CN103074335B - Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method - Google Patents

Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method Download PDF

Info

Publication number
CN103074335B
CN103074335B CN201210482530.5A CN201210482530A CN103074335B CN 103074335 B CN103074335 B CN 103074335B CN 201210482530 A CN201210482530 A CN 201210482530A CN 103074335 B CN103074335 B CN 103074335B
Authority
CN
China
Prior art keywords
goby
gobioidei
iii
gene
plastosome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210482530.5A
Other languages
Chinese (zh)
Other versions
CN103074335A (en
Inventor
徐田军
王日昕
金逍逍
孙悦娜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Ocean University ZJOU
Original Assignee
Zhejiang Ocean University ZJOU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Ocean University ZJOU filed Critical Zhejiang Ocean University ZJOU
Priority to CN201210482530.5A priority Critical patent/CN103074335B/en
Publication of CN103074335A publication Critical patent/CN103074335A/en
Application granted granted Critical
Publication of CN103074335B publication Critical patent/CN103074335B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the fish mitochondrial genome research field, and concretely relates to a COIII and ND3 gene amplimer, the gene amplimer is composed of two strips of single chain oligonucleotide chains, wherein a light chain primer is a nucleotide sequence shown in SEQ ID NO.1, and a heavy chain primer is a nucleotide sequence shown in SEQ ID NO.2. The invention also provides a design and an amplification method of the amplimer. The invention can specifically amplify a plurality of goby mitochondrion COIII and ND3 gene sequences with high efficiency, and can be used in goby different classification category systems evolution and classification research.

Description

Gobioidei plastosome CO III and ND3 gene amplification primer, design and amplification method
Technical field
The invention belongs to fish Mitochondrial Genome Overview research field, be specifically related to a kind of efficient amplification multiple Gobioidei mitochondrial cytochrome c (Cytc) oxidase subunit III (cytochrome c oxidase subunit III; CO III) the most of sequence of gene and NADH reductase enzyme complex subunit 3(NADH dehydrogenase subunits 3; ND3) amplimer of gene complete sequence and design thereof and amplification method.
Background technology
Fish Mitochondrial Genome Overview 37 encoding genes and one section of main non-coding region (control region) is made up of 13 proteins encoded plasmagenes, 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA) totally, has matrilinear inheritance simple in structure, copy number is many, strict, recombinates hardly, coding efficiency is high, rate of evolution is fast and different zones rate of evolution such as there are differences at the feature.Due to these features that fish Mitochondrial Genome Overview has, become the important molecular markers of the research fields such as fish molecular population genetics, phylogenetics and conservation biology.
Gobioidei is under the jurisdiction of Perciformes, goby suborder, is most species in the world, and one of the widest fish distribute.Estimate that global goby kind has kind more than 2000, they form a huge biological group, in the water surrounding especially marine eco-environment, occupy an important position.Goby mostly is carnivorous small fish, is found everywhere through the world, and especially, taking the torrid zone as many, is mainly seawater fish, the life of dwelling of most of battalion end, and principal character is that its abdomeinal fin heals into a sucker shape.In recent years, due to reasons such as overfishing, climatope variations, many traditional tuna fisheries resources can not form fishing news, and some is even exhausted, but Gobioidei is because of reasons such as it are adaptable, life cycle is short, reproductivity is strong, and stock number but increases year by year.Most of Gobioidei economic worth is not high, has about the research of Gobioidei relatively lessly both at home and abroad, and of a great variety because of it, formalness feature is very similar, causes being difficult for differentiating and assert.At present, the classification of Gobioidei is also very not clear, and the classification position of many types is also more chaotic.
Genes involved in the full genome of plastosome and Mitochondrial Genome Overview has been widely used in the research fields such as goby population genetics, phylogenetics and conservation biology as molecule marker.CO III and ND3 are as 3 Codocyte pigment c (Cytc) oxidase subunits and 7 one of genes of NADH reductase enzyme complex subunits of encoding in vertebrates encoding mitochondrial protein gene, its contained phylogeny information is arranged in the better-than-average of 13 encoding egg white genes, can be applicable to vertebrate phyletic evolution and sort research.But do not had the universal primer of reporting increase plastosome CO III and ND3 gene order, especially for Gobioidei.Therefore design the universal primer of specific amplification Gobioidei plastosome CO III and ND3 gene order, thereby lay the foundation for efficiently obtaining goby plastosome CO III and ND3 gene order and mitochondrial genome complete sequence.
Summary of the invention
The vacancy existing for above-mentioned prior art, the present invention aims to provide the single stranded oligonucleotide primer of a pair of efficiently specific amplified multiple Gobioidei plastosome CO III and ND3 gene order, thereby provides a powerful for effectively obtaining fast Gobioidei plastosome CO III and ND3 gene order to carry out phyletic evolution and sort research.The present invention also aims to provide the method for design of described Gobioidei plastosome CO III and ND3 gene amplification primer, and the method for utilizing described Gobioidei plastosome CO III and ND3 gene amplification primer prawn tiger fish plastosome CO III and ND3 gene to increase.
For realizing goal of the invention of the present invention, contriver provides following technical scheme:
Gobioidei plastosome CO III and ND3 gene amplification primer, be made up of two single stranded oligonucleotide chains, and wherein light chain primer is the nucleotide sequence shown in SEQ ID No.1; Heavy chain primer is the nucleotide sequence shown in SEQ ID No.2.
Shown in light chain primer Gobies-CO III-ND3-F(SEQ ID No.1 of the present invention) there are 21 base: ATACCACATAGTAGACCCCAG, be positioned on CO III gene; Heavy chain primer Gobies-CO III-ND3-R (shown in SEQ ID No.2) has 21 base: GACTTTAACCACGAGCTTTTG, is positioned on tRNA-Arg gene.
Gobioidei plastosome CO III of the present invention and ND3 gene amplification primer are to 17 kinds of Gobioideis that gather at Area of The East China Sea, all can obtain fragment length is the specific amplification products of 1150 bp left and right, through order-checking and with GenBank in the comparison of homologous sequence, confirm as and comprise chondriosome ND 3 gene complete sequence, tRNA-Gly gene complete sequence, and length is the amplified production of the CO III gene overwhelming majority sequence of 720 bp left and right, embody the wider amplification scope of the present invention and stronger amplification ability, thereby provide a powerful for effectively obtaining fast Gobioidei line grain CO III and ND3 gene order to carry out phyletic evolution and sort research.
As preferably, according to Gobioidei plastosome CO III of the present invention and ND3 gene amplification primer, wherein said Gobioidei includes but not limited to following: Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
The present invention also provides the method for design of above-mentioned Gobioidei plastosome CO III and ND3 gene amplification primer, login CO III gene and the tRNA-Arg gene order of the Mitochondrial Genome Overview of other species of Gobioidei that GenBank database (http://www.ncbi.nlm.nih.gov/) search in NCBI website measured and nearly edge species, through homology comparison, find conserved sequence, and utilize Premier Primer5.0 software design to go out Gobioidei plastosome CO III and ND3 gene amplification primer.Premier Primer5.0 software used is downloaded at biosoftware net http://www.bio-soft.net/.
The present invention also provides a kind of method that Gobioidei plastosome CO III and ND3 gene are increased, and it is that the DNA profiling solution that adopts above-mentioned Gobioidei plastosome CO III and ND3 gene amplification primer to treat test sample product carries out pcr amplification.
As preferably, according to a kind of method that Gobioidei plastosome CO III and ND3 gene are increased of the present invention, wherein the condition of pcr amplification is: 95 DEG C of denaturation 5min, then 95 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C are extended 1min20s, totally 35 circulations, and last 72 DEG C are extended 5min.
As preferably, according to a kind of method that Gobioidei plastosome CO III and ND3 gene are increased of the present invention, wherein the reaction composition of pcr amplification is: PCR reaction system is 25 μ L, includes dNTP(2.5mM) the light chain primer of 2 μ L, 10 × Taq archaeal dna polymerase Buffer, 2.5 μ L, 10 μ M and the each 1 μ L of heavy chain primer, Taq archaeal dna polymerase (5U/ul) 0.2 μ L, containing DNA profiling solution 1 μ L and the ddH of 100ng 2o 17.3 μ L.
As preferably, according to a kind of method that Gobioidei plastosome CO III and ND3 gene are increased of the present invention, wherein said testing sample is from including but not limited to following Gobioidei: Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
Compared with prior art, tool of the present invention has the following advantages:
Gobioidei plastosome CO III provided by the invention and ND3 gene amplification primer, can efficiently increase specifically multiple Gobioidei plastosome CO III and ND3 gene order, can be applied to the different taxonomic category phyletic evolutions of shrimp tiger and sort research.Universal primer of the present invention and method of design thereof also can be used as the specific examples of universal primer PCR amplification principle and key parameter research simultaneously, promote the progressive development of the field that the invention relates to, thereby possess important invention value and theory significance.
Brief description of the drawings
Fig. 1 is Gobioidei plastosome CO III of the present invention and the ND3 gene amplification primer electrophoretogram in order to increase different Gobioidei plastosome CO III and ND3 gene order.
Wherein M:DNA molecular weight standard (DL2000), 1-17 is followed successively by: Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
Embodiment
Below in conjunction with embodiment and Figure of description, be described more specifically content of the present invention.Should be appreciated that enforcement of the present invention is not limited to the following examples, any pro forma accommodation that the present invention is made and/or change all will fall into protection domain of the present invention.
In the present invention, if not refer in particular to, all part, per-cents are weight unit, and all equipment and raw materials etc. all can be buied from market or the industry is conventional.If without specializing, the method that embodiment adopts is this area current techique.
Main raw, reagent and plant and instrument:
Software and sequence resource: Premier Primer5.0 primer-design software (downloading from biosoftware net http://www.bio-soft.net/), Gobioidei Mitochondrial Genome Overview sequence resource (downloading Genbank database http://www.ncbi.nlm.nih.gov/ in NCBI), sequence analysis software MEGA5.0(downloads from biosoftware net http://www.bio-soft.net/).
Pcr amplification detects related reagent instrument: marine animal genome DNA extracting reagent kit (TIANGEN, Beijing), sepharose DNA reclaims test kit (TIANGEN, Beijing), conventional desk centrifuge (Thermo), Bio-Rad C1000TM Thermal Cycler amplification instrument (Bio-Rad, the U.S.), micropipet (Enppdorf, Germany), 96 hole PCR plates (Axygen), dNTP(TIANGEN, Beijing), 10 × Taq archaeal dna polymerase Buffer(TIANGEN, Beijing), Taq archaeal dna polymerase (TIANGEN, Beijing), sterilizing distilled water, DL2000 DNA marker(TIANGEN, Beijing), agarose (Biowest, Hong Kong), electrophoresis apparatus (DYY-6C type, Beijing 6 1), gel imaging instrument (Bio-Rad GD2000, the U.S.).
Cloning and sequencing related reagent instrument: high-pressure steam sterilizing pot (SANYO, Japan), the antibiotic sterilizing LB of ammonification benzyl (Amp) substratum, LB solid culture plate (the raw work in Shanghai), Bechtop (SW-CJ-1G type, the star of famous brand, China), thermostat water bath (upper Nereid is grand), DH5 α competent cell (TIANGEN), Amp microbiotic (the raw work in Shanghai), the chloro-3-indoles-β-D-of the bromo-4-of 5-galactoside (the raw work in Shanghai), isopropylthio-β-D-galactoside (the raw work in Shanghai), pGEM-T carrier (Promega, the U.S.), constant incubator (PH070A type, Shanghai Yiheng Scientific Instruments Co., Ltd), constant temperature oscillation shaking table (training English, Taicang experimental installation factory) automated DNA sequenator (ABI 3730 types, the U.S.).
The experimental technique of unreceipted actual conditions in embodiment, according to normal condition, the authors' such as such as Sambrook molecular cloning laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition of manufacturer's specification sheets suggestion.
embodiment 1
1, the design of Gobioidei plastosome CO III and ND3 gene amplification primer and synthetic:
CO III gene and the tRNA-Arg gene order of other species of Gobioidei that the GenBank database search in login NCBI website has been measured and the Mitochondrial Genome Overview of nearly edge species, sequence is loaded in analysis software MEGA5.0, utilize ClustalW algorithm to carry out multisequencing contraposition compare of analysis, find conserved sequence, found conserved sequence is loaded into Premier Primer5.0 software and under manual designs pattern, (under manual option, selects Low, design parameter is default setting) design Gobioidei plastosome CO III and ND3 gene amplification primer: wherein shown in light chain primer Gobies-CO III-ND3-F(SEQ ID No.1) there are 21 base: ATACCACATAGTAGACCCCAG, be positioned on CO III gene, heavy chain primer Gobies-CO III-ND3-R (shown in SEQ ID No.2) has 21 base: GACTTTAACCACGAGCTTTTG, is positioned on tRNA-Arg gene.
Synthesized the primer that meets nucleotide sequence shown in SEQ ID No.1 and SEQ ID No.1 according to contriver's requirement by Nanjing Genscript Biotechnology Co., Ltd..
2, Gobioidei plastosome CO III and ND3 gene are increased
17 samples to be tested in the present invention are all collected in the Area of The East China Sea of China.Wherein the Gobioidei of amplification is following kind: Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
Utilize marine animal genome DNA extracting reagent kit to extract the genomic dna of sample to be tested, method is carried out according to test kit specification sheets, the genomic dna of agarose electrophoresis Detection and Extraction.
PCR reaction system and reaction conditions for increase multiple Gobioidei plastosome CO III and ND3 gene are as follows: PCR reaction system is 25 μ L, include dNTP(TIANGEN), 10 × TaqDNA polysaccharase Buffer(TIANGEN), heavy chain primer Gobies-CO III-ND3-R of light chain primer Gobies-CO III-ND3-F of 10 μ M and 10 μ M, Taq DNA polysaccharase (TIANGEN), contain the genomic dna template solution of the said extracted of 100ng, ddH 2o, wherein:
10 × TaqDNA polysaccharase Buffer, 2.5 μ L
dNTP 2μL
Gobies- COⅢ-ND3-F 1μL
Gobies- COⅢ-ND3-R 1μL
Template DNA 1μL
ddH 2O 17.3μL
Taq DNA polysaccharase 0.2 μ L.
Amplified reaction is at Bio-Rad C1000 tMon Thermal Cycler instrument, carry out, amplification condition is: 95 DEG C of denaturation 5min, and then 95 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C are extended 1min20s, totally 35 circulations, last 72 DEG C are extended 5min.Amplified production detects its size and purity with 1% agarose gel electrophoresis.The electrophoretogram of different Gobioidei plastosome CO III and ND3 gene amplification product is shown in Fig. 1.
Use the most Gobioidei line grain CO III of primer amplification and the ND3 gene order of design, all obtain single object fragment, product size is about 1150 bp, and pcr amplification product is directly checked order, after the steps include: that pcr amplification product tentatively quantitatively, concentration reaches the sample of about 100ng/ μ l, sends Nanjing Genscript Biotechnology Co., Ltd., entrust it to carry out two-way order-checking, sequencing primer is Gobies-CO III-ND3-F(10 μ M) and Gobies-CO III-ND3-R(10 μ M).Comprising chondriosome ND 3 gene complete sequence, tRNA-Gly gene complete sequence and length through checking order and compare with the homologous sequence in GenBank, confirming as is the amplified production of the CO III gene overwhelming majority partial sequences of 720 bp left and right.
Use the thin sour jujube goby of primer amplification Pu Shi and blue or green mudskipper plastosome CO III and the ND3 gene of design, all obtain single object fragment, product size is about 1150 bp, and use sepharose DNA to reclaim test kit (TIANGEN, Shanghai) pcr amplification product is carried out to glue recovery purifying, purified product connects with pGEM-T carrier (Promega company, the U.S.), transform qualification positive colony order-checking.The steps include: that the pcr amplification product that reclaims purifying through glue carries out ligation with pGEM-T carrier under the effect of T4 DNA ligase.Ligation system is carrier 1 μ l, and T4 DNA ligase 1 μ l connects Buffer 5ul, PCR purified product 3 μ l.Ligation is in operation on ice, and reaction solution is placed in 4 DEG C of refrigerators and connects spend the night (at least 12 hours).Get DH5 α competent cell (TIANGEN, Beijing), heat shock method transforms, carry out the white screening of indigo plant with containing ammonia benzyl microbiotic (Amp) LB flat board (being evenly coated with in advance the bromo-4-of 5-chloro-3-indoles-β-D-galactoside (X-Gal) of 40ul 20mg/ml and the isopropylthio-β-D-galactoside (IPTG) of 30ul 0.2mol/L before use), and confirm positive colony of picking by bacterium liquid pcr amplification.The bacterium liquid of positive colony after enlarged culturing is sent Nanjing Genscript Biotechnology Co., Ltd. and is carried out two-way direct Sequencing.Sequencing primer is SP6/T7.Sequenator is the full-automatic DNA sequencer of ABI 3730.Comprising chondriosome ND 3 gene complete sequence, tRNA-Gly gene complete sequence and length through checking order and compare with the homologous sequence in GenBank, confirming as is the amplified production of the CO III gene overwhelming majority sequences of 720 bp left and right.
practicality
Gobioidei plastosome CO III of the present invention and ND3 gene amplification primer carry out pcr amplification to the DNA profiling solution of 17 kinds of ocean Gobioideis in Area of The East China Sea collection, all can obtain the specific amplification products of fragment in 1150 bp left and right, through order-checking and with GenBank in the comparison of homologous sequence, confirm as and comprise chondriosome ND 3 gene complete sequence, tRNA-Gly gene complete sequence, and length is the amplified production of the CO III gene overwhelming majority sequence of 720 bp left and right, embody the wider amplification scope of the present invention and stronger amplification ability, therefore, Gobioidei plastosome CO III of the present invention and ND3 gene amplification primer can be applied in the different hierarchies evolution of Gobioidei and sort research field.
Although contriver has done comparatively detailed elaboration and has enumerated technical scheme of the present invention, be to be understood that, for one of this area those skilled in the art, above-described embodiment is modified and/or flexible or to adopt the replacement scheme being equal to be obvious, all can not depart from the essence of spirit of the present invention, the term occurring in the present invention, for the elaboration to technical solution of the present invention and understanding, can not be construed as limiting the invention.
SEQUENCE LISTING
<110> Oceanography Institute Of Zhejiang
<120> Gobioidei plastosome CO III and ND3 gene amplification primer, design and amplification method
<130> Z122339
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
ataccacata gtagacccca g 21
<210> 2
<211> 21
<212> DNA
<213> artificial sequence
<400> 2
gactttaacc acgagctttt g 21

Claims (4)

1. Gobioidei plastosome CO III and ND3 gene amplification primer, is characterized in that being made up of two single stranded oligonucleotide chains, and wherein light chain primer is the nucleotide sequence shown in SEQ ID No.1; Heavy chain primer is the nucleotide sequence shown in SEQ ID No.2.
2. Gobioidei plastosome CO III as claimed in claim 1 and ND3 gene amplification primer, is characterized in that described Gobioidei comprises Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
3. method Gobioidei plastosome CO III and ND3 gene being increased, is characterized in that the DNA profiling solution that adopts Gobioidei plastosome CO III as claimed in claim 1 and ND3 gene amplification primer to treat test sample product carries out pcr amplification,
The condition of pcr amplification is: 95 DEG C of denaturation 5min, and then 95 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C are extended 1min20s, totally 35 circulations, last 72 DEG C are extended 5min,
The reaction composition of pcr amplification is: PCR reaction system is 25 μ L, includes dNTP 2 μ L, the light chain primer of 10 × Taq archaeal dna polymerase Buffer, 2.5 μ L, 10 μ M and the Taq archaeal dna polymerase 0.2 μ L of the each 1 μ L of heavy chain primer, 5U/ul of 2.5mM, containing DNA profiling solution 1 μ L and the ddH of 100ng 2o 17.3 μ L.
4. a kind of method that Gobioidei plastosome CO III and ND3 gene are increased as claimed in claim 3, is characterized in that described testing sample is from Bostrichthys sinensis, blue or green mudskipper, speckle tongue goby, moustache thin white silk used in ancient China goby, hole goby, the thin sour jujube goby of green statin, red wolf's fang goby, the thin sour jujube goby of Pu Shi, spot acanthogobius, mudskipper, lance tail goby, Zhoushan reins goby, tack pole goby, biobelt thin white silk used in ancient China goby, the not easily seen goby of canine tooth, Taiwan ditch goby, eyeball tail tadpole goby.
CN201210482530.5A 2012-11-22 2012-11-22 Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method Active CN103074335B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210482530.5A CN103074335B (en) 2012-11-22 2012-11-22 Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210482530.5A CN103074335B (en) 2012-11-22 2012-11-22 Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

Publications (2)

Publication Number Publication Date
CN103074335A CN103074335A (en) 2013-05-01
CN103074335B true CN103074335B (en) 2014-07-09

Family

ID=48151030

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210482530.5A Active CN103074335B (en) 2012-11-22 2012-11-22 Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

Country Status (1)

Country Link
CN (1) CN103074335B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111961733A (en) * 2020-08-28 2020-11-20 海南热带海洋学院 DNA bar code for identifying goby and goby of China comb and identification method and application thereof
CN117418023B (en) * 2023-12-18 2024-03-01 中国科学院海洋研究所 Double-band onyx and imogolix species-specific markers, specific primers, application and identification method and kit

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102409051A (en) * 2011-10-18 2012-04-11 浙江海洋学院 Marine fish mitochondrial genome control area amplification primer, as well as design and amplification methods
CN102776183A (en) * 2012-07-12 2012-11-14 宁波大学 Amplimer of large yellow croaker mitochondrion complete genome sequence and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102409051A (en) * 2011-10-18 2012-04-11 浙江海洋学院 Marine fish mitochondrial genome control area amplification primer, as well as design and amplification methods
CN102776183A (en) * 2012-07-12 2012-11-14 宁波大学 Amplimer of large yellow croaker mitochondrion complete genome sequence and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
邵爱华.暗纹东方魨线粒体DNA的分离纯化及其几个重要基因的克隆与序列分析.《中国优秀博硕士学位论文全文数据库(硕士)农业科技辑D052-1》.2006, *

Also Published As

Publication number Publication date
CN103074335A (en) 2013-05-01

Similar Documents

Publication Publication Date Title
CN102912012B (en) Marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer and design and amplification method thereof
CN102409051B (en) Marine fish mitochondrial genome control area amplification primer, as well as design and amplification methods
CN1900318B (en) High variation zone amplication primer of rockfish mitochondrial genome and its design method
CN102757960B (en) Semi-random polymerase chain reaction (PCR) technique for amplifying unknown sequence and primer and kit used for technique
CN103740729A (en) SNP locus related to growth characteristics of patinopecten yessoensis and detection and application thereof
CN103898108A (en) Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof
CN104099428B (en) A kind of triple real-time fluorescence PCR primers, probe and test kit differentiating Ranavirus virus
CN103074335B (en) Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method
CN104059975A (en) Providencia O3, O4, O8, O12, O13 and O20 specific nucleotides and application thereof
CN103074336B (en) Goby mitochondrion ND1 gene complete sequence amplimer, design and amplification method
Dezotti et al. Molecular biology techniques applied to the study of microbial diversity of wastewater treatment systems
Ma et al. Development of 12 polymorphic microsatellite markers in Coilia ectenes Jordan and Seale, 1905 (Clupeiformes: Engraulidae) and cross-species amplification in Coilia mystus Linnaeus, 1758
CN104726555A (en) Nibea japonica microsatellite DNA markers
CN104531688B (en) A kind of spider mitochondrial genome complete sequence amplimer and amplification method
CN104789666A (en) DNA (deoxyribonucleic acid) barcoding based standard gene for identifying dengue fever transmission medium aedes albopictus and application
Miller‐Butterworth et al. Isolation and characterization of highly polymorphic microsatellite loci in Schreibers’ long‐fingered bat, Miniopterus schreibersii (Chiroptera: Vespertilionidae)
CN106995842B (en) Kit for detecting clinically common pathogenic bacteria by combining TMA (mechanical analysis) melting curve method with pyrophosphoric acid sequencing technology and application of kit
CN101709334B (en) DNA molecular mark and application thereof of SXI inbred line mouse
Fukui et al. Rapid detection of Vibrio harveyi in seawater by real-time PCR
CN111926094B (en) Bar code identification primer, identification method and kit for different species in aeromonas
Li et al. Isolation and characterization of polymorphic microsatellites in a sex‐reversal fish, rice field eel (Monopterus albus)
Li et al. Characterization and development of SSR markers of schizothoracine fish (Cypriniformes: Cyprinidae) based on SLAF‐seq Technique
CN101693919B (en) PCR amplification primer for chondriosome cytb gene segment of Marsupenaeus japonicus and identification method thereof
Shangguan et al. Screening and characterization of novel polymorphic microsatellite markers from sea cucumber Holothuria leucospilota
CN109321664A (en) A kind of more Lin Zi Acenthogobius flavimanus mitochondrial genome complete sequence primers and design, phylogenetic analysis complete sequence amplification method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CP01 Change in the name or title of a patent holder

Address after: Ocean Science College, No. 105 Wenhua Road, Dinghai District, Zhoushan City, Zhejiang Province, 316000

Patentee after: Zhejiang Ocean University

Address before: Ocean Science College, No. 105 Wenhua Road, Dinghai District, Zhoushan City, Zhejiang Province, 316000

Patentee before: ZHEJIANG OCEAN University

CP01 Change in the name or title of a patent holder
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20130501

Assignee: Zhejiang Xinjiahe Biotechnology Co.,Ltd.

Assignor: Zhejiang Ocean University

Contract record no.: X2023980043657

Denomination of invention: Primers, design, and amplification methods for mitochondrial CO III and ND3 genes in shrimp, tiger, and fish

Granted publication date: 20140709

License type: Common License

Record date: 20231019

EE01 Entry into force of recordation of patent licensing contract