CN107177693B - Multiple PCR amplification method - Google Patents
Multiple PCR amplification method Download PDFInfo
- Publication number
- CN107177693B CN107177693B CN201710591161.6A CN201710591161A CN107177693B CN 107177693 B CN107177693 B CN 107177693B CN 201710591161 A CN201710591161 A CN 201710591161A CN 107177693 B CN107177693 B CN 107177693B
- Authority
- CN
- China
- Prior art keywords
- primer
- amplification
- primers
- universal
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a multiple PCR amplification method, namely a pair of multiple primers (with low concentration) which are composed of a plurality of same sequences and have the same 5' ends as common primers and a pair of common primers (with high concentration) are used for amplification in the same PCR reaction, and DNA polymerase used in the amplification is heat-resistant polymerase with strand displacement effect. The multiple primer sequence comprises two parts, namely, the 3 'end is complementary with the target gene, and the 5' end carries at least 1 sequence which is identical with the universal primer. The number of the universal primers carried by the 5' ends of the upstream and downstream multiple primers is the same or different, and the sequences of the upstream and downstream universal primers can also be the same or different. The method simultaneously produces a plurality of amplification products in one cycle, and each amplification product contains at least one upstream and one downstream universal primer sequence in addition to the target amplification sequence. The invention can generate more than twice amplification products by one cycle, so the invention can obviously improve the amplification efficiency and the detection sensitivity of PCR, and is suitable for being used as a conventional molecular biology laboratory means and a medical nucleic acid detection means for detecting the low template number gene.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a multiple PCR amplification method.
Background
As a method for rapidly amplifying a specific gene in vitro, the PCR technology has been widely applied to various fields due to its advantages such as high specificity and sensitivity. The key of the PCR method is to design a pair of oligonucleotide primers with high stringency according to the target gene, and realize rapid amplification through DNA polymerase enzymatic reaction.
Since the invention of PCR technology, although various improvements and derivatives have been developed, they have not broken through the basic model that each target gene is amplified by a pair of primers complementary to the template. Conventional PCR uses a pair of primers for amplification, and can only produce twice as many amplification products per cycle, so that the amplification efficiency is limited.
Disclosure of Invention
The invention aims to provide a multiple PCR amplification method to break through the limit that at most two times of amplification products can be generated in each cycle in the prior art, thereby improving the amplification efficiency of PCR and shortening the PCR reaction time.
The multiplex PCR amplification method of the invention comprises performing the amplification in a reaction mixture comprising a pair of multiplex primers and a pair of universal primers, and replacing a conventional DNA polymerase with a strand-displacement thermostable DNA polymerase. Priming the PCR with a lower concentration of the polyploid primer in the first few cycles, producing a first amplification product comprising the universal primer sequence; and (3) amplifying the PCR by using the first amplification product as a template and using a universal primer with higher concentration under the action of heat-resistant DNA polymerase with the chain replacement function. For the target gene, more than twice of amplification products can be generated in one cycle, so that the amplification efficiency of PCR is improved, and the amplification time of PCR is shortened.
In a first aspect of the present invention, a multiple PCR amplification method is provided, which comprises performing a first amplification round using a pair of specific sequences complementary to a target gene at their 3 'ends and a multiple primer consisting of a plurality of universal sequences at their 5' ends to generate a first amplification product comprising the universal primer sequences; using the first amplified product as template, under the action of heat-resisting DNA polymerase with chain replacement action utilizing general primer to implement second amplification to produce several amplified products carrying target gene sequence; wherein the multiple primers and the universal primer are added simultaneously, and the reaction is carried out under the condition of the same annealing temperature.
In a second aspect, the invention provides a primer design for multiple PCR amplification, comprising multiple primers and universal primers.
The concentration of the polyploid primer is 5-100 nM; the 3' end of the multiple primer is completely complementary with the target gene sequence, the sequence can be designed by primer software, the high stringency of the common excellent primer is met, and the sequence length is 10-30 bases; the 5' end comprises at least one sequence which is completely identical with the universal primer, and the sequences can be connected by using bases; the number of bases of the multiple primers forming the hairpin structure should be as low as possible, and the total complementary bases should be as low as possible.
The number of universal primers contained in the upstream and downstream sequences of the multiple primers is the same or different, but the total number of the universal primer sequences contained in the upstream and downstream multiple primers in one system is at least 3.
The concentrations of the universal primers are respectively l-10 mu M; the general primer sequence is irrelevant to the target gene sequence, and the design is completely independent of the detected gene; the length of the substance sequence is 10-30 bases; the annealing temperature of the universal primer and the annealing temperature of the specific sequence at the 3' end of the multiple primer are different by no more than 4 ℃; the sequences of the upstream and downstream universal primers may be the same or different.
The multiple primers and the universal primers are mixed with other PCR reaction reagents, two rounds of PCR amplification are carried out at the same annealing temperature, the multiple primers with lower concentration are completed in the first few cycles of the reaction, and the universal primers cannot play a role completely because the sequences of the universal primers are not matched with target genes.
The multiple PCR amplification method of the invention has many advantages over the conventional PCR method:
firstly, the use of multiple primers with lower concentration improves the stringency of the reaction, and is beneficial to reducing or eliminating primer dimers and non-specific amplification products;
secondly, the melting temperature of the specific sequence of the multiple primers is similar to that of the universal primer, so that the multiple primers and the universal primer react at the same annealing temperature, and the heterogeneity of amplification efficiency caused by different melting temperatures, combination efficiencies and the like of the primers is avoided;
third, the sequence of the universal primer is designed independently of the target template sequence and has high stringency. The high-concentration universal primer prolongs the linear accumulation period of the amplification product of the multiple PCR, and is beneficial to improving the detection sensitivity and shortening the amplification time.
Drawings
The invention is further described below with reference to the accompanying drawings.
FIG. 1 is a schematic diagram of the multiplex PCR amplification method of the present invention. In the figure, Fm and Rm are respectively an upstream multi-primer and a downstream multi-primer, and FUP and RUP are respectively an upstream universal primer and a downstream universal primer.
FIGS. 2A and 2B are schematic diagrams of the primers of the present invention. In the figure, 101 is an upstream specific primer, 102 is a connecting base, 103 is an upstream universal primer, 104 is a downstream specific primer, 105 is a connecting base, and 106 is a downstream universal primer.
FIGS. 3A and 3B are amplification electrophoretograms using 2-fold primers and 3-fold primers, respectively, in example 1. M is a 50bp DNA molecular standard.
FIG. 4 shows the specificity of real-time fluorescent multiplex PCR in example 2 of the present invention.
Detailed Description
As shown in FIG. 1, the present invention provides a multiplex PCR amplification method in which a pair of multiplex primers (low concentration) and a pair of universal primers (high concentration) are amplified in the same PCR reaction, and DNA polymerase used in the amplification is thermostable polymerase having strand displacement action. In the first few cycles of the PCR reaction, the 3 'end of the multiple primer binds specifically to the target gene, and as the polymerase extends, a complete double-stranded DNA with the 5' end sequence is generated. Amplification is accomplished by the universal primers in subsequent PCR cycles, and the strands formed by the outer primers displace the inner strands as they are extended by the polymerase chain displacement action, thus producing a plurality of amplification products after each cycle, each amplification product containing at least one upstream and one downstream universal primer sequence in addition to the target amplification sequence. Fm and Rm are respectively an upstream multi-primer and a downstream multi-primer, and FUP and RUP are respectively an upstream universal primer and a downstream universal primer.
As shown in FIG. 2A and FIG. 2B, the design of the upstream multiple primer is composed of two parts, namely, a target gene specific primer sequence 101 at the 3 'end and an upstream universal primer sequence 103 at the 5' end, which are connected by a connecting base 102; the downstream multiple primer design also consists of two parts, namely a target gene specific primer sequence 104 at the 3 'end and an upstream universal primer sequence 106 at the 5' end, which are connected by a connecting base 105. The universal primer sequences at the 5' ends of the upstream and downstream multiple primers can be the same or different, and the number of the universal primers can be the same or different. A specific probe sequence can be designed between the universal primer sequence at the 5 'end and the specific sequence at the 3' end for detection.
The invention can obviously improve the amplification efficiency and the detection sensitivity of PCR, and is suitable for being used as a conventional molecular biology laboratory means and a medical nucleic acid detection means for detecting the low-template-number gene.
The invention is further illustrated by the following specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. In addition, after reading the disclosure of the present invention, one skilled in the art can make various changes or modifications to the invention, and such equivalents also fall within the scope of the claims appended to the present application.
In the following examples, SD DNA polymerase and SD reaction buffer were purchased from BIORON GmbH (Germany), and primers and other related reagents were provided by Shanghai Bioengineering Co., Ltd.
Example 1
Multiplex PCR amplification of template DNA:
the following primers (Table 1) were designed based on the principle of multiple primer and universal primer design in the technical scheme using an artificially synthesized template of 69bp as the amplification target.
The reaction conditions were as follows:
the PCR reaction system contained 10U of SD DNA polymerase, 1 XSD reaction buffer, 3.5mM MgCl, and a total volume of 25. mu.L20.4mM dNTPs, 30nM each of the upstream and downstream multiplex primers Fm and Rm, 1. mu.M each of the upstream and downstream universal primers FUP and RUP, 0.5. mu.L of SYBR Geen I (20X), 2. mu.L of template. Sterile water was used as a negative control.
The PCR amplification procedure was: denaturation at 92 ℃ for 2min, followed by denaturation at 92 ℃ for 20s, renaturation at 56 ℃ for 30s, extension at 68 ℃ for 20s, 25 cycles. Adding 5 mu L of the amplification solution into 1 mu L of 6x sample adding buffer solution, uniformly mixing, and taking 5 mu L of the amplification solution for electrophoresis experiment, wherein the electrophoresis conditions are as follows: voltage 100V, time 60min, 2% agarose gel, 4S red nucleic acid dye color.
FIGS. 3A and 3B are diagrams of amplification electrophoresis using 2-fold primers and 3-fold primers, respectively, in example 1. M is a 50bp DNA molecular standard.
The result of the above-mentioned multiplex PCR amplification:
(1) three amplified bands were obtained using a 2-fold primer pair (F2/R2) and were divided into 113bp,135bp and 157bp, respectively, indicating that four amplified products were produced, i.e., two of 135bp and one of 113bp and 157bp each.
(2) Five amplified bands were obtained using 3-fold primer pairs (F3/R3) and divided into 113bp,135bp, 157bp, 179bp and 201bp, respectively, indicating that nine amplified products were produced, i.e., two 135bp, three 157bp, two 179bp and one for each of 113bp and 201 bp.
TABLE 1 Artificial synthetic template and multiple and universal primer sequences
Example 2
Real-time quantitative multiple PCR detection of salmonella:
multiple primers and universal primers were designed with the ttr gene of salmonella as the detection target (table 2).
The reaction conditions were as follows:
the PCR reaction system contained 10U of SD DNA polymerase, 1 XSD reaction buffer, 4mM MgCl, and a total volume of 25. mu.L20.4mM dNTPs, 30nM each of the upstream and downstream 2-fold primers F2 and R2, 1. mu.M each of the upstream and downstream universal primers FUP and RUP, 0.5. mu.L of SYBR Geen I (20X), 2. mu.L of template. Sterile water was used as a negative control.
The PCR amplification procedure was: denaturation at 92 ℃ for 2min, subsequent denaturation at 92 ℃ for 30s, renaturation at 55 ℃ for 30s, extension at 68 ℃ for 1min, fluorescence detection in the extension segment, 35 cycles.
TABLE 2 primer sequence table for detecting salmonella ttr gene
As shown in FIG. 4, FIG. 4 is a specific experiment of real-time fluorescence multiplex PCR in example 2 of the present invention. In the figure, the salmonella strain is Salmonella murine CMCC50071, the non-salmonella strain is Escherichia coli ATCC 8739, Vibrio parahaemolyticus CMCC 17802, Listeria monocytogenes CMCC 54003.
And (4) interpretation of results: the primer designed according to the salmonella ttr gene is used for multiple PCR analysis, and as can be seen from FIG. 4, only salmonella is detected, but other non-salmonella such as Escherichia coli, Vibrio parahaemolyticus and Listeria monocytogenes cannot be detected, which indicates that the specificity of the primer is very good.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention in any way, so that any simple modification, equivalent change and modification made to the above embodiment according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.
Sequence listing
<110> Zhongshan university
<120> a multiplex PCR amplification method
<160>11
<210>1
<211>69
<212>DNA
<213> Artificial sequence
<221>misc_feature
<400>1
tgagcagcagacagcagacacaacgaacttatgatcggtagagtacacaagtgtcgtcgctgtgtctga69
<210>2
<211>63
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>2
ggacagaggacagcagtgacttggacagaggacagcagtgactttgagcagcagacagcagac 63
<210>3
<211>63
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>3
ccacacagacgacacagaccttccacacagacgacacagacctttcagacacagcgacgacac 63
<210>4
<211>85
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>4
ggacagaggacagcagtgacttggacagaggacagcagtgacttggacagaggacagcagtgactttgagcagcagacagcagac 85
<210>5
<211>85
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>5
ccacacagacgacacagaccttccacacagacgacacagaccttccacacagacgacacagacctttcagacacagcgacgacac 85
<210>6
<211>20
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>6
<210>7
<211>20
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>7
<210>8
<211>66
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>8
cagagatggtggcaggaagtaacagagatggtggcaggaagtaaggtagtcaggaagtcacgaatg 66
<210>9
<211>65
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>9
caggaggcagagacaagaggaacaggaggcagagacaagaggaagcacaggtaatggcaatcagt 65
<210>10
<211>20
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>10
<210>11
<211>20
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<400>11
Claims (7)
1. A method of multiplex PCR amplification, comprising: the method comprises performing the amplification in a reaction mixture comprising a pair of polyploid primers and a pair of universal primers, and a thermostable DNA polymerase with strand displacement; priming the PCR at a lower concentration of the multiple primer for the first few cycles, resulting in a first amplification product comprising a plurality of universal primer sequences; amplifying the PCR using a higher concentration of the universal primer using the first amplification product as a template to produce a plurality of second amplification products comprising the target gene;
the method further comprises the steps of:
1) a first amplification reaction in which the multiplex primer hybridizes to the template to produce a first amplification product comprising at least two upstream universal primers and one downstream universal primer or at least one upstream universal primer and two downstream universal primer sequences;
2) and a second amplification reaction, wherein the first amplification product is used as a template, the universal primer is combined with the first amplification product, and a plurality of second amplification products containing the target gene sequence and at least one upstream universal primer and one downstream universal primer are generated under the action of heat-resistant DNA polymerase with the strand displacement effect.
2. The method of claim 1, wherein: in the step 1), the concentration of the multiple primers is 5-100 nM; the 3 'end of the multiple primer is specifically complementary with the target gene, and the 5' end comprises at least 1 binding site with the same sequence as the universal primer.
3. The method of claim 1, wherein: in the step 1), the number of universal primers contained in the upstream and downstream sequences of the multiple primers is the same or different, but the total number of the universal primer sequences contained in the multiple primers in one system is at least 3.
4. The method of claim 1, wherein: in the step 2), the concentration of the universal primers is l-10 mu M respectively; the universal primer has no homology with a target gene sequence; the melting temperature of the universal primer and the melting temperature of the target gene specific primer are different by not more than 4 ℃.
5. The method of claim 1, wherein: in the step 2), the sequences of the upstream and downstream of the universal primer are the same or different.
6. The method of claim 1, wherein: in step 2), the 3 'end of the multiple primer is completely complementary with the target gene sequence, the sequence is designed by using primer software, the length of the sequence is 10-30 bases, the 5' end comprises at least one sequence completely identical to the universal primer, and the sequences are connected by using bases.
7. The method of claim 1, wherein: the general primer sequence is irrelevant to the target gene sequence, and the design is completely independent of the detected gene; the length of the sequence is 10-30 bases.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710591161.6A CN107177693B (en) | 2017-07-19 | 2017-07-19 | Multiple PCR amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710591161.6A CN107177693B (en) | 2017-07-19 | 2017-07-19 | Multiple PCR amplification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107177693A CN107177693A (en) | 2017-09-19 |
| CN107177693B true CN107177693B (en) | 2020-11-06 |
Family
ID=59838034
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710591161.6A Active CN107177693B (en) | 2017-07-19 | 2017-07-19 | Multiple PCR amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107177693B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102352350A (en) * | 2011-09-30 | 2012-02-15 | 北京万达因生物医学技术有限责任公司 | Same sequence primer transpositional nucleic acid amplification technology |
| CA2894381A1 (en) * | 2012-12-07 | 2014-06-12 | Invitae Corporation | Multiplex nucleic acid detection methods |
| CN104293962A (en) * | 2014-10-20 | 2015-01-21 | 苏州大学 | Method for screening general primers |
| CA2999902A1 (en) * | 2015-10-09 | 2017-04-13 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012097374A1 (en) * | 2011-01-14 | 2012-07-19 | Cb Biotechnologies, Inc. | Immunodiversity assessment method and its use |
| WO2015031691A1 (en) * | 2013-08-28 | 2015-03-05 | Cellular Research, Inc. | Massively parallel single cell analysis |
-
2017
- 2017-07-19 CN CN201710591161.6A patent/CN107177693B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102352350A (en) * | 2011-09-30 | 2012-02-15 | 北京万达因生物医学技术有限责任公司 | Same sequence primer transpositional nucleic acid amplification technology |
| CA2894381A1 (en) * | 2012-12-07 | 2014-06-12 | Invitae Corporation | Multiplex nucleic acid detection methods |
| CN104293962A (en) * | 2014-10-20 | 2015-01-21 | 苏州大学 | Method for screening general primers |
| CA2999902A1 (en) * | 2015-10-09 | 2017-04-13 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
Non-Patent Citations (3)
| Title |
|---|
| "An innovative SNP genotyping method adapting to multiple platforms and throughputs";Y. M. Long et al.;《Theoretical and Applied Genetics》;20161209;第1-11页 * |
| "一种基于适配器连接介导的等位基因特异性扩增法测定多重SNP";汪维鹏等;《遗传》;20061231;第28卷(第2期);第219-226页 * |
| "一种高效筛选公共引物的方法";陈英等;《中国血液流变学杂志》;20161231;第26卷(第1期);第2页第1段和右栏第2-3段、第3页第1-2段、右栏第3段和第5页第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107177693A (en) | 2017-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1256630A2 (en) | Selective polymerase chain reaction of DNA of which base sequence is completely unknown | |
| CN108754000B (en) | Fluorescent quantitative PCR detection method for drug-resistant gene mcr-4/5/8 | |
| CN113186319A (en) | Primer, kit and method for detecting Nocardia seriolae | |
| CN1333827A (en) | Method for synthesizing C DNA | |
| CN110734994A (en) | Specific primer pair, probe and detection kit for detecting aeromonas hydrophila | |
| JP6940412B2 (en) | PCR method | |
| Nurjayadi et al. | Optimum temperature of the amplification of the fljB gene of Salmonella typhimurium | |
| CN110564823B (en) | DNA constant temperature amplification method and kit | |
| CN107177693B (en) | Multiple PCR amplification method | |
| CN109355404B (en) | Primer, kit and detection method for isothermal detection of listeria monocytogenes based on polymerase helix reaction | |
| CN103571932A (en) | Detection method for single nucleotide polymorphism based on heat-resistant nuclease HII | |
| CN102424833A (en) | Chip and method for real-time PCR (polymerase chain reaction) gene detection at polygenic mutation site | |
| KR101987388B1 (en) | Composition for colorimetric isothermal detecting of vibrio species containing molecular beacon and uses thereof | |
| KR101509071B1 (en) | Primers for amplifying Microcystis sp Gene, and detection method of Microcystis sp using the same | |
| CN116004773A (en) | Linear displacement isothermal amplification method and application thereof | |
| CN109852670A (en) | A kind of high specific nucleic acid detection reagent and its application method | |
| He et al. | Nickase-dependent isothermal DNA amplification | |
| CN105018604A (en) | Kit for detecting drug resistance gene polymorphism at a room temperature by probe | |
| KR101785687B1 (en) | Method for detection of target nucleic acid sequence by multiple amplification nested signal amplification | |
| KR20190041314A (en) | Oligonucleotide set for detection of chikungunya virus and uses thereof | |
| CN107904284A (en) | The nucleic acid constant-temperature amplification method of programmatic method and its kit application | |
| JP4782784B2 (en) | DNA sequences for detection and identification of pathogenic E. coli | |
| CN111334562A (en) | Nucleic acid amplification method and kit containing modified primer | |
| WO2017183648A1 (en) | Multi-item amplification method | |
| CN112391449B (en) | Multifunctional DNA isothermal amplification method with flexible primer design and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |