CN106995842B

CN106995842B - Kit for detecting clinically common pathogenic bacteria by combining TMA (mechanical analysis) melting curve method with pyrophosphoric acid sequencing technology and application of kit

Info

Publication number: CN106995842B
Application number: CN201710187708.6A
Authority: CN
Inventors: 任绪义; 罗英
Original assignee: Hangzhou Dian Medical Examination Center Co ltd
Current assignee: Hangzhou Dian Medical Examination Center Co ltd
Priority date: 2017-03-27
Filing date: 2017-03-27
Publication date: 2021-01-08
Anticipated expiration: 2037-03-27
Also published as: CN106995842A

Abstract

The invention relates to a kit for detecting clinically common pathogenic bacteria by combining a TMA melting curve method and a pyrophosphate sequencing technology and application thereof, wherein the kit comprises the following primers and probes: (1) TMA reaction primers: the nucleotide sequence is shown in SEQ ID NO. 1-4; (2) molecular beacon probe: the nucleotide sequence is shown in SEQ ID NO. 5-7; (3) sequencing primer: the nucleotide sequence is shown in SEQ ID NO. 8. The kit disclosed by the invention belongs to the field of microbiology, can realize accurate, rapid and high-throughput detection of common clinical pathogenic bacteria, so that rapid identification of infectious bacteria in clinical samples is realized, guidance is provided for preparing reasonable antibacterial drug treatment for clinical bacterial infection patients, abuse of antibiotics is further avoided, and valuable treatment time is saved for the patients.

Description

Kit for detecting clinically common pathogenic bacteria by combining TMA (mechanical analysis) melting curve method with pyrophosphoric acid sequencing technology and application of kit

Technical Field

The invention belongs to the field of microbiology, and particularly relates to a kit and a method for detecting clinically common pathogenic bacteria by combining a TMA (mechanical analysis) melting curve method and a pyrophosphoric acid sequencing technology.

Background

Bacterial infections are a common clinical infectious disease with high morbidity and mortality rates that can seriously compromise a patient's life if not diagnosed and treated early. Isolation of the bacteria directly from clinical specimens indicates that the infection is severely in need of immediate antibacterial treatment. The sensitivity of different pathogenic bacteria to the type and concentration of drug varies, and the key to successful treatment is the early application of a suitable sufficient amount of drug. In the traditional methods for detecting pathogenic bacteria, such as microscopic examination, culture method, biochemical examination, immunological method and the like, due to the influence of various factors, several methods are usually required to be used in combination, the time consumption is long and is 1-3 days, and improper medication often causes the patients to be seriously ill or the drug resistance of the strains is increased. Especially in the case of multiple bacterial combined infection, the complexity of strain identification and medication is increased. Therefore, it is necessary to establish a rapid and highly specific method for detecting microorganisms.

Transcription-mediated nucleic acid amplification (TMA) is an isothermal amplification technology for directly and rapidly detecting RNA developed in recent years, overcomes the defects of the conventional nucleic acid amplification, is simpler, more convenient and more efficient, and is particularly suitable for detecting RNA viruses. High Resolution Melting curve analysis (HRM) is a new tool for detecting gene mutation, genotyping, and SNP, and can rapidly detect single-base mutation in nucleic acid fragments. HRM techniques are based primarily on differences in the physical properties of nucleic acid molecules. The length of the fragments, GC content, GC distribution, etc. of different nucleic acid molecules are different, and therefore any double-stranded DNA molecule will have the shape and position of its own melting curve when denatured by heating. The basic principle of the HRM technique is to differentiate samples according to melting curves. Pyrosequencing (Pyrosequencing) technology is a new generation of DNA sequence analysis technology and is widely used in the field of genotype analysis. The technology does not need electrophoresis, and the DNA fragment does not need special fluorescent labeling, so the operation is very simple and convenient. The kit and the method for detecting the clinically common pathogenic bacteria by using the TMA technology and the pyrosequencing technology are developed by the kit, and more than twenty clinically common pathogenic bacteria can be detected. The kit is mainly used for assisting the diagnosis and treatment of clinicians, and has the main clinical significance of detection: when bacterial infection is treated, it is important to use antibiotics reasonably and correctly, and each bacterium has a corresponding applicable antibiotic, and if the bacterial species cannot be identified quickly and accurately, the failure of surgical treatment, the increase of complications, the recurrence of infection, the prolongation of hospital stay, the increase of the use of expensive antibiotics and other medicines, and the like can be caused.

Disclosure of Invention

The invention aims to provide a kit for detecting clinically common pathogenic bacteria by combining a TMA melting curve method and a pyrophosphate sequencing technology, so as to overcome the defects of the prior art, and provide basis and guidance for scientific medication of a patient infected with bacteria.

In order to solve the technical problems, the invention provides the following technical scheme:

the primer and the probe for detecting the clinically common pathogenic bacteria by combining the TMA melting curve method with the pyrosequencing technology comprise the following sequences:

(1) TMA reaction primers: the nucleotide sequence is shown in SEQ ID NO. 1-4;

(2) molecular beacon probe: the nucleotide sequence is shown in SEQ ID NO. 5-7;

(3) sequencing primer: the nucleotide sequence is shown in SEQ ID NO. 8.

The specific TMA reaction primers comprise forward primers F1 and F2 and reverse primers R1 and R2;

the base sequences of the forward primer F1 and the reverse primer R1 are shown as follows:

forward primer F1: 5'-GAAGAGTTTGATCATGGCTCAG-3', respectively;

reverse primer R1: 5'-AATTCTAATACGACTCACTATAGGGAGAAGGTTACTCACCCGTCCGCCACT-3', respectively;

the base sequences of the forward primer F2 and the reverse primer R2 are shown as follows:

forward primer F2: 5'-GCAACGCGAAGAACCTTACC-3', respectively;

reverse primer R2: 5'-AATTCTAATACGACTCACTATAGGGAGAAGGACGACAGCCATGCAGCACCT-3', respectively;

5' ends of the forward primers F1 and F2 are labeled with biotin;

31 bases at the 5 'end of the reverse primers R1 and R2 are added T7 phage promoter sequences, and 20 bases at the 3' end are specific sequences complementary to 16S rRNA of bacteria;

the base sequence of the molecular beacon probe is shown as follows:

molecular beacon probe P1: 5'-GCGCGGCCTAATACATGCAAGTCGAGCGAACGGACGGGGAGCTTGCCCGCGC-3', respectively;

molecular beacon probe P2: 5'-GCCCGTTAGAGATAGAGGCTTCACCTTCGGAGGACAATGTGAACGGGC-3', respectively;

molecular beacon probe P3: 5'-CGCGCGGGCCGAACACAAAAAGTTAAGCTTCTTAG CGCCGATTGTAG CCGCGCG-3', respectively;

the molecular beacon probe P1 is marked with a fluorescent reporter group CY5 at the 5 'end and a fluorescent quencher group DABCYL at the 3' end of an oligonucleotide DNA molecule; 6 bases at the 5 'end and 3' end of P1 are reverse complementary sequences forming the stem region of the hairpin structure characteristic of the probe, and 40 bases in the middle of the probe molecule are specific sequences complementary to the 16S rRNA antisense strand of the bacterium;

the molecular beacon probe P2 is characterized in that the 5 'end of an oligonucleotide DNA molecule thereof is marked with a fluorescent reporter group HEX, and the 3' end is marked with a fluorescent quencher group DABCYL; the 7 bases at the 5 'end and 3' end of P2 are reverse complementary sequences forming the stem region of the hairpin structure characteristic of the probe, and the 34 bases in the middle of the probe molecule are specific sequences complementary to the 16S rRNA antisense strand of the bacterium;

the molecular beacon probe P3 is characterized in that the 5 'end of an oligonucleotide DNA molecule of the molecular beacon probe P3 is marked with a fluorescence reporter group FAM, and the 3' end of the oligonucleotide DNA molecule is marked with a fluorescence quencher group DABCYL; the 7 bases at the 5 'end and 3' end of P3 are reverse complementary sequences forming the stem region of the hairpin structure characteristic of the probe, and the 40 bases in the middle of the probe molecule are specific sequences complementary to the 16S rRNA antisense strand of the bacterium;

the kit for detecting the clinically common pathogenic bacteria by combining the TMA melting curve method with the pyrosequencing method comprises an RNA extraction reagent, a 2 xTMA reaction solution, a 5 x enzyme mixed solution, a single-stranded purification reagent and a sequencing reagent.

Wherein the RNA extraction reagent comprises: lysis solution, washing solution I, washing solution II and eluent TE;

the lysis solution comprises the following components: 2-8M of guanidine salt, 50-200 mM Tris and 0.5-10% of surfactant in volume percentage, wherein the guanidine salt is guanidine isothiocyanate or guanidine hydrochloride, and the surfactant is Tween 20, NP40 or Triton X-100;

the washing solution I comprises the following components: 2-6M guanidine salt, 50-200 mM Tris, and 0.5-10% by volume percent of surfactant, wherein the guanidine salt is guanidine isothiocyanate or guanidine hydrochloride, and the surfactant is Tween 20, NP40 or Triton X-100;

the washing liquid II comprises the following components: 10-100 mM Tris, 20-100 mM EDTA, 65-80% ethanol by volume percentage;

the eluent TE comprises the following components: 10mM Tris, 1mM EDTA, pH 8.0.

Wherein the 2 XTMA reaction solution comprises: 0.4 to 1. mu.M of the oligonucleotide represented by SEQ ID NO.1 to 4, 0.05 to 0.5. mu.M of the 3-molecule beacon probe, 80mM Tris-HCl (pH8.0), 24mM MgCl₂140mM KCl, 2mM dNTPs, 4mM NTPs and 30% (v/v) dimethyl sulfoxide.

Wherein the 5 Xenzyme mixed solution comprises: 200U M-MLV, 1000U T7RNAPol and 105. mu.g BSA;

the single-stranded purification reagent comprises: 75% (v/v) ethanol solution, 0.2M NaOH, 10mM Tris (hydroxymethyl) aminomethane acetate solution pH 7.6, binding buffer, annealing buffer, streptavidin-coated magnetic beads;

the sequencing reagent comprises: DNA polymerase, ATP sulfurylase, luciferase, apyrase, substrate APS, luciferin and dNTP.

The kit for detecting clinically common pathogenic bacteria by combining the TMA melting curve method and the pyrosequencing method is applied to detecting pathogenic bacteria.

The method for detecting the clinically common pathogenic bacteria by using the kit for detecting the clinically common pathogenic bacteria by using the TMA melting curve method and the pyrosequencing method comprises the following steps:

(1) extracting a sample to be detected or bacterial RNA;

(2) TMA amplification: taking 5ul of the RNA solution extracted in the step (1), adding the RNA solution into 10ul of 2 xTMA reaction solution, uniformly mixing, and carrying out reaction at 65 ℃ for 5min and at 41 ℃ for 2 min; then adding 5ul of 5 Xenzyme mixed solution, mixing uniformly, and placing at the constant temperature of 41 ℃ for amplification for 30min (can be directly placed on a Roche fluorescence quantitative PCR instrument);

(3) and (3) detecting a melting curve: the following components are arranged on a fluorescent quantitative PCR instrument: at 95 ℃ for 2 min; the temperature was gradually raised from 35 ℃ to 75 ℃ at a temperature rise rate of 0.14 ℃/step, the fluorescence value generated by the molecular beacon was recorded for each temperature rise by the Melting curve analysis program, which was carried out on a fluorescent quantitative PCR instrument (LightCycler 480, Roche corporation);

(4) and (4) analyzing results: and (4) judging the result according to the melting curve peak value (Tm) of the detection sample in the step (3). Firstly, the quality control system judges that negative control and blank control have no melting peak, otherwise, the system detection is invalid. When the system is effectively detected, judging the result of the sample to be detected, wherein different bacteria correspond to different melting Tm values;

(5) pyrosequencing: when the bacterial species can not be judged according to the step (4), taking out the product of the step (3) and combining the product with streptavidin-coated magnetic beads for single-chain purification; then carrying out pyrosequencing on the single-chain purified product; the sequencing results were compared to NCBI data to determine the genus of the sample tested.

Has the advantages that:

the kit of the invention designs primers and probes according to the existing conserved region of the 16S rRNA gene sequence of bacteria, and ensures the specificity of the detection method. The invention adopts an improved transcription-mediated nucleic acid amplification Technology (TMA) -melting curve technology-pyrophosphoric acid sequencing technology, has strong specificity, sensitivity similar to that of a PCR detection method, low pollution (amplification product RNA is easy to degrade in a natural environment), high speed (TMA-melting curve detection only needs about 1 hour, single-strand purification and pyrophosphoric acid sequencing can be completed only about 1 hour), and can complete the identification of 80 percent of clinically common pathogenic bacteria within about 1 hour and complete the identification of all clinically infected bacteria within 2 hours. Plays an important role in the rapid identification and detection analysis of clinical microorganisms and has wide application prospect.

Drawings

FIG. 1: the detection result diagrams of the heteroproteus, the enterobacter cloacae and the klebsiella cepacia are shown, wherein 1 is proteus mirabilis, 2 is enterobacter cloacae, 3 is klebsiella cepacia, 4 is negative control and 5 is blank control.

FIG. 2: sequencing results of pyrophosphate of Burkholderia yunnanensis.

FIG. 3: and D, sequencing the actinomyces neucheniformis pyrophosphate.

Detailed Description

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the examples are only illustrative of the present invention and should not, nor should they limit the invention as detailed in the claims.

Example 1: method for detecting clinically common pathogenic bacteria by combining TMA (mechanical analysis) melting curve method with pyrosequencing method

1. Extracting clinical specimen RNA (using RNA extraction reagent in kit)

The instrument comprises the following steps: tianlong NP968 nucleic acid extractor

The method comprises the following steps:

a. taking 5 clinical samples, centrifuging, collecting precipitates, adding 300 mu l of physiological saline, uniformly mixing, transferring to a 96-deep-hole plate cracking hole, adding 300 mu l of lysis solution in a kit, 150 mu l of isopropanol (self-prepared) and 20 mu l of magnetic beads in the kit;

b. and extracting RNA on a nucleic acid extractor for about 15-30 min.

TMA melting Curve detection

The instrument comprises the following steps: roche

480II real-time fluorescent quantitative PCR

a. Using the RNA obtained in the step 1 as a template, and performing TMA-melting curve detection by using specific primers (SEQ ID NO. 1-4) and molecular beacon probes (SEQ ID NO. 5-7) of a conserved region of the 16S rRNA of the bacteria;

wherein, the TMA amplification system is as follows: 2 XTMA reaction solution 10. mu.l (including primers F1, F2, R1, R2 and molecular beacon probes P1, P2, P3), 5 XTMA enzyme mixture 4. mu.l, extracted RNA 6. mu.l; the reaction conditions are as follows: 5min at 65 ℃; at 41 ℃ for 30 min; then 95 ℃ for 2 min; and (3) at the temperature of 35-75 ℃, the heating rate is 0.14 ℃/step, and the fluorescence value generated by the molecular beacon probe during each heating is collected.

b. And (c) according to the difference of the Tm positions of the melting curves obtained in the step a, completing the identification of the conventional bacteria, as shown in the figure 1.

3. Pyrophosphoric acid sequencing

The instrument comprises the following steps: QIAGEN Pyromark Q96ID sequencer

3.1 Single Strand purification:

for some samples which are not common or cannot be completely distinguished in the step 2, the TMA amplification product in the step 2 is subjected to single-strand purification by using a single-strand purification reagent in the kit, and the specific operation steps are as follows:

1) before use, ensure that all solutions reach room temperature; turning on a power switch of the oven to enable the temperature to reach 80 ℃;

2) to the PSQ 96 plate were added 45. mu.l of Annealing Buffer and 1-2. mu.l of 10uM sequencing primer (SEQ ID NO: 8) (ii) a

3) Sepharose Beads (streptavidin-labeled magnetic Beads) were mixed well on a shaker;

4) the desired amount of Sepharose Beads (3. mu.l per sample) was transferred to a 1.5ml Eppendorf tube;

5) binding Buffer was added to Sepharose Beads to give an average volume of about 50. mu.l per sample, and the mixture was mixed well on a shaker;

6) the above mixture was added to TMA amplification product (approximately 50. mu.l reaction volume) in 50. mu.l per sample;

7) mixing the PCR plate evenly for 10 minutes on a vibrator at normal temperature to ensure that Sepharose Beads are fully combined with a biotin labeled product;

8) in the vacumprep works, 180ml of pure water, 120ml of 70% ethanol, Washing Buffer and decomposition Buffer are sequentially added into four liquid tanks;

9) turning on a pump of the VacuumPrep works, and washing the VacuumPrep Tool in pure water for 30 seconds;

10) moving the Vacuum Prep Tool to a PCR plate hole, and grabbing sepharose beads combined with biotin labeled nucleic acid;

11) picking up the PCR plate and checking whether the Beads are adsorbed on the Vacuum Prep Tool;

12) putting the Vacuum Prep Tool into 70% ethanol for 15 seconds, then moving the Vacuum Prep Tool into a Desurvation Buffer for 15 seconds, and then moving the Vacuum Prep Tool into a Washing Buffer for cleaning for 30 seconds;

13) suspending the Tool above the PSQ plate hole containing the sequencing primer, without contacting the liquid level, turning off the pump, placing the Vacuum Prep Tool in the PSQ plate containing the sequencing primer, and rotating and shaking to release Sepharose Beads;

14) the PSQ 96 Plate with the purified sample is placed on a Thermo Plate, placed in an oven at 80 ℃ for heating for 2 minutes, taken out and cooled to room temperature, and then placed in a sequencer for downstream Pyrosequencing reaction.

3.2 cleaning after purification:

1) without opening a Vacuum pump and a valve, washing the Vacuum Prep Tool with a small amount of pure water to elute a small amount of unspiked Beads;

2) after the pure water is replaced, opening the vacuum pump and the valve, and cleaning the Tool with about 300mL of pure water;

3) turning off the Vacuum pump and valve, placing the Vacuum Prep Tool on the side, and drying at room temperature;

4) cleaning all plastic tanks containing reagent solution, and naturally drying;

5) the surface of the purification equipment was wiped with a damp cloth.

3.3 Pyrophosphoric acid sequencing

1) Calling out a set running program file, clicking a pull-down key of View, selecting Run, automatically calculating the use amount of each reagent in the experiment according to software, and adding each reagent component to a reagent sample adding bin;

2) placing the prepared sample and the reagent cabin into corresponding positions of the instrument, and clicking the 'Run' at the right lower end of the screen to start pyrosequencing;

3) after the detection is finished, firstly clicking a close key of a software process state window to store a sequencing result;

3.4 pyrosequencing results analysis

1) Double-clicking a mouse in an SQA Runs folder, opening the running file, selecting an SQA mode, clicking an Analyze All key, and analyzing All detection samples;

2) reading the base sequence of each detection sample, and performing alignment analysis in online GeneBank to determine the genus type of the detected sample, as shown in FIGS. 2 and 3.

In conclusion, the target sequence selected by the invention and the kit applying the invention can realize rapid, simple, accurate, efficient, practical and economic detection of common clinical pathogenic bacteria and difficult bacteria, can meet the requirements of clinical examination on actual work, are beneficial to clinical bacterial infection patients to prepare and reasonably provide guidance for antibacterial treatment, further avoid abuse of antibiotics, save precious treatment time for the patients and improve the life quality of the patients.

SEQUENCE LISTING

<110> Hangzhou Dian medical inspection center, Inc

<120> kit for detecting clinically common pathogenic bacteria by combining TMA (mechanical analysis) melting curve method and pyrosequencing technology and application thereof

<210>1

<211>22

<212>DNA

<213> primer F1

<400>1

gaagagtttg atcatggctc ag 22

<210>2

<211>51

<212>DNA

<213> primer R1

<400>2

aattctaata cgactcacta tagggagaag gttactcacc cgtccgccac t 51

<210>3

<211>20

<212>DNA

<213> primer F2

<400>3

gcaacgcgaa gaaccttacc 20

<210>4

<211>51

<212>DNA

<213> primer R2

<400>4

aattctaata cgactcacta tagggagaag gacgacagcc atgcagcacc t 51

<210>5

<211>52

<212>DNA

<213> molecular Beacon Probe P1

<400>5

gcgcggccta atacatgcaa gtcgagcgaa cggacgggga gcttgcccgc gc 52

<210>6

<211>48

<212>DNA

<213> molecular Beacon Probe P2

<400>6

Gcccgttaga gatagaggct tcaccttcgg aggacaatgt gaacgggc 48

<210>7

<211>54

<212>DNA

<213> molecular Beacon Probe P3

<400>7

cgcgcgggcc gaacacaaaa agttaagctt cttagcgccg attgtagccg cgcg 54

<210>8

<211>20

<212>DNA

<213> sequencing primer

<400>8

ttactcacccgtccgccact 20

Claims

The primer and the probe for detecting the clinically common pathogenic bacteria by combining the TMA melting curve method with the pyrosequencing technology are characterized by comprising the following sequences:

(1) TMA reaction primers: the nucleotide sequence is shown in SEQ ID NO. 1-4;

(2) molecular beacon probe: the nucleotide sequence is shown in SEQ ID NO. 5-7;

(3) sequencing primer: the nucleotide sequence is shown as SEQ ID NO. 8;

the 5' ends of SEQ ID NO.1 and SEQ ID NO.3 are marked with biotin;

the 5 'end of SEQ ID NO.5 is marked with a fluorescence reporter group CY5, and the 3' end is marked with a fluorescence quenching group DABCYL;

the 5 'end of SEQ ID NO.6 is marked with a fluorescence reporter group HEX, and the 3' end is marked with a fluorescence quenching group DABCYL;

the 5 'end of SEQ ID NO.7 is marked with a fluorescence reporter group FAM, and the 3' end is marked with a fluorescence quencher group DABCYL.
The kit for detecting the clinically common pathogenic bacteria by combining the TMA melting curve method and the pyrosequencing method is characterized by comprising the following steps: the kit comprises an RNA extraction reagent, a 2 xTMA reaction solution, a 5 xenzyme mixed solution, a single-strand purification reagent, a sequencing reagent, the TMA reaction primer, the molecular beacon probe and the sequencing primer of claim 1.
3. The kit for detecting clinically common pathogenic bacteria by using TMA melting curve method combined with pyrosequencing method according to claim 2, wherein the RNA extraction reagent comprises: lysis solution, washing solution I, washing solution II and eluent TE;

the lysis solution comprises the following components: 2-8M of guanidine salt, 50-200 mM Tris and 0.5-10% of surfactant in volume percentage, wherein the guanidine salt is guanidine isothiocyanate or guanidine hydrochloride, and the surfactant is Tween 20, NP40 or Triton X-100;

the washing solution I comprises the following components: 2-6M of guanidine salt, 50-200 mM Tris and 0.5-10% of surfactant in volume percentage, wherein the guanidine salt is guanidine isothiocyanate or guanidine hydrochloride, and the surfactant is Tween 20, NP40 or Triton X-100;

the washing liquid II comprises the following components: 10-100 mM Tris, 20-100 mM EDTA, 65-80% ethanol by volume percentage;

the eluent TE comprises the following components: 10mM Tris, 1mM EDTA, pH 8.0.
4. The kit for detecting clinically common pathogenic bacteria by using the TMA melting curve method in combination with the pyrosequencing method according to claim 2, wherein the 2 XTMA reaction solution comprises: 0.4-1 μ M of oligonucleotides represented by SEQ ID NO. 1-4, 0.05-0.5 μ M of 3 molecular beacon probe, 80mM Tris-HCl, 24mM MgCl₂140mM KCl, 2mM dNTPs, 4mM NTPs and 30% (V/V) dimethyl sulfoxide.
5. The kit for detecting clinically common pathogenic bacteria by using the TMA melting curve method and the pyrosequencing method in combination according to claim 2, wherein the 5 x enzyme mixture solution comprises: 200U M-MLV, 1000U T7RNA Pol and 105. mu.g BSA;

the single-stranded purification reagent comprises: 75% (v/v) ethanol solution, 0.2M NaOH, 10mM Tris (hydroxymethyl) aminomethane acetate solution pH 7.6, binding buffer, annealing buffer, streptavidin-coated magnetic beads;

the sequencing reagent comprises: DNA polymerase, ATP sulfurylase, luciferase, apyrase, substrate APS, luciferin and dNTP.