, had a good application prospect in terms of detection of nucleic acids.

Description

Novel C RISPR/ScCas12a albumen and preparation method thereof

Technical field

The invention belongs to technical field of molecular biology.More particularly, to a kind of novel C RISPR/ScCas12a albumen And preparation method thereof.

Background technique

The regular short palindrome in cluster interval repeats system (clustered regularly interspaced short palindromic repeat；CRISPR-associated, CRISPR-Cas) be archaeal and bacterium resistance virus and plasmid The important immune defense system infected, for resisting the invasion of exogenous genetic material, such as phage virus and exogenous plasmid. CRISPR/Cas system can identify exogenous DNA or RNA, and they are cut off, the expression of silencing foreign gene.Just because of This accurate target function, CRISPR/Cas system are developed to a kind of efficient gene editing tool, can to gene into The accurate edits of row fixed point.Currently, Cas9 and Cpf1 albumen is widely used as genome edit tool, traditional base is overcome Because editing technique complex steps, time-consuming, low efficiency the disadvantages of, with its less ingredient, easily operation and higher effect Rate meets the gene editing demand in most of fields, and has potential and huge clinical value.In nature, CRISPR/Cas system possesses plurality of classes, and wherein CRISPR/Cas9 system is to study most deep, the most mature type of application Not.CRISPR-Cas9 is a kind of complex with endonuclease activity, identifies specific DNA sequence dna, carries out specific site Cutting causes double-strand DNA cleavage (Double-strandbreaks, DSB), under conditions of no template, occurs non-homogeneous heavy Group end connects (Non-homologous end joining, NHEJ), causes frameshift mutation (frameshift Mutation), lead to gene knockout.CRISPR/Cas9 is after " zinc finger endonuclease (ZFN) ", " class activating transcription factor effect Answer object nuclease (TALEN) " after occur the third generation " genome fixed point editing technique ".By feat of low in cost, operation side Just, the advantages that high-efficient, the worldwide laboratory rapidly CRISPR/Cas9 become the strong helper of biological scientific research.Cas9 Targeting cutting DNA is by two kinds of tiny RNAs -- gRNA (CRISPR RNA) and tragRNA (trans-activating gRNA) It is realized with the principle of target sequence complementation identification, two kinds of tiny RNAs is fused into a RNA chain, abbreviation gRNA now (guide RNA).Respectively design a guide RNA (guide RNA1, guide RNA2) in the upstream and downstream of gene, by its with contain Cas9 The plasmid of protein coding gene is transferred in cell together, and guide RNA can target the target near PAM by base pair complementarity Sequence, Cas9 albumen can be such that the DNA double chain of the gene upstream and downstream is broken.And organism itself answering there is DNA damage reparation Mechanism is answered, the sequence for being broken upstream and downstream both ends can be connected, to realize the knockout of target gene in cell.If The template plasmid (donor DNA molecule) of a reparation is introduced on the basis of this for cell, this like cell will be according to the template of offer Segment insertion or rite-directed mutagenesis are introduced in repair process.Gene editing is carried out to fertilized egg cell, and is conducted into replace-conceive mother In body, the building of gene editing animal model may be implemented.With going deep into for research, CRISPR/Cas technology is extensive Using.In addition to gene knockout, the basis such as gene replacement edit mode, it may be utilized for gene activation, and disease model constructs, Even gene therapy.

In conclusion CRISPR/Cas is at guide RNA (guide RNA, gRNA) and the participation of Cas9 albumen, it is to be edited Cell genomic dna will be counted as virus or exogenous DNA, accurately sheared.But the application of CRISPR/Cas9 also has one A little restrictive conditions.Firstly, the PAM sequence (NGG) that areas adjacent to be edited needs to have relatively conservative.Secondly, guide RNA is wanted With the series complementary pairing of the upstream PAM.Furthermore can gRNA accomplish that specificity, accurate targeting target gene are CRISPR- Cas9 can specific knockdown target gene prerequisite, either miss the target or mistake targeting, can all influence CRISPR- Specific knockdown of the Cas9 to target gene；Therefore it can design, prepare accuracy and selectively targeted target gene The key technology of gRNA and CRISPR-Cas9 gene knockout.

2015, a kind of completely new the second class CRISPR-Cas system-V-type system was found, the effect egg in the system It is white to be named as Cpf1/Cas12a.Entitled " the Cpf1is a that Zhang Feng team delivers on November 22nd, 2015 at " Cell " The article of single RNA-guided endonuclease ofa Class 2CRISPR-Cas system ".The system is basic Workflow it is similar with CRISPR/Cas9, or invader is hit by " blacklist " system of CRISPR sequence. But the mode that gRNA is formed is different from CRISPR/Cas9 system: Cpf1/Cas12a albumen can be compound with immature gRNA, And gRNA is processed, gRNA can then hybridize with the complementary region near PAM.Finally, external source double-stranded DNA (double Strand DNA, dsDNA) it can be sheared, gene expression can be also silenced.However, while cutting target dsDNA, activation Cpf1/Cas12a can also degrade target dsDNA neighbouring single stranded DNA (single strand DNA, ssDNA), referred to as " attached cutting ", this activity are the key features of detection of nucleic acids platform newly developed.On April 27th, 2018, Doudna team Two entitled " Two distinct RNase activities of have been delivered at " Science " simultaneously with Zhang Feng team CRISPR-C2c2enable guide-RNA processing and RNA detection " and " Multiplexed and The paper of portable nucleic acid detection platform with Cas13, Cas12a, and Csm6 ".Table While cutting target dsDNA, can also degrade bright Cpf1/Cas12a target dsDNA neighbouring ssDNA.The two independent experiments The V-type CRISPR system of targeting dsDNA has been transformed in room respectively, has become quick, cheap and super-sensitive diagnostic tool. This discovery is expected to bring the influence for the property changed for scientific research and global public health.Utilize this new CRISPR skill Art: CRISPR-Cpf1/Cas12a, highly sensitive can detect includes that zika virus infects, including dengue virus infection etc. Disease, principle are by CRISPR-Cpf1/Cas12a in conjunction with isothermal nucleic acid amplification, detect the RNA or DNA of specificity.Separately Outside, the report ssDNA of fluorescence is issued when which also includes a cutting.When Cpf1/Cas12a detects target dsDNA sequence When column, ssDNase activity will cut report ssDNA, discharge detectable fluorescence signal.Both technologies are combined New system can with extremely low concentration detect list RNA and list DNA molecular, have a good application prospect.And according to Zhang Feng team Result of study show that of the same clan, Cpf1/Cas12a albumen has biggish difference, and certain albumen of the same clan are inactive.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the deficiencies of existing CRISPR/Cas system, provide a kind of with DNA The protein component ScCas12a albumen of the novel C RISPR/Cas12a system of cleavage activity can be applied to specific nucleic acid detection.

The object of the present invention is to provide a kind of novel ScCas12a albumen with DNA cleavage activity.

Another object of the present invention is to provide the preparation method of the ScCas12a albumen.

Above-mentioned purpose of the present invention is achieved through the following technical solutions:

Exploratory development of the present invention has found a kind of novel C as12a albumen with DNA cleavage activity, i.e. ScCas12a egg White, nucleotide sequence is as shown in SEQ ID NO.1.

ScCas12a albumen has DNA cleavage activity, can be used as novel C RISPR/ScCas12a system and examines applied to nucleic acid Survey, gene editing, gene modification, for based on Cas12a verification Molecular Detection and gene editing and modification provide a kind of necessity The new selection of tool.

Meanwhile in addition to ScCas12a albumen itself of the present invention, functional variety or its homologue or straight Xiang Tongyuan Object is all possible to retain part or all protein activity, the i.e. functional variety of ScCas12a albumen or its homologue or directly to same The application of source object, also should be within the scope of the present invention.

The functional variety may include that ScCas12a mutant (can be insertion, the mutation of missing or replacement sequence Body), polymorphic etc..The functional variety also include ScCas12a albumen and another usually incoherent nucleic acid, protein or The fusion product of polypeptide.Functional variety can be naturally occurring, be also possible to artificial.

It is first to pass through ScCas12a protein gene sequence simultaneously the present invention also provides the preparation method of ScCas12a albumen Codon optimization is crossed, the ScCas12a protein gene sequence after optimization is more suitable for gene in lactation as shown in SEQ ID NO.6 It is expressed in zooblast, the ScCas12a protein gene cloning after optimization is then entered into pET28a plasmid, carry out prokaryotic expression, table BL21star (DE3) is used up to bacterium；Finally ScCas12a albumen is obtained by purifying.

Preferably, albumen preparation condition is as follows:

The present invention prepares inducing expression condition when ScCas12a albumen are as follows: according to connecing for 1:80-120 (preferably 1:100) Expression bacterium is inoculated with the culture of LB culture medium, is incubated overnight strain to OD600=0.6- in 28-38 DEG C (preferably 37 DEG C) by kind amount 1.0, after cooled on ice (preferably 30 minutes cooling time), add the IPTG of final concentration of 0.2mM-0.5mM, continues in 16-37 DEG C Culture 4-24 hours.

It is sweet using 40-60mM Tris-HCl, pH7.5-8.5280-320mM NaCl, 4-6% when purifying protein of the present invention The lysis buffer of oil and 20-40mM imidazoles composition carries out cellular lysate.

Preferably, the composition of lysis buffer are as follows: 50mM Tris-HCl, pH8.0300mM NaCl, 5% glycerol and 30mM Imidazoles.

When purifying protein of the present invention, purified with Ni Sepharose FF column.

It is sweet with 40-60mM Tris-HCl, pH7.5-8.5280-320mM NaCl, 8-12% when purifying protein of the present invention The elution buffer of oil and 240-260mM imidazoles composition is eluted.

Preferably, the composition of elution buffer are as follows: 50mM Tris-HCl, pH8.0300mM NaCl, 10% glycerol and 250mM imidazoles.

It is sweet with 40-60mM Tris-HCl, pH7.5-8.5280-320mM NaCl and 4-6% when purifying protein of the present invention The dialyzate of oil composition is dialysed.

Preferably, the composition of dialyzate are as follows: 50mM Tris-HCl, pH8.0300mM NaCl and 5% glycerol.

Preferably, dialysis is carried out using 30kDa bag filter.

Specifically, optional scheme as one preferred, the preparation method of the ScCas12a albumen include following step It is rapid:

S1. using the plasmid for carrying ScCas12a sequence as template, upstream and downstream primer shown in SEQ ID NO.4 and 5 is utilized Carry out PCR amplification；

S2. NotI and NotI double digestion is utilized, pcr amplification product is connected to pET28a-ccdB-CmR carrier, obtains weight Group plasmid pET-28a-ScCas12a；

S3. recombinant plasmid pET-28a-ScCas12a is converted to BL21 and is expressed bacterial strain, the final concentration of 0.2-0.5mM of bacterial strain IPTG, for 24 hours in 18 DEG C of inducing expressions；

S4. it purifies: being purified using Ni Sepharose FF；

S5. be concentrated: ScCas12a albumen after purification with the concentration of 30kDa super filter tube, obtains ScCas12a albumen again.It obtains ScCas12a albumen addition glycerol to final concentration 50% after, packing liquid nitrogen flash freezer be stored in -80 DEG C.

Wherein, pET-28-ccdB-CmR carrier described in step S2 is basic with prokaryotic expression carrier pET28a, NotI-ccdB-CmR-AscI sequence is inserted between HindIII and XhoI restriction enzyme site to obtain.

The dilution used that dilutes includes 50mM Tris-HCl, pH8.0300mMNaCl, 5% glycerol；

The dialyzate includes 50mM Tris-HCl, pH8.0300mM NaCl, 5% glycerol.

The plasmid that ScCas12a sequence is carried described in step S1 will include C-terminal SV40 nuclear localization signal and HA label ScCas12a albumen is connected in improvement pET28a plasmid by NotI and AscI restriction enzyme site and obtains；The improvement pET28a plasmid It is between HindIII and XhoI, to insert NotI restriction endonuclease position on the basis of original pET28a plasmid Point, chloramphenicol resistance gene, ccdB bacterial growth lethal protein, AscI restriction endonuclease site obtain.

It is source Smithella sp.SC_K08D17's by the ScCas12a albumen of the above-mentioned prokaryotic expression of the present invention The protein component of CRISPR/ScCas12a system, C-terminal are connected with SV40 nuclear localization sequence, can tie with the sgRNA of in-vitro transcription It closes, has and target the activity that external DNA sequence dna or internal genome sequence are specifically cut.

Therefore, the following application of ScCas12a albumen also should all be within protection scope of the present invention:

Application of the ScCas12a albumen in terms of cutting DNA.

ScCas12a albumen as or application in terms of preparing DNA cutting tool.

Application of the ScCas12a albumen in terms of detection of nucleic acids.

Application of the ScCas12a albumen in terms of the detection of nucleic acids based on CRISPR/Cas12a.

ScCas12a albumen as or preparation detection of nucleic acids tool in terms of application.

ScCas12a albumen as or preparation the detection of nucleic acids tool based on CRISPR/Cas12a in terms of application.

The invention has the following advantages:

The research of the invention finds that a kind of novel C as12a albumen, i.e. ScCas12a albumen can with DNA cleavage activity It is applied to detection of nucleic acids, gene editing and modification as novel C RISPR/ScCas12a system, for the nucleic acid based on Cas12a point Son detection provides a kind of new selection of essential tool.

And the nucleic acid detection system based on ScCas12a albumen can be in 25-37 DEG C of highly sensitive, the high-precision molecule of realization Detection has specificity well and compatibility, and detection sensitivity is high, and testing cost is cheap, easy to operate, quick, application Range is wide, has a good application prospect in terms of detection of nucleic acids.

Detailed description of the invention

Fig. 1 is ScCas12a segment PCR amplification result.

Fig. 2 is recombinant plasmid pET28a-ScCas12a carrier digestion qualification result.

Fig. 3 is ScCas12a protein expression result.

Fig. 4 is ScCas12a protein purification result.

Fig. 5 is ScCas12a Activity determination result；1, negative control；2, experimental group.

Fig. 6 is ScCas12a gRNA purification result.

Fig. 7 is the detection of nucleic acids result based on ScCas12a.

Fig. 8 is ScCas12a nucleic acid detecting sensitivity testing result (black LbCas12a, grey ScCas12a).

Fig. 9 is ScCas12a detection of nucleic acids specific detection result.

Specific embodiment

The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention It limits in any form.To those skilled in the art, other any without departing from Spirit Essence and original of the invention Changes, modifications, substitutions, combinations, simplifications made by reason is lower, should be equivalent substitute mode, are included in protection of the invention Within the scope of.

Unless stated otherwise, the present invention uses reagent, method and apparatus for the art conventional reagent, method and are set It is standby.Unless stated otherwise, following embodiment agents useful for same and material are commercially available.

Unless otherwise indicated, the present invention uses immunology, biochemistry, chemistry, molecular biology, microbiology, thin Born of the same parents' biology, genomics and recombinant DNA etc. are the conventional technical ability of this field.Referring to Pehanorm Brooker (Sambrook), not in Odd (Fritsch) and the Germania base of a fruit this (Maniatis), " molecular cloning: laboratory manual " (MOLECULAR CLONING:A LABORATORY MANUAL), the 2nd editor (1989)；" Current Protocols laboratory manual " (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY) (F.M. Austria Su Beier (F.M.Ausubel) et al. editor, (1987))；" Enzymology method " (METHODS IN ENZYMOLOGY) series (Academic Press Inc): " PCR2: practical approach " (PCR 2:A PRACTICAL APPROACH) (M.J. McPpherson (M.J.MacPherson), B.D. Hei Musi (B.D.Hames) and Taylor G.R. (G.R.Taylor) edit (1995)), Ha Luo (Harlow) and draw in (Lane) edit (1988) " antibody: laboratory manual " (ANTIBODIES, A LABORATORY MANUAL), and " animal cell culture " (ANIMAL CELL CULTURE) (R.I. Fu Leixieni (R.I.Freshney) edits (1987)).

Isopropyl vulcanization-D- galactoside (IPTG) used in as the following examples is bought from Sigma company.Ni Sepharose FF is bought from GE Healthcare.Protein purification consumptive material is bought from green skies company.Amicon430kDa ultrafiltration Pipe is bought from Millipore company.Phusion archaeal dna polymerase, FastDigestNotI, FastDigestAscI restriction endonuclease, T4 ligase is bought from Thermo company.PCR clean up and gel reclaims kit are purchased from Qiagen company.

The discovery of 1 Cpf1/ScCas12a gene of embodiment

We have found a kind of Cas12a albumen with DNA cleavage activity from Smithella sp.SC_K08D17, are denoted as ScCas12a (sequence is as shown in SEQ ID NO.1).DsRNA substrate, ScCas12a albumen and gRNA are added in vitro anti- System is answered, discovery dsRNA substrate can specifically be cut under gRNA mediation by ScCas12a albumen.

Meanwhile the present inventor team, the study found that when choosing gRNA targeting sequence, targeting sequence 5 ' end should have 5 '- TTTN-3 ' sequence, and target sequence itself and do not formed between stable secondary structure, targeting sequence and remaining sequence not formed and stablize two Level structure, under this sgRNA design principle, ScCas12a, which has, targets external DNA sequence dna or internal genome sequence progress spy The activity of different cutting.

Following embodiment gives the preparation and active confirmatory experiment case of ScCas12a albumen.

The clone of 2 Cpf1/ScCas12a gene of embodiment and protein expression

1, PCR amplification Cas12a sequence

(1) design primer

It is as follows according to ScCas12a sequence design upstream and downstream primer, sequence:

Upstream primer (shown in SEQ ID NO.4):

GTGCGGCCGCCATGCAGACCCTGTTTGAGAACTTCACA；

Downstream primer (shown in SEQ ID NO.5):

GTGGCGCGCCTGGCATAGTCGGGGACATCATATG。

(2) PCR amplification

First ScCas12a protein gene is optimized, sequence is as shown in SEQ ID NO.6 after optimization.Using above-mentioned upper Downstream primer carries out target fragment under different annealing temperature using high-fidelity DNA polymerase (phusion archaeal dna polymerase) PCR amplification.As a result as shown in Fig. 1, PCR purpose band (about 4000bp).

2, construction recombination plasmid pET-28a-ScCas12a

(1) pcr amplification product purifies: purification kit (the Clean up examination that product passes through Qiagen company after PCR amplification Agent box) carry out purification process；

(2) using the quick restriction enzyme NotI (FastDigestNotI) of Thermo company and NotI (FastDigestAscI) double digestion is carried out；

(3) digestion products pass through micro-example gel reclaims kit (MiniElute) purification and recovery of Qiagen company；

(4) product of purification and recovery is connected to the pET28a-ccdB-CmR for also passing through the processing of NotI and AscI double digestion On carrier, recombinant plasmid pET-28a-ScCas12a is obtained；

Wherein, pET-28-ccdB-CmR carrier used is the preservation of this laboratory, is with prokaryotic expression carrier pET28a (purchase Managed in biological unifier) basis, it is engineered that NotI-ccdB-CmR-AscI sequence is added between HindIII and XhoI restriction enzyme site Column, are made pET-28-ccdB-CmR carrier.

3, the identification of recombinant plasmid pET-28a-ScCas12a

To identify pET-28a-ScCas12a recombinant vector correctness, we are to recombinant plasmid pET-28a-ScCas12a Carry out digestion identification and sequencing identification.

Digestion identification is carried out using Asc I or NotI single endonuclease digestion and Asc I or NotI double digestion respectively, as a result such as attached drawing 2 It is shown, the experimental results showed that, the digestion products size of all experimental groups is to be consistent with expection, thus can tentatively judge that we obtain The carrier arrived is correct pET-28a-ScCas12a carrier.

In addition, sequencing result also indicates that ScCas12a sequence is correctly cloned into pET28a.

4, the prokaryotic expression of ScCas12a albumen

(1) it will identify that correct recombinant plasmid pET-28a-ScCas12a is converted to BL21 (DE3) expression bacterial strain (to be purchased from Transgen company) in.Recombinant bacterium is obtained by positive identification.

(2) monoclonal of picking recombinant bacterium 37 DEG C of overnight incubations into 50mL LB culture medium.According to the inoculum concentration of 1:100, Overnight strain, which is seeded in 1L LB culture medium 37 DEG C of cultures, adds IPTG to final concentration to OD600=0.6, ice-water bath 30min For 0.5mM, continue to cultivate 4h in 15 DEG C.Thalline were collected by centrifugation saves in -80 DEG C.

5, it detects and optimizes ScCas12a protein expression

Recombinant plasmid pET-28a-ScCas12a is transferred in BL21 (DE3), is expressed at 37 DEG C with 0.2mM inducible protein, And electrophoretic analysis is carried out to precipitating after cracking and supernatant.(as shown in Fig. 3).

The purifying of 3 ScCas12a albumen of embodiment

1, the purification process of ScCas12a albumen

Bacterium solution after inducing expression is centrifuged, and thallus is resuspended in lysis buffer, carries out ultrasonication (70% vibration Width, 2s On/4s Off, 3 minutes, Sonics 750w Ultrasound Instrument), it is centrifugated supernatant.Extremely by protein cleavage supernatant loading Ni Sepharose FF after balance washes away foreign protein to be greater than the lysis buffer of 30 times of bed volumes, with elution buffer It is eluted, with Superdex 200,10/300 gel chromatographic columns of Tricorn are purified.SDS-PAGE points are carried out after elution Analysis observation result and gel column purification, the Cas12a albumen after purification of acquisition.Wherein, lysis buffer includes 50mM Tris-HCl, pH8.0300mM NaCl, 5% glycerol, 20mM imidazoles.Elution buffer include 50mM Tris-HCl, PH8.0300mM NaCl, 5% glycerol, 250mM imidazoles.

Obtained albumen dilutes three times with 50mM Tris-HCl pH8.0300mM NaCl5% glycerol, and super with 30kDa Chimney filter concentration.After adding glycerol to final concentration 50%, packing liquid nitrogen flash freezer is stored in -80 DEG C.

2, ScCas12a protein purification result

Carry out large-scale purification again after optimized purification step, purpose band is about 170kDa.As shown in Fig. 4, it is seen that The purity and yield of purifying are higher.

ScCas12a purification schemes of the present invention simplify TEV cutting labelling step, have substantially simplified purifying process and purifying Cost, meanwhile, this method can ensure that protein active.

The Activity determination of 4 ScCas12a albumen of embodiment

1, it is the activity for detecting ScCas12a albumen, passes through the activity of the ScCas12a of experiment in vitro verifying purifying.

We have prepared the pUC19-B2 plasmid containing target sequence, and (plasmid origin is in article: CRISPR-Cas12a Target binding unleashes single-stranded DNase activity) as inspection ScCas12a albumen Active substrate, choose plasmid on a site design sgRNA, active ScCas12a albumen in conjunction with sgRNA after can Targeting DNA is cut into two segments, so that it is determined that whether ScCas12a albumen is active.

The plasmid that specifically 100ng is linearized through SacI, the ScCas12a albumen of 20ng gRNA, 250ng after purification, It mixes in 1 × NEB buffer3 final volume 10 μ L, 37 DEG C of incubation 60min, reaction is with the termination of 0.1 μ L Proteinase K, in 1% agar Electrophoretic analysis ScCas12a albumen external activity is carried out in sugared gel.As a result as shown in Fig. 5, only when being added to ScCas12a DNA just can be successfully cut into two segments after albumen, thus confirm we extract, the ScCas12a albumen that purifies in vitro It is active.

The acquisition of gRNA described in experiment: design can identify the targeting sequence of plasmid: TttaGATCGTTACGCTAACTATGA transcribes out sgRNA by t7 rna polymerase.

Detection of nucleic acids of the embodiment 5 based on ScCas12a

1, target RNA is prepared

Target nucleotide can pass through PCR amplification, recombinase polymeric enzymatic amplification (RPA), NASBA isothermal duplication or ring mediated isothermal Amplification (LAMP), strand displacement amplification (SDA), helicase dependent amplification (HDA) and nickase amplified reaction (NEAR) mode expand Increase target DNA.

Recombinase polymeric enzymatic amplification RPA (Recombinase Polymerase Amplification): NCBI is used Primer blast designs RPA primer, and amplified fragments size is 80-120nt, and the denaturation temperature of primer can be 54-67 DEG C, Opt =60, length 30-35nt, Opt=32, G/C content is 40-60% in primer, according to implementation sequence synthetic DNA primer.

Template sequence:

atttcacacaggaaacagctatgaccatgattacgccaagcttGACGACAAAAtttaGATCGTTACGC TAACTATGAgggctgtctgtgaatgctaggatccccgggtaccgagctcgaattcactggccgtcgttttacaacg tcgtgactgggaaaaccctggcgttacccaacttaatcgcc

Primer sequence:

FP:AATTCTAATACGACTCACTATAGggccagtgaattcgagctcggtacccgggg atcc

RP:atttcACACAGGAAACAGCTATGACCATGATTACG

It refers to respectivelyBasic andBasicRT (TwistDx) kit carries out RPA reaction, Unlike, before template segments addition, the MgAc of 280mM, i.e. magnesium acetate is first added.It is reacted 30 minutes at 37 DEG C.

Glue separation and purifying (using MinElute gel extraction kit (Qiagen) kit), after purification DsDNA be incubated overnight (use T7RNApolymerase (Thermo) kit) with 37 DEG C of T7 polymerase, then use RNeasy Mini kit (Qiagen) kits RNA, to obtain target nucleus RNA.

2, gRNA is prepared

GRNA primer sequence design principle: when choosing targeting sequence, targeting sequence 5 ' end should have 5 '-TTTN-3 ' sequence； And targeting sequence itself does not form between stable secondary structure, targeting sequence and remaining sequence and does not form stable secondary structure.It can lead to Cross http://www.rgenome.net/cas-designer/ online software Computer Aided Design.

Primer construction:

5 '-targeting sequence-" ATCTACACTTAGTAGAAATTA "-CCCTATAGTGAGTCGTATTACA-3 '

Wherein " ATCTACACTTAGTAGAAATTA " sequence can be replaced " ATCTACAATAGTAGAAATTA ".

Referring to T7RNApolymerase kit (Thermo) kit specification, by the DNA fragmentation with T7 promoter, T7 Primer, the mixing of T7 polymerase, 37 DEG C of overnight incubations；RNeasy mini kit (Qiagen) is used again, obtains the gRNAs of purifying. As shown in Figure 6.

T7 primer sequence: TGTAATACGACTCACTATAGGG

T7gRNA primer sequence:

TCATAGTTAGCGTAACGATCATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTACA。

3, Cpf1/Cas12a Activity determination

Detection architecture includes: 100ng nucleic acid primer, the ScCas12a of 45nM purifying, 22.5nM gRNA and nuclease inspection Surveying buffer, (buffer each component is in the final concentration of of detection architecture: 20mM Tris, 60mM NaCl, 10mM MgCl₂, pH 7.3).React 1h.1 μ l Proteinase K (Thermo) is added and terminates reaction.Agarose gel electrophoresis analysis is as a result, such as Fig. 7.

4, detection of nucleic acids

Detection architecture includes: 2 μ l RPA products, the ScCas12a of 45nM purifying, 22.5nM gRNA, and 100nM exists The reporter dna chain of ScCas12a capable of emitting fluorescence when cutting, i.e., non-specific single stranded DNA fluorescence probe (DNAseAlert QC System Thermo Scientific), 0.5 μ l RNase inhibitor (Promega) and nuclease detection buffer (buffering Liquid each component is in the final concentration of of detection architecture: 20mM Tris, 60mM NaCl, 10mM MgCl₂,pH 7.3)。

Reaction system is placed in fluorescence analyser (BioTek), reacts 1-3 hours under 37 DEG C (unless otherwise indicated), fluorescence Dynamic testing 5 minutes primary.

Analysis SHERLOCK fluorescence data: the fluorescence data in order to calculate removal background facilitates the ratio between different condition Compared with the initial fluorescence of sample is removed.Background fluorescence (no target nucleotide or without gRNA under conditions of) can be removed from sample, from And obtain the data of background correction fluorescence.

For testing result as shown in figure 8, compared with reported LbCas12a, ScCas12a has same detection sensitivity.

Detection of nucleic acids specificity of the embodiment 6 based on ScCas12a

1, experimental method

By determined nucleic acid sample described in same embodiment 4, ScCas12a albumen, gRNA, non-specific single-stranded fluorescence probe It is mixed into reaction system with reaction required buffer liquid addition, it is glimmering to read reacting hole with excitation wavelength 530nm/ launch wavelength 580nm Light value.In the presence of target, compared with negative control sample, fluorescence signal can receive at 580nm.

According to SsCas12a for substrate and mutation Substrate fluorescence signal intensity difference judgement detection specificity.

Substrate sequence:

atatgGTGCCATGGACTTTAGTACATTGCAAGATACTAAATGTGAGGTAC

Mutant nucleotide sequence:

atatgGTGCCATGGACTTTAAAACATTGCAAGATACTAAATGTGAGGTAC

2, result has good as shown in figure 9, can distinguish to non-specific template that is special and non-fully matching Verify detection specificity.

It will be appreciated by persons skilled in the art that can be implemented using the alternative replacement present invention of this field routine The conventional clone of Cas12a gene, the building of recombinant expression carrier, the expression of Cas12a albumen and purifying, target nucleus glycosides in example The amplification of acid/target gene segment and etc. one of or it is a variety of, to obtain similar or equivalent effect.

Sequence table

<110>the universal Li Hua Science and Technology Ltd. in Guangzhou

<120>novel C RISPR/ScCas12a albumen and preparation method thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3753

<212> DNA

<213>ScCas12a sequence (ScCas12a)

<400> 1

atgcaaacac tatttgaaaa tttcacaaat cagtatccgg tgagtaagac tttgcgtttt 60

gagttgatcc cgcagggaaa aacaaaagat tttatagaac agaaaggtct tttaaaaaaa 120

gacgaggatc gtgcggaaaa atataagaaa gtaaaaaaca ttattgatga atatcataaa 180

gatttcattg agaaatcact gaacggttta aaattagacg ggcttgagaa gtataagact 240

ttatatttaa agcaggaaaa agacgataaa gataaaaagg cgtttgataa agaaaaagaa 300

aatcttagga aacagattgc gaatgctttt agaaacaatg aaaagtttaa aacgctcttt 360

gccaaggaat taataaagaa cgatttgatg agttttgcct gtgaggaaga caaaaaaaac 420

gtaaaggagt ttgaagcttt tacaacttat ttcactgggt ttcaccagaa cagggcaaac 480

atgtatgtgg cggatgagaa acgaacggct attgcgagcc ggcttataca tgagaatctg 540

cccaagttca ttgataacat caagatattt gaaaagatga aaaaagaagc gcccgagctt 600

ctttcccctt ttaatcaaac attaaaggat atgaaggatg ttatcaaggg tacaacattg 660

gaagaaatat tttcactgga ttatttcaat aagacactta cacaatcggg gattgacata 720

tacaattccg taatcggcgg cagaacaccc gaagagggaa aaacaaaaat caagggctta 780

aacgaatata tcaatactga ttttaaccag aagcagaccg ataagaaaaa aagacagccc 840

aagttcaagc aactctacaa gcagattttg agcgacaggc agagcctgtc atttattgcg 900

gaggcattca aaaatgatac tgaaattctg gaagcaatag aaaaattcta tgtaaatgaa 960

ttgctgcatt tttccaatga aggcaaatca accaatgtat tggatgcaat caaaaatgct 1020

gtaagcaatc ttgaatcttt caacctgacc aagatgtatt tcagaagcgg cgcttcattg 1080

accgatgttt ccaggaaagt atttggagaa tggagcatta ttaacagggc tttagataat 1140

tactacgcaa caacctaccc catcaagcca agagagaaat cagagaaata cgaagagcgg 1200

aaagagaaat ggctcaaaca ggattttaac gtcagcctga ttcagaccgc aattgatgag 1260

tacgacaatg aaacagttaa gggaaaaaac agtgggaaag tcatagctga ttactttgcg 1320

aagttctgcg atgacaaaga gactgattta attcagaagg tcaatgaagg ctatatagct 1380

gtcaaggatt tgctgaacac cccttgtcct gaaaatgaga agctcgggag caataaggat 1440

caggtcaaac agataaaggc atttatggac agcataatgg acattatgca ttttgtaaga 1500

ccgctgagcc tgaaggatac tgataaagag aaagacgaaa cattctatag tctgtttacc 1560

cctctatacg accatctgac ccagaccatc gcactctaca ataaggtgcg taactacctc 1620

acacagaaac catacagcac ggaaaagata aaactgaact ttgaaaactc cacattgctg 1680

ggtggatggg atttaaataa agaaacagac aatacagcta ttatactgag gaaagataac 1740

ctttattact tgggcattat ggacaagaga cataacagaa tattcagaaa cgtacctaaa 1800

gcggataaaa aggatttctg ctacgagaaa atggtttaca agcttctgcc tggagcaaat 1860

aaaatgctgc cgaaggtatt cttttcgcag tcacggatac aggaatttac tccgtcagcc 1920

aaactgctgg aaaactacgc gaatgagacg cacaaaaaag gtgataattt caacctgaat 1980

cattgccata aattaattga ttttttcaaa gactcaatca acaaacacga ggactggaaa 2040

aactttgatt tcaggttttc agccacgtcc acctatgctg atttaagcgg attctatcac 2100

gaggtggaac atcagggcta taagataagt ttccagagcg tagccgattc attcattgac 2160

gatttggtca atgaagggaa actctatctt ttccaaatat acaacaagga tttctcacct 2220

ttcagtaagg gcaagcccaa cctgcacacc ctctactgga agatgctctt tgatgagaat 2280

aatttaaaag acgtggttta taaactaaat ggtgaggccg aggtattcta ccgcaagaaa 2340

tccattgccg agaaaaacac gaccattcat aaggccaatg aaagtattat taacaagaat 2400

ccagacaatc cgaaagccac aagtacattt aactacgaca tcgtcaagga taaacgctac 2460

accattgata agttccaatt ccacattccc ataaccatga atttcaaggc tgaaggcata 2520

ttcaatatga accagagggt caaccagttc ctcaaggcca acccagatat taatatcatc 2580

ggaatagaca ggggagaaag gcatctactt tactacgccc tgataaatca gaaaggtaag 2640

attctcaagc aggacacctt gaatgtcatt gccaatgaaa agcagaaagt tgactatcac 2700

aacctgctgg acaagaaaga gggtgataga gccacggcaa ggcaggaatg gggcgtaatt 2760

gagaccatta aggaactgaa ggaaggttat ctgtcgcagg tcatccacaa gctgaccgat 2820

ttgatgattg aaaacaacgc catcattgtg atggaagatt tgaacttcgg tttcaagcgt 2880

ggaaggcaga aggtggagaa gcaggtttac cagaagtttg agaaaatgct gattgataaa 2940

ctcaattacc ttgtggataa gaataaaaaa gcaaatgaac ttggcggtct gctcaacgca 3000

ttccagttag cgaacaagtt tgaaagtttc cagaaaatgg ggaagcagaa cggatttatt 3060

ttctacgtgc ctgcgtggaa cacaagcaag accgatcctg ccacaggttt cattgatttc 3120

ctgaaaccca gatatgagaa cctgaaccag gcaaaggact tctttgagaa gtttgattcc 3180

atccgtctca acagcaaggc agattatttt gaatttgctt ttgattttaa aaacttcacc 3240

gaaaaggcag acggtggaag gacgaaatgg acagtttgca ccaccaatga ggacaggtac 3300

gcttggaaca gggcgttaaa caacaacagg ggcagtcagg aaaaatatga tatcacagca 3360

gaactgaaat ccctgtttga cggaaaggtg gactacaaaa gcggcaagga tttgaaacag 3420

cagatagcaa gtcaggaatc tgctgatttc tttaaggcat taatgaaaaa tttaagcatt 3480

accctttcat tgcggcacaa caacggagag aaaggagata atgagcagga ttatatttta 3540

tctcctgtag cagacagcaa gggaagattc tttgattcaa ggaaagcaga tgacgatatg 3600

cccaagaatg ccgacgccaa cggcgcttat catatcgcgc ttaaaggttt atggtgtctg 3660

gaacagatca gtaagacgga cgacctgaaa aaagtaaagt tagccataag caataaagag 3720

tggcttgaat ttgtgcaaac actaaaagga taa 3753

<210> 2

<211> 185

<212> DNA

<213>template target sequence (Target sequence)

<400> 2

atttcacaca ggaaacagct atgaccatga ttacgccaag cttgacgaca aaatttagat 60

cgttacgcta actatgaggg ctgtctgtga atgctaggat ccccgggtac cgagctcgaa 120

ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 180

tcgcc 185

<210> 3

<211> 40

<212> DNA

<213>gRNA sequence (gRNA)

<400> 3

taatttctac tattgtagat gatcgttacg ctaactatga 40

<210> 4

<211> 38

<212> DNA

<213>upstream primer (forward primer)

<400> 4

gtgcggccgc catgcagacc ctgtttgaga acttcaca 38

<210> 5

<211> 34

<212> DNA

<213>downstream primer (reverse primer)

<400> 5

gtggcgcgcc tggcatagtc ggggacatca tatg 34

<210> 6

<211> 3885

<212> DNA

<213>the ScCas12a protein gene sequence (Optimized ScCas12a) after optimizing

<400> 6

atgcagaccc tgtttgagaa cttcacaaat cagtacccag tgtccaagac cctgcgcttt 60

gagctgatcc cccagggcaa gacaaaggac ttcatcgagc agaagggcct gctgaagaag 120

gatgaggacc gggccgagaa gtataagaag gtgaagaaca tcatcgatga gtaccacaag 180

gacttcatcg agaagtctct gaatggcctg aagctggacg gcctggagga atacaagacc 240

ctgtatctga agcaggagaa ggacgataag gataagaagg cctttgacaa ggagaaggag 300

aacctgcgca agcagatcgc caatgccttc cggaacaatg agaagtttaa gacactgttc 360

gccaaggagc tgatcaagaa cgatctgatg tctttcgcct gcgaggagga caagaagaat 420

gtgaaggagt ttgaggcctt caccacatac ttcaccggct tccaccagaa ccgcgccaat 480

atgtacgtgg ccgatgagaa gagaacagcc atcgccagca ggctgatcca cgagaacctg 540

ccaaagttta tcgacaatat caagatcttc gagaagatga agaaggaggc ccccgagctg 600

ctgtctcctt tcaaccagac cctgaaggat atgaaggacg tgatcaaggg caccacactg 660

gaggagatct ttagcctgga ttatttcaac aagaccctga cacagagcgg catcgacatc 720

tacaattccg tgatcggcgg cagaacccct gaggagggca agacaaagat caagggcctg 780

aacgagtaca tcaataccga cttcaaccag aagcagacag acaagaagaa gcggcagcca 840

aagttcaagc agctgtataa gcagatcctg agcgataggc agagcctgtc ctttatcgcc 900

gaggccttca agaacgacac cgagatcctg gaggccatcg agaagtttta cgtgaatgag 960

ctgctgcact tcagcaatga gggcaagtcc acaaacgtgc tggacgccat caagaatgcc 1020

gtgtctaacc tggagagctt taacctgacc aagatctatt tccgctccgg cacctctctg 1080

acagacgtga gccggaaggt gtttggcgag tggagcatca tcaatagagc cctggacaac 1140

tactatgcca ccacatatcc aatcaagccc agagagaagt ctgagaagta cgaggagagg 1200

aaggagaagt ggctgaagca ggacttcaac gtgagcctga tccagaccgc catcgatgag 1260

tacgacaacg agacagtgaa gggcaagaac agcggcaaag tgatcgtcga ttattttgcc 1320

aagttctgcg acgataagga gacagacctg atccagaagg tgaacgaggg ctacatcgcc 1380

gtgaaggatc tgctgaatac accctgtcct gagaacgaga agctgggcag caataaggac 1440

caggtgaagc agatcaaggc ctttatggat tctatcatgg acatcatgca cttcgtgcgc 1500

cccctgagcc tgaaggatac cgacaaggag aaggatgaga cattctactc cctgttcaca 1560

cctctgtacg accacctgac ccagacaatc gccctgtata acaaggtgcg gaactatctg 1620

acccagaagc cttacagcac agagaagatc aagctgaact tcgagaacag caccctgctg 1680

ggcggctggg atctgaataa ggagacagac aacacagcca tcatcctgag gaaggaaaac 1740

ctgtactatc tgggcatcat ggacaagagg cacaatcgca tctttcggaa cgtgcccaag 1800

gccgataaga aggactcttg ctacgagaag atggtgtata agctgctgcc tggcgccaac 1860

aagatgctgc caaaggtgtt cttttctcag agcagaatcc aggagtttac cccttccgcc 1920

aagctgctgg agaactacga aaatgagaca cacaagaagg gcgataattt caacctgaat 1980

cactgtcacc agctgatcga tttctttaag gactctatca acaagcacga ggattggaag 2040

aatttcgact ttaggttcag cgccacctcc acctacgccg acctgagcgg cttttaccac 2100

gaggtggagc accagggcta caagatctct tttcagagca tcgccgattc cttcatcgac 2160

gatctggtga acgagggcaa gctgtacctg ttccagatct ataataagga cttttcccca 2220

ttctctaagg gcaagcccaa cctgcacacc ctgtactgga agatgctgtt tgatgagaac 2280

aatctgaagg acgtggtgta taagctgaat ggcgaggccg aggtgttcta ccgcaagaag 2340

agcattgccg agaagaacac cacaatccac aaggccaatg agtccatcat caacaagaat 2400

cctgataacc caaaggccac cagcaccttc aactatgata tcgtgaagga caagagatac 2460

accatcgaca agtttcagtt ccacatccca atcacaatga actttaaggc cgagggcatc 2520

ttcaacatga atcagagggt gaatcagttc ctgaaggcca atcccgatat caacatcatc 2580

ggcatcgaca gaggcgagag gcacctgctg tactatgccc tgatcaacca gaagggcaag 2640

atcctgaagc aggataccct gaatgtgatc gccaacgaga agcagaaggt ggactaccac 2700

aatctgctgg ataagaagga gggcgaccgc gcaaccgcaa ggcaggagtg gggcgtgatc 2760

gagacaatca aggagctgaa ggagggctat ctgtcccagg tcatccacaa gctgaccgat 2820

ctgatgatcg agaacaatgc catcatcgtg atggaggacc tgaactttgg cttcaagcgg 2880

ggcagacaga aggtggagaa gcaggtgtat cagaagtttg agaagatgct gatcgataag 2940

ctgaattacc tggtggacaa gaataagaag gcaaacgagc tgggaggcct gctgaacgca 3000

ttccagctgg ccaataagtt tgagtccttc cagaagatgg gcaagcagaa cggctttatc 3060

ttctacgtgc ccgcctggaa tacctctaag acagatcctg ccaccggctt tatcgacttc 3120

ctgaagcccc gctatgagaa cctgaatcag gccaaggatt tctttgagaa gtttgactct 3180

atccggctga acagcaaggc cgattacttt gagttcgcct ttgacttcaa gaatttcacc 3240

gagaaggccg atggcggcag aaccaagtgg acagtgtgca ccacaaacga ggacagatat 3300

gcctggaata gggccctgaa caataacagg ggcagccagg agaagtacga catcacagcc 3360

gagctgaagt ccctgttcga tggcaaggtg gactataagt ctggcaagga tctgaagcag 3420

cagatcgcca gccaggagtc cgccgacttc tttaaggccc tgatgaagaa cctgtccatc 3480

accctgtctc tgagacacaa taacggcgag aagggcgata atgagcagga ctacatcctg 3540

tcccctgtgg ccgattctaa gggccgcttc tttgactccc ggaaggccga cgatgacatg 3600

ccaaagaatg ccgacgccaa cggcgcctat cacatcgccc tgaagggcct gtggtgtctg 3660

gagcagatca gcaagaccga tgacctgaag aaggtgaagc tggccatctc caacaaggag 3720

tggctggagt tcgtgcagac actgaagggc aaaaggccgg cggccacgaa aaaggccggc 3780

caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttatccctac 3840

gacgtgcctg attatgcata cccatatgat gtccccgact atgcc 3885

Claims (16)

1. a kind of protein component ScCas12a of novel C RISPR/Cas12a system, which is characterized in that nucleotide sequence such as SEQ Shown in ID NO.1 or SEQ ID NO.6.

2. the preparation method of ScCas12a described in claim 1, which is characterized in that by optimization shown in SEQ ID NO.6 ScCas12a protein gene sequence carries out prokaryotic expression and obtains ScCas12a albumen.

3. preparation method according to claim 2, which is characterized in that ScCas12a protein gene cloning is entered pET28a matter Grain, carries out prokaryotic expression, and expression bacterium uses BL21 star (DE3)；Finally ScCas12a albumen is obtained by purifying.

4. the preparation method according to Claims 2 or 3, which is characterized in that the condition of protein induced expression are as follows: according to 1:80- Expression bacterium is inoculated with the culture of LB culture medium, strain is incubated overnight in 28-38 DEG C to OD600=0.6-1.0, ice by 120 inoculum concentration After upper cooling, add the IPTG of final concentration of 0.2mM-0.5mM, continues culture 4-24 hours in 16-37 DEG C.

5. the preparation method according to Claims 2 or 3, which is characterized in that when purifying protein, use 40-60mM Tris- The lysis buffer that HCl, pH7.5-8.5 280-320mM NaCl, 4-6% glycerol and 20-40mM imidazoles form carries out thallus and splits Solution.

6. the preparation method according to Claims 2 or 3, which is characterized in that it is pure to carry out albumen using Ni Sepharose FF column Change.

7. the preparation method according to Claims 2 or 3, which is characterized in that when purifying protein, with 40-60mM Tris-HCl, The elution buffer of pH7.5-8.5 280-320mM NaCl, 8-12% glycerol and 240-260mM imidazoles composition are eluted.

8. the preparation method according to Claims 2 or 3, which is characterized in that when purifying protein, the component for dialyzate used of dialysing Are as follows: 40-60mM Tris-HCl, pH7.5-8.5 280-320mM NaCl and 4-6% glycerol.

9. preparation method according to claim 8, which is characterized in that dialysed using 30kDa bag filter.

10. the preparation method according to Claims 2 or 3, which comprises the steps of:

S1. it using the plasmid for carrying ScCas12a sequence as template, is carried out using upstream and downstream primer shown in SEQ ID NO.4 and 5 PCR amplification；

S2. it utilizesNotI andNotPcr amplification product is connected to pET28a-ccdB-CmR carrier by I double digestion, obtains recombination matter Grain pET-28a-ScCas12a；

S3. recombinant plasmid pET-28a-ScCas12a is converted to BL21 and is expressed bacterial strain, and bacterial strain carries out inducing expression with IPTG；

S4. it purifies: being purified using Ni Sepharose FF；

S5. be concentrated: ScCas12a albumen after purification with the concentration of 30kDa super filter tube, obtains ScCas12a albumen again.

Application of the 11.ScCas12a albumen in terms of cutting DNA.

12.ScCas12a albumen as or application in terms of preparing DNA cutting tool.

Application of the 13.ScCas12a albumen in terms of detection of nucleic acids.

Application of the 14.ScCas12a albumen in terms of the detection of nucleic acids based on CRISPR/Cas12a.

15.ScCas12a albumen as or preparation detection of nucleic acids tool in terms of application.

16.ScCas12a albumen as or preparation the detection of nucleic acids tool based on CRISPR/Cas12a in terms of application.