CN105087517B - A method of recombination multienzyme complex and the seamless clone of external homologous recombination - Google Patents
A method of recombination multienzyme complex and the seamless clone of external homologous recombination Download PDFInfo
- Publication number
- CN105087517B CN105087517B CN201510507988.5A CN201510507988A CN105087517B CN 105087517 B CN105087517 B CN 105087517B CN 201510507988 A CN201510507988 A CN 201510507988A CN 105087517 B CN105087517 B CN 105087517B
- Authority
- CN
- China
- Prior art keywords
- recombination
- clone
- cloning vector
- homologous recombination
- pcr product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a kind of recombination multienzyme complex, which derives from Escherichia coli Rec homologous recombination enzyme, including RecE, RecT and Gamma albumen.The present invention also provides the methods of external seamless clone of homologous recombination a kind of, both ends only need to be had to the PCR product of carrier end sequence and linearisation cloning vector is mixed in a certain ratio, under the catalysis of the recombination multienzyme complex, expeditiously by any site of target dna directed cloning to any carrier, cloning positive rate may be up to 95% or more.Method of the invention is particularly suitable for the clone of DNA large fragment.The present invention compensates for the defects of conventional cloning methods are cumbersome, time-consuming, failure rate is higher, a kind of efficient cloning process of rapid and convenient can be provided for DNA vitro recombination, Cytological Basis research and industrial and agricultural production, in terms of establish important basis.
Description
Technical field
The present invention relates to the DNA recombinant techniques in molecular biology, and in particular to be a kind of external homologous recombination
Cloned nucleic acid molecule method and a kind of recombination multienzyme complex.
Background technique
Modern biology research will largely depend on recombinant DNA technology.The DNA recombination occurred into the cell is existing
As referred to as In vivo recombination.Due to the development of new technology, it now is possible to extracellularly carry out DNA recombination, referred to as body by manual operation
Outer recombination.
It is structure, function and the basis of evolution for studying gene by the clone that the recombination of DNA obtains gene.Gene cloning
Technology, the molecule clone technology that is otherwise known as, recombinant DNA technology, genetic engineering, genetic manipulation or vegetative propagation of gene etc..?
During whole gene is cloned, reconfiguring for DNA be a very crucial step, it, which directly decides, entirely clones
Success or not.Over time, research is goed deep into, and more and more DNA recombination methods are applied to production and scientific research is worked as
In.
Traditional digestion-connection classics cloning process results from the early 1970s, being the gene cloning applied earliest
Method is more common and common method, uses till today always.But in actual experimentation, the step of this method
Suddenly seem relatively complicated time-consuming, need that different restriction endonucleases is selected to use according to cloned gene sequence, higher cost.And part is rich
Gene cloning Chang Yin failure without suitable restriction enzyme site containing special palindromic sequence.
Therefore one kind efficiently quick vitro recombination clone technology easy to operate is developed to substitute traditional digestion connection side
Method is of great significance.
Summary of the invention
To achieve the above object, the present invention provides a kind of recombination multienzyme complex, which derives from large intestine
Bacillus Rec homologous recombination enzyme, including RecE, RecT and Gamma albumen, the wherein NCBI Gene ID of Gamma albumen:
8183641。
Further, the content ratio of three kinds of recombinases of RecE, RecT and Gamma albumen is 1:1:2.
The present invention also provides the methods of external seamless clone of homologous recombination a kind of, method includes the following steps:
Step 1: preparation linearisation cloning vector；
Step 2: preparing Insert Fragment PCR product, by holding the end for introducing the linearisation cloning vector same in primer 5 '
Source sequence, so that 5 ' ends of the Insert Fragment PCR product are respectively provided with 3 ' ends and two ends pair of the linearisation cloning vector
The completely the same sequence answered；
Step 3: the Insert Fragment PCR product that will be obtained in the linearisation cloning vector obtained in step 1 and step 2
Recombining reaction is carried out under the action of the recombination multienzyme complex；
Step 4: the recombinant products obtained in step 3 are subjected to cell transformation, obtain transformed cells；
Step 5: the transformed cells obtained in step 4 are cultivated, and carry out clone identification, are obtained through clone identification
For positive recombinant DNA molecules.
Further, in step 1, which is obtained by digestion with restriction enzyme or Inverse PCR amplification
?.
Further, digestion with restriction enzyme is single endonuclease digestion or double digestion.
When further, using the method for Inverse PCR amplification, using exo+ polymerase to the cloning vector linearized in advance
It is expanded.
Further, in step 2, the design method of primer is as follows:
Positive amplimer design method:
5 '-upstream vector terminal homologous sequences+gene specific forward direction extension increasing sequence -3 '；
Reversed amplimer design method:
The reversed extension increasing sequence of 3 '-gene specifics+downstream vector terminal homologous sequence -5 '.
Further, the length of homologous sequence is 15bp~20bp in primer.Bp means base-pair, for indicating DNA points
The length of son.
Further, in step 3, when Insert Fragment PCR product is more than or equal to 5kb, linearisation cloning vector and insertion
Fragment PCR products molar ratio is 1:10.Kb means kilobase pair, for indicating the length of DNA molecular.
Further, in step 3, when Insert Fragment PCR product is less than or equal to 2kb, linearisation cloning vector and insertion
Fragment PCR products molar ratio is 1:2.
According to above-mentioned steps, the plasmid identification extracted after PCR positive bacterium colony culture, it was demonstrated that target dna in the present invention
Under the catalysis of the recombination multienzyme complex, in vitro can simple and direct efficiently directed cloning into required carrier.It is so-called simple and direct efficient
Refer under the catalysis of recombination multienzyme complex, it is only necessary to which reacting 30 minutes can be converted, and directed cloning is completed, and clone positive rate
Up to 95% or more.Recombination multienzyme complex in the present invention is determined according to lot of documents support first completes reconstruction experiment needs
The functional activity having, then the organized enzyme of screening experiment corresponding function, then determined by a large amount of functional verifications from function and
All meet the organized enzyme of long-range exploitation in expression cost.The ratio of enzyme is to realize respective function by various enzymes in recombination multienzyme complex
The basic dosage of energy, and on this basis by a large amount of similar proportions parallel laboratory test, to determine optimization system.The present invention is more
The defects of conventional cloning methods are cumbersome, time-consuming, failure rate is higher is mended.Meaning of the present invention is can be external for DNA
Recombination provides a kind of efficient cloning process of rapid and convenient, in the side such as Cytological Basis research and industrial and agricultural production, medicines and health protection
Establish important basis in face.
Detailed description of the invention
Fig. 1 is the flow diagram of the method for the seamless clone of external homologous recombination in the present invention；
Fig. 2 is the DNA electrophoretogram result that bacterium colony PCR verifying is carried out in a preferred embodiment of the invention.
Specific embodiment
The method of the seamless clone of external homologous recombination in the present invention the following steps are included:
Step 1: preparation linearisation cloning vector
Step 2: Insert Fragment PCR product is prepared
Step 3: recombining reaction
Step 4: recombinant products conversion
Step 5: clone identification
Linearized vector in step 1 can include single endonuclease digestion or double digestion by digestion with restriction enzyme, or reversed
PCR amplification obtains.
1. digestion preparation linearisation cloning vector
Using double digestion, completely, conversion background, that is, false positive clones are low for linearisation.
2. Inverse PCR amplification preparation linearisation cloning vector
When that can not prepare by PCR to cloned sequence there are a large amount of repetitive sequences, exo+ polymerase pair can be passed through
The plasmid vector linearized in advance is expanded, and both ends are added to cloned sequence homologous fragment, if PCR product electrophoretic band is single,
Amplified production may not need purifying and be directly used in recombining reaction.
Cloning vector digestion products or pcr amplification product DNA purity are lower and be possible to containing not linearizing cyclic plasmid,
When directly using recombining reaction is carried out, recombination efficiency, clone's positive rate can all decrease.Therefore, larger segment example is being carried out
When being such as larger than equal to the clone of 5kb, it is recommended to use the kit of high quality carries out glue recovery purifying to linearisation cloning vector, with
It improves DNA purity and removes the circular vectors that a part does not linearize (its electrophoresis position is different from linearisation cloning vector).No
The usage mode of the linearisation cloning vector prepared with mode can consult table 1.
Table 1: the usage mode of cloning vector is linearized
The preparation of Insert Fragment PCR product includes design of primers and PCR amplification in step 2.
1. designing amplimer
The total principle of design of primers is: linearisation cloning vector terminal homologous sequence is introduced by holding in primer 5 ', so that
5 ' and 3 ' least significant end of Insert Fragment amplified production is respectively provided with and linearizes the corresponding completely the same sequence in two end of cloning vector
Column, the length is 15bp~20bp.
Positive amplimer design method:
5 '-upstream vector terminal homologous sequences+gene specific forward direction extension increasing sequence -3 '
Reversed amplimer design method:
The reversed extension increasing sequence of 3 '-gene specifics+downstream vector terminal homologous sequence -5 '
Gene specific is positive/negative positive/negative to amplimer sequence to the i.e. conventional Insert Fragment of extension increasing sequence；
Upstream/downstream carrier end homologous sequence is linearisation cloning vector most end terminal sequence (being used for homologous recombination).
2. Insert Fragment PCR amplification
Insert Fragment is recommended to use exo+ polymerase and is expanded, to reduce the introducing of amplification mutation.Without considering to produce
Object end will be removed in regrouping process, and be not in final carrier whether there is or not A tail.
After PCR, a small amount of product is taken to carry out agarose electrophoresis to examine amplification yield and specificity.Recombining reaction system
Compatible conventional PCR reaction system.Therefore, if amplification template is not cyclic plasmid identical with cloning vector resistance, and PCR product
Electrophoretic band is single, and amplified production may not need purifying and be directly used in recombining reaction.
Pcr amplification product DNA purity is lower, and when directly using progress recombining reaction, recombination efficiency, clone's positive rate all can
It decreases.Therefore, when carrying out the cloning experimentation of the larger segment more than or equal to 5kb, it is recommended to use the kit of high quality
Glue recovery purifying is carried out to improve DNA purity to amplified production.The usage mode of Insert Fragment amplified production can consult table 2.
Table 2: amplified production is recommended to use mode
It include preparing reaction system and recombining reaction in step 3.
1. being formulated as follows reaction system in ice-water bath.If liquid is sticked to tube wall accidentally, can be made by of short duration centrifugation
It sinks to tube bottom.
The ratio between recombination multienzyme complex RecE, RecT and Gamma albumen used in recombining reaction system is 1:1:2 (name
For HieffClone Enzyme)；Most suitable cloning vector usage amount is 0.03pmol；Most suitable cloning vector and Insert Fragment mole
Than for 1:2, i.e., most suitable Insert Fragment usage amount is 0.06pmol.The corresponding DNA mass of these molal quantitys can be thick by following formula
Approximation, which is calculated, to be obtained:
Most suitable cloning vector usage amount=[0.02 × cloning vector base logarithm] ng (0.03pmol)
Most suitable Insert Fragment usage amount=[0.04 × Insert Fragment base logarithm] ng (0.06pmol)
2. recombining reaction
1) it after the completion of system is prepared, is gently blown and beaten up and down with pipettor and mixes each component several times, avoid generating bubble, it is not acute
Violent shock swings or is vortexed mixing.
2) 37 DEG C of reaction 30min are placed in.
3) to after the reaction was completed, reaction tube is placed in ice-water bath cooling 5min immediately.
4) reaction product can be converted directly；- 20 DEG C can also be stored in, conversion of thawing when needed.
The conversion of recombinant products and coated plate include following four step in step 4
1) the cooling reaction solution of 10 μ l is taken, is added in 100 μ l competent cells, is flicked and mixed under tube wall number, put on ice
Set 30min.
2) 42 DEG C heat shock 45~90 seconds, ice-water bath are incubated for 2min.
3) 450 μ l SOC or LB culture mediums are added, 37 DEG C of incubation 10min sufficiently recover.37 DEG C are shaken bacterium 45min.
4) 100 μ l bacterium solutions is taken to be uniformly coated on the plate containing appropriate antibiotic.Plate is inverted, in 37 DEG C of trainings overnight
It supports.
Efficiently method is bacterium colony PCR to the most convenient of clone identification in step 5.
Single bacterium colony is chosen into 20~50 μ l LB culture mediums with sterile pipette tips or toothpick and is mixed, 1 μ l conduct is directly taken
Pcr template.Recommendation at least carries out bacterium colony PCR with a universal sequencing primer object, in this way can be to avoid the generation of PCR false positive.
The remaining bacterium solution of PCR positive bacterium colony is seeded to overnight incubation in the LB culture medium containing appropriate antibiotic, is extracted
Plasmid does subsequent identification.
According to above-mentioned steps, the plasmid identification extracted after PCR positive bacterium colony culture, it was demonstrated that target dna in the present invention
Under the catalysis of the recombination multienzyme complex added with unique recombination enhancement factor, in vitro can simple and direct efficiently directed cloning to institute
It needs in carrier.
Elaborate below to the embodiment of the present invention: the present embodiment carries out under the premise of the technical scheme of the present invention
Implement, gives detailed embodiment and process, but protection scope of the present invention is not limited to following embodiments.
Embodiment: effect protein BepC construction of eukaryon expression plasmid for expressing
The nucleic acid sequence of BepC albumen are as follows:
ATGTTAGAGCATAATTATTTTTATAAAAACAGCGCAACACTGAAGAATAAACATGGCATAAAAAACCCG
CGAAAACTGTATGAACGCTGTGCTCATGAGACAGCCAGAGAGGCTGTAAATTTTCGCCTTGAACCGCCACCAGGGAA
ATTTGATGCCGCTTATCTAAGGACAATTCACTGGTGCCTTTTCCATAAAACTTTTGAATGGGCCGGTGTTACCCGAG
ATCAGCCCTTTACATTTGAAGATGGCAGCACTGCATGTATGCCAGCTATGCGACCAAAAGGTTATAAGGTTCCTTTT
GCTGTCGGTTCACAAATTCAAAGAGAGCTTAAAAAATTAGAACAAAGACTAACCGCGAAGAATAATTTACAAGGCTT
ATCGCGCCAAGAATTTGCTGCAAATGCTGCTGAAGTTTTTACAGCTCTCGACCACGCGCATCCTTTCAGAAAAGGCA
ATGGGCGCACACAACGAATGTTTATGGAAAAACTCGGACAAGCGGCAGGCTATAAGATTGATTTTTCTTTGATCACA
AAAGAACGCATGACATATGCCAGCATTGAAGCAATGCAACATAACAATCCAGAACCCATGAAAGATCTTTTTGAGGA
TATCACTCACCCTCAAAAATCCCTTCTTTTAAAGGAATTTATCTCTCAGATGAGAAGCGCTAGACTTGATGAAATTA
ACAATCATATTGTTTTGGCAGCAAAAGAAGGTGTGACCTATGATGGCATTTATAAAGGTTCTTCAGCTGAAGGTTTT
GTTATAGAAGTAGAAGGTGGCACTTTCATCGTCGGGCACAAAGATGATCTTAAGCCAGAGCAAGTGAAAATATTACA
GAATGGTGATTTCATCTCCTTTCAGAAAAACAATGTTCAAAACATGAGAGAAACACTTATCCCAAGCGAGATATTAG
CGCCTCTCACCAATGAGATCCTTGCCGAAAGGCTCGTAAACCATTGTGGGGTTGAATCATACCGCCATGAAGTCGAG
TGTTTATCAAAAATTGTTTATGGCAACACACAAGCATTAAGCCAAATGATTGAGACAATCAACATAGATCCAAGTTT
AGGCGAACAGTTTGTCGATCACATTATCCAAAATCCTAAATCAGTTGGTAAGCTTGCCGGGAAAAAAATCCTGGGTC
TAAGAAGCCCAGCGCGCAAACGTGCGGAAGAAACTGTTTCACAGCTTAGTGACACACTTAAAAGTTATGCCGATATA
GCACATCAGACCATGGCTGACATCATAGAGCAACACTCAAAAGAACAAAGACGCACAGCGCGCTCTGTCGAAAATCC
CGGGAAAGACTTGCAAAACCTTTTTGCCTTGTTCCCAGAACAACAAAGAGAAGCCTTGTCTCATTCCCCTACGCTGC
AACAACAACTCCATCGTTTTTCGCGTCAATTGCAAAATCGTTTATCATCAGAGGAGCGTCGAGCCATACAAGAAAAC
GATTGCACAAGACTTTCTTGTCTGCTTGGTGTATCGGCAAGCAAAGCAAAAGACATTGCTCAAATTGTGAAGCATAC
CAAAGAGGCACAATGTCAGATGCGTACCCTTAAAGTCTGCCGCTCCGCATCGATGGCTCTGACCAGCTAA
Expression plasmid is pCDNA4.0/TO-Strep, and multiple cloning sites are classified as through BamH1 and Xho1 double digestion postorder:
GCGAGCTCGGTACCAAGCTTAAG*********CGCCCAAATTTGCCCGGGAGCT
Wherein * * * * * * * * * represents plasmid backbone sequence.
The PCR primer designed according to Homology-based cloning are as follows: (underscore part represents homologous overlay region)
Upstream: 5 'AACCATGGCTCGAGCGGATCC ATGTTAGAGCATAATTATT 3’
Downstream: 5 'GGGTTTAAACGGGCCCTCGAG GCTGGTCAGAGCCATCGATGC 3’
PCR condition: 95 DEG C initial denaturation 5 minutes, it is subsequent 32 circulation: 95 DEG C 30 seconds, 56 DEG C 40 seconds, 72 DEG C 30 seconds, finally prolong
It stretches 5 minutes.Product is quantitative after gel extraction, and PCR product is mixed with linearized vector according to molar ratio 2:1.?
4 μ l buffers and 2 μ l recombinases are added in 20ul total volume, 37 degree are incubated for 30 minutes, and 100 μ l then are added in 10 μ l reaction solutions
In competent cell, chemical conversion is carried out.10 clones of random picking carry out bacterium colony PCR verifying after 16 hours, and primer is same as above, and tie
Fruit is as shown in Figure 2: 10 clones of picking have been successively inserted into cloned sequence.
The preferred embodiment of the present invention has been described in detail above.It should be appreciated that the ordinary skill of this field is without wound
The property made labour, which according to the present invention can conceive, makes many modifications and variations.Therefore, all technician in the art
Pass through the available technology of logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea
Scheme, all should be within the scope of protection determined by the claims.
Claims (5)
1. the method for the seamless clone of the outer homologous recombination of microbial body a kind of, which is characterized in that the described method comprises the following steps:
Step 1: preparation linearisation cloning vector；
Step 2: preparing Insert Fragment PCR product, by the terminal homologous for introducing the linearisation cloning vector at the end of primer 5 '
Sequence the, so that 5 ' ends and 3 ' ends of the Insert Fragment PCR product are respectively provided with and described two ends of linearisation cloning vector
Corresponding completely the same sequence, wherein the length of PCR product terminal homologous sequence is 15bp-20bp；
Step 3: the Insert Fragment PCR that will be obtained in the linearisation cloning vector obtained in step 1 and step 2
Product carries out recombining reaction under the action of recombinating multienzyme complex, and recombination multienzyme complex derives from Escherichia coli Rec homologous recombination
Enzyme, the recombination multienzyme complex include RecE, RecT and Gamma albumen, the RecE, the RecT and the Gamma albumen
The content ratio of three kinds of recombinases is 1:1:2；When the Insert Fragment PCR product is more than or equal to 5kb, the linearisation clone
Carrier and the Insert Fragment PCR product molar ratio are 1:10；It is described when the Insert Fragment PCR product is less than or equal to 2kb
It linearizes cloning vector and the Insert Fragment PCR product molar ratio is 1:2；
Step 4: the recombinant products obtained in step 3 are subjected to cell transformation, obtain transformed cells；
Step 5: the transformed cells obtained in step 4 are cultivated, and carry out clone identification, are obtained through the clone
It is accredited as positive recombinant DNA molecules.
2. the method for the seamless clone of the outer homologous recombination of microbial body according to claim 1, which is characterized in that the step
In one, the linearisation cloning vector is obtained by digestion with restriction enzyme or Inverse PCR amplification.
3. the method for the seamless clone of the outer homologous recombination of microbial body according to claim 2, which is characterized in that the limitation
Property endonuclease digestion is single endonuclease digestion or double digestion.
4. the method for the seamless clone of the outer homologous recombination of microbial body according to claim 2, which is characterized in that described in use
When the method for Inverse PCR amplification, the cloning vector linearized in advance is expanded using exo+ polymerase.
5. the method for the seamless clone of the outer homologous recombination of microbial body according to claim 1, which is characterized in that the step
In two, the design method of the primer is as follows:
Positive amplimer design method:
5 '-upstream vector terminal homologous sequences+gene specific forward direction extension increasing sequence -3 '；
Reversed amplimer design method:
The reversed extension increasing sequence of 3 '-gene specifics+downstream vector terminal homologous sequence -5 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510507988.5A CN105087517B (en) | 2015-08-18 | 2015-08-18 | A method of recombination multienzyme complex and the seamless clone of external homologous recombination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510507988.5A CN105087517B (en) | 2015-08-18 | 2015-08-18 | A method of recombination multienzyme complex and the seamless clone of external homologous recombination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087517A CN105087517A (en) | 2015-11-25 |
| CN105087517B true CN105087517B (en) | 2019-05-07 |
Family
ID=54568852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510507988.5A Active CN105087517B (en) | 2015-08-18 | 2015-08-18 | A method of recombination multienzyme complex and the seamless clone of external homologous recombination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087517B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119222A (en) * | 2016-07-04 | 2016-11-16 | 翌圣生物科技（上海）有限公司 | A kind of protease composition for external homologous recombination, test kit and method |
| CN111321160A (en) * | 2018-12-17 | 2020-06-23 | 中国科学院深圳先进技术研究院 | Rapid cloning method based on reverse amplification full-length plasmid and In-fusion connection |
| CN111850022A (en) * | 2020-07-02 | 2020-10-30 | 南京农业大学 | Method for quickly adding or replacing protein tag of target gene |
| CN114015690A (en) * | 2021-11-08 | 2022-02-08 | 南阳师范学院 | Construction method and application of bombyx mori shRNA expression vector |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPP684998A0 (en) * | 1998-10-30 | 1998-11-26 | Murdoch Institute for Research into Birth Defects Limited, The | A method of recombination and agents useful for same |
-
2015
- 2015-08-18 CN CN201510507988.5A patent/CN105087517B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| Evaluation of seamless ligation cloning extract preparation methods from an Escherichia coli laboratory strain;Yuki Okegawa, Ken Motohashi;《Analytical Biochemistry》;20150629;第486卷(第1期);第51页左栏 |
| Red/ET系统研究进展及在微生物研究中的应用;徐飞等;《药物生物技术》;20071231;第14卷(第3期);第222页、摘要 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087517A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | Influenza A virus molecular virology techniques | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| CN105087517B (en) | A method of recombination multienzyme complex and the seamless clone of external homologous recombination | |
| CN102703424B (en) | A kind of method of genome of E.coli point mutation of recombined engineering mediation | |
| CN107922931A (en) | Heat-staple Cas9 nucleases | |
| CN107488725A (en) | Library method for building up and its application suitable for the sequencing of unicellular genomic methylation | |
| CN108486139A (en) | A kind of site-directed point mutation method and its application based on seamless clone technology | |
| CN106947766A (en) | A kind of bacillus subtilis has DNA fragmentation and its application of promoter function | |
| WO2023098492A1 (en) | Sequencing library construction method and application | |
| Wang et al. | Protocol to access unknown flanking DNA sequences using wristwatch-PCR for genome-walking | |
| WO2024041641A1 (en) | Multi-fragmented polya polynucleotide stably existing in host cell and use thereof | |
| CN105969784A (en) | Recombinase-independent DNA (deoxyribonucleic acid) seamless cloning method | |
| CN103397028B (en) | Semi-random primer based on PCR walking technology, and kit thereof | |
| CN114990093B (en) | Protein sequence MINI RFX-CAS13D with small amino acid sequence | |
| CN111004813A (en) | Super-large plasmid construction kit, super-large plasmid construction method and application thereof | |
| CN108486140A (en) | A kind of cloning vector preparation method and kit based on seamless clone technology | |
| Grozdanov et al. | Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1α promoter using Gibson assembly | |
| CN104293962B (en) | Method for screening general primers | |
| Gu et al. | pYEMF, a pUC18-derived Xcm I T-vector for efficient cloning of PCR products | |
| CN111394379B (en) | Site-directed mutagenesis method of large vector DNA (deoxyribonucleic acid) based on recombinase and super-fidelity DNA polymerase | |
| CN103540587B (en) | Targeted integration exogenous DNA array is to the method in rat and mouse Rosa26 site and application thereof | |
| CN116135982A (en) | Application method and kit for gene fragment ligation | |
| Yang et al. | Construction of DNA Barcode-Tagged Salmonella Strains | |
| CN111434771A (en) | Plasmid construction method for self-recombination of linearized vector | |
| CN109371007A (en) | A kind of fast and convenient method for synthesizing gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201203 room 504, No. 781 Cailun Road, Zhangjiang High Tech Park, Pudong New Area, Shanghai Patentee after: Yisheng Biotechnology (Shanghai) Co.,Ltd. Address before: 201203 room 504, No. 781 Cailun Road, Zhangjiang High Tech Park, Pudong New Area, Shanghai Patentee before: YEASEN BIOLOGICAL TECHNOLOGY (SHANGHAI) Co.,Ltd. |