KR101987388B1 - Composition for colorimetric isothermal detecting of vibrio species containing molecular beacon and uses thereof - Google Patents

Abstract

The present invention provides oligonucleotide primers of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5 and a oligonucleotide primer comprising the oligonucleotide primer set forth in SEQ ID NO: 4, and a polynucleotide sequence encoding a LOP (Loop-mediated isothermal amplification) composition for detecting Vibrio sp. Lt; / RTI >

Description

[0001] The present invention relates to a composition for detecting isothermal coloration of Vibrio sp. Containing a molecular beacon and a use thereof.

The present invention relates to a composition for detecting isothermal coloration of a Vibrio sp. Containing a molecular beacon and uses thereof.

Detection and diagnosis of pathogenic microorganisms causing many diseases in the human body are very important fields for the welfare of human beings. Especially, in case of food which is the most important energy for human, if the safety test for these pathogenic microorganisms is not carried out, Can happen. For this reason, efforts have been made to detect and diagnose pathogenic microorganisms. Clinical features appearing as symptoms in major human diseases are found, but many diseases that have not yet been identified have been reported to be caused by bacteria that have not yet been identified, Development of new detection methods for such pathogenic microorganisms is being sought.

Recently, more advanced loop-mediated isothermal amplification (LAMP) reactions have been developed than conventional PCR-based methods. LAMP reaction can be annealed and stretched at a constant temperature without changing the temperature, unlike the case where the amplification reaction is performed in three steps of denaturation, annealing and extension in the conventional PCR, so that the reaction time is 1 hour , And there is no DNA damage or damage due to temperature change. Since it is necessary to maintain only a certain temperature, it is possible to perform experiments using only a simple thermostat without requiring expensive equipment, so that the application is high in the field. In addition, since four specific primers are used to recognize six regions of the gene sequence to be amplified, the specificity of the target gene is very high.

Vibrio spp. Is a bacterium belonging to Pseudomonas spp., Gram-negative, with one or several flagella, and has a curved rod shape. So far 34 species are known. Cells are not long, but they are bent and single, or several connected spirals. At one end of the body has one or several flagella, which actively swim and move. As a gram-negative organism, wild species are widely distributed in seawater, and many are found in fresh water and soils. Life is biocidal. There are some pathogens in humans and fish. Vibrio cholerae and V. parahaemolyticus , known as bacterial food poisoning, are among the most virulent pathogens.

Korean Patent No. 0607901 discloses a method for identifying and analyzing a specific substance using a molecular beacon, and Korean Patent Publication No. 2005-0027011 discloses a method for detecting a heat-resistant hemolytic toxin-like toxin gene of Vibrio parahaemolyticus However, the composition for detecting the isothermal color of Vibrio sp. Containing the molecular beacon of the present invention and its use have not been described.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-described needs, and it is an object of the present invention to provide a primer set for LAMP specific to Vibrio sp. And a molecular beacon containing a DNA-based enzyme sequence capable of binding to a product amplified through the primer set As a result of performing LAMP reaction on Vibrio parahaemolyticus and other microorganisms using the primer set and the molecular beacon, the primer set and the molecular beacon of the present invention were included. , The present inventors have completed the present invention by confirming that the composition for LAMP specifically detects Vibrio bacteria and can effectively reduce a false positive v of LAMP reaction.

In order to solve the above-mentioned problems, the present invention provides oligonucleotide primers of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5, and a loop-mediated isothermal amplification (LAMP) composition for detecting Vibrio sp. do.

The present invention also relates to a LAMP composition for detection of the Vibrio sp. A reagent for carrying out an amplification reaction; And a reagent for detecting an amplification reaction product.

In addition, the present invention provides a method for detecting a vibriosis infection, comprising the steps of: isolating genomic DNA from a suspected Vibrio infection sample; Amplifying the target sequence using the separated genomic DNA as a template and carrying out isothermal amplification reaction using the LAMP composition for detecting Vibrio sp. Of the present invention; And a step of detecting the product of the isothermal amplification step.

The LAMP composition for detecting Vibrio sp. Bacteria according to the present invention and the method for detecting Vibrio spp. Using the same can amplify a gene under isothermal conditions, so that the reaction time is shorter than that of a conventional PCR requiring a temperature gradient, It has excellent amplification efficiency due to low DNA damage and loss. It does not need equipment such as expensive gene cycler and can be used for field examination because it can detect the naked eye through colorimetric reaction. In addition, the LAMP composition of the present invention can be used for diagnosis of suspected infection of Vibrio sp. By improving the accuracy of detection by using a molecular beacon hybridized to an amplified product in order to eliminate false positives.

1 schematically illustrates the working principle of the present invention.
FIG. 2 shows the results of detection of Vibrio bacteria using the LAMP primer set of the present invention and molecular beacons. FIG. 2 (A) shows the colorimetric results of the final reaction product, the upper side shows the state before the reaction termination reagent was added, After the addition of the reaction termination reagent, show the figure. (B) is a graph showing absorbance at 450 nm after completion of the color reaction, and (C) is an agarose gel loading photograph of the isothermal amplification reaction product.
FIG. 3 shows the results of confirming the conditions of the molecular beacon concentration (A) and the isothermal amplification reaction time (B) for optimizing the LAMP reaction. Signal to noise: {Absorbance of negative sample / Absorbance of positive sample} -1} x 100.
4 shows the results of the LAMP reaction using sample DNAs of various concentrations in order to confirm the sensitivity of the detection ability of Vibrio bacteria using the LAMP primer set of the present invention and molecular beacons.
FIG. 5 is a graph showing the specificity of the detection ability of Vibrio bacteria using the LAMP primer set of the present invention and the molecular beacon. The results are shown in Fig. VP: Vibrio parahaemolyticus , BC: Bacillus cereus , EC: Escherichia coli , SA: Staphylococcus aureus , ST: Salmonella typhimurium , LM: Listeria monocytogenes .
FIG. 6A is a result of electrophoresis to confirm a false positive result common to LAMP, and FIG. 6B is a result of a molecular beacon of a LAMP reagent showing false positive results. P: Positive sample, N: Negative sample.

In order to accomplish the objects of the present invention, the present invention provides oligonucleotide primers of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5, and a loop-mediated isothermal amplification (LAMP) composition for detecting Vibrio sp. do.

In this specification, the term 'loop-mediated isothermal amplification' (LAMP) is a method capable of amplifying a target sequence under an isothermal condition, unlike the conventional PCR (polymerase chain reaction) method. For the LAMP reaction, four kinds of oligonucleotide primers (FIP, BIP, F3, B3) are basically required. The four primers consist of two outer primers and two inner primers. The outer primers are forward outer (F3) primer and backward outer (B3) primer. And serves to release DNA duplexes during the non-cyclic step of the reaction. The internal primers consist of forward internal primer (FIP) and backward inner primer (BIP), and are designed to bind to both forward and reverse base sequences so as to form a loop necessary for the ring-mediated isothermal amplification reaction. And consists of the corresponding nucleotides.

In the LAMP composition according to an embodiment of the present invention, the oligonucleotide primer set of SEQ ID NO: 1 to SEQ ID NO: 4 is a primer set targeting the hemolysin gene of Vibrio sp., The primer of SEQ ID NO: 1 is a forward The primer of SEQ ID NO: 2 is BIP, the primer of SEQ ID NO: 2 is BIP which is the reverse primer, the primer of SEQ ID NO: 3 is F3 which is the forward primer, and the primer of SEQ ID NO: 4 is B3 which is the reverse primer.

As used herein, the term "oligonucleotide" is an oligodeoxyribonucleotide composed of oligoribonucleotides composed of ribose and deoxyribose in the state where several to ten nucleotides are polymerized with phosphoric acid diester bonds.

The oligonucleotide primer of the present invention may comprise at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41 consecutive sequences in SEQ ID NOS: 1 and 2, And may comprise oligonucleotides consisting of fragments of at least 15, at least 16, and at least 17 contiguous nucleotides of SEQ ID NOS: 3 to 4. For example, the primer (42 oligonucleotides) of SEQ ID NO: 1 has at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41 nucleotides in the sequence of SEQ ID NO: RTI ID = 0.0 > oligonucleotides < / RTI >

As used herein, the term "primer " refers to a single strand of oligonucleotide sequence complementary to the nucleic acid strand to be duplicated and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or And may include an intercalating agent.

As used herein, the term "molecular beacon" refers to an oligonucleotide designed to be complementary to a LAMP reaction product, which contains a sequence of the middle DNA-based enzyme DNAzyme (HRPzyme) Lt; / RTI >

In the present invention, when a positive sample is included, a molecular beacon is hybridized to the LAMP amplification product, and there is no or only a small amount of free molecular beacon in the reactant, so that heme does not form a G-quadruplex with hemin, -quadruplex, and when a negative sample is included, molecular beacons are not hybridized to the LAMP amplification product, so that a molecular beacon exists in a free state in the reaction and reacts with hemin to form a G-quadruplex. Therefore, when a substrate solution such as TMB is added, the G-quadruplex formed in the negative sample exhibits a strong colorimetric reaction by reacting with the substrate, and a weak colorimetric reaction or colorimetric reaction is not observed in the positive sample. Low.

In the LAMP composition according to one embodiment of the present invention, the molecular beacon composed of the oligonucleotide of SEQ ID NO: 5 is a probe that can hybridize to the target product amplified by the LAMP reaction, and the base of 8-12 bp at both ends is LAMP And the sequence may be complementary to the product amplified by the DNA-based enzyme (DNAzyme), but is not limited thereto.

As used herein, the term "DNA-based enzyme" is a synthetic DNA molecule capable of enzymatically cleaving other nucleic acid molecules. The DNA-based enzyme of the present invention is a horseradish peroxidase (HRP) And specifically, the 11th to 28th bases of SEQ ID NO: 5 may be HRPzyme sequences, but are not limited thereto.

In the LAMP composition for detecting Vibrio spp. Of the present invention, the Vibrio spp. May be selected from the group consisting of Vibrio parahaemolyticus , V. mimicus , V. fluvialis , Vibrio parahaemolyticus, see Norris coarse tea may be (V. alginolyticus), or Vibrio Cincinnati N-Sys (V. cincinnatiensis), and preferably may be a Vibrio para to memory T carcass (Vibrio parahaemolyticus), but is not limited thereto.

In order to accomplish still another object of the present invention, the present invention provides the above LAMP composition; A reagent for carrying out an amplification reaction; And a reagent for detecting an amplification reaction product.

In the kit of the present invention, the LAMP composition comprises an oligonucleotide primer of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And an oligonucleotide primer of SEQ ID NO: 4; and a molecular beacon consisting of the oligonucleotide of SEQ ID NO: 5. In addition, the reagent for carrying out the amplification reaction may include a DNA polymerase, dNTPs and a buffer, and the reagent for detecting the amplification reaction product may be a DNA-based enzyme (DNAzyme) contained in the molecular beacon sequence of the present invention, Of catalyst and substrate. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to make the buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

Isolating the genomic DNA from the suspect sample of the Vibrio infection;

Using the separated genomic DNA as a template, an oligonucleotide primer of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And an oligonucleotide primer of SEQ ID NO: 4; and a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5; and amplifying the target sequence by performing an isothermal amplification reaction; And

And a step of detecting the product of the isothermal amplification step.

The method of the present invention comprises isolating genomic DNA from a suspected Vibrio infection sample. Methods for isolating genomic DNA from the sample can be performed by a method known in the art. For example, a CTAB method may be used, or a Wizard prep kit (Promega) may be used. Using the separated genomic DNA as a template, an amplification reaction can be performed using a LAMP primer set and a molecular beacon according to an embodiment of the present invention to amplify the target sequence.

In the detection method according to an embodiment of the present invention, amplifying the target sequence may be performed at a temperature of 57 to 62 ° C, preferably 58.8 ° C, but is not limited thereto. In the step of amplifying the target sequence, the concentration of the molecular beacon may be 3 to 5 μM, preferably 4 μM, but is not limited thereto. In addition, in the step of amplifying the target sequence, the isothermal amplification reaction time may be 30 to 40 minutes, preferably 40 minutes, but is not limited thereto.

In the method of the present invention, the detection of the amplification product can be carried out through colorimetric analysis, fluorescence measurement, DNA chip, gel electrophoresis, radioactive measurement, or phosphorescence measurement, preferably through colorimetric analysis But is not limited thereto.

In the method for detecting Vibrio spp. According to an embodiment of the present invention, hemin is added to the reaction solution after completion of the isothermal amplification reaction, and HRP-like DNA sequence of the free molecular beacon sequence is combined with hemin to form G (H ₂ O ₂ ) and TMB (3,3 ', 5,5'-Tetramethylbenzidine) were added to the reaction mixture to induce formation of a quadruplex / hemin complex. And the reaction is terminated. The absorbance in the solution after completion of the reaction can be measured through a known technique in the art.

In the method of the present invention, a sample that is positive for Vibrio sp. Is hybridized to the amplified product of molecular beacon, and there is little free molecular beacon in the reaction solution after completion of the isothermal amplification reaction. In contrast, in the sample which is negative for Vibrio sp. The beacon amplification product does not hybridize to the amplified product, and the principle of the existence of free molecular beacons in the reaction solution after completion of the isothermal amplification reaction is used. The higher the concentration of the target DNA to be detected, the lower the absorbance. So that the absorbance was increased. The method of the present invention is a method in which the accuracy of detection is improved by solving the problem of false poses, which is a problem in the LAMP reaction.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Used strain

In the present invention, Vibrio parahaemolyticus , which is distributed from the KCTC, and V. mimicus , Vibrio species, which are distributed from the Korean Microorganism Conservation Center (KCCM), Vibrio parahaemolyticus, was used (V. fluvialis), Vibrio see Norris coarse tea (V. alginolyticus) and Vibrio Cincinnati N-Sys (V. cincinnatiensis). Further, in order to determine the detection specificity of the present invention, Bacillus cereus (Bacillus cereus; KCTC 7464), L. monocytogenes cytokines to Ness (Listeria monocytogenes; KCTC 11994), E. coli (Escherichia coli; KCCM 40405), Salmonella typhimurium (Salmonella Typhimurium (ATCC 19585) and Staphylococcus aureus (ATCC 14458) were purchased and used in the experiment.

Reagents and devices

DNA amplification was performed using T100 ^™ Thermal Cycler (Bio-Rad, USA), agarose gel was used for Agarose LE (iNtRON, Korea) and electrophoresis apparatus was Mupid-α (Advance, Japan). The color reaction of the amplified product was performed using 1-Step ^TM Ultra TMB-ELISA (Thermo, USA), 30% hydrogen peroxide (DUKSAN, Korea) and 2M sulfuric acid (Thermo). The image of the agarose gel was also taken at Fusion FX (VILBER LOURMAT, Germany) and absorbance at 450 nm using SPARK 10M TECAN, Switzerland).

Medium and DNA Isolation

Vibrio spp. Was cultivated in TCBS solid medium (Difco, France), and single colonies formed were inoculated into TSB containing 2% sodium chloride (Tryptone Soya Broth; OXOID, UK) and cultured at 37 ° C for 18 hours with shaking. DNA was isolated from the culture of the cultured Vibrio spp. Using the Labopass ^™ Genomic DNA Isolation Kit (Cosmo genetech, Korea) according to the supplier's method.

LAMP primer set and molecular beacon design

The nucleotide sequence of the hemolysin gene, which is specific for Vibrio locus, was searched from NCBI (National Center for Biotechnology Information). Primer Explorer V4 software program and Primer3 Input (version 0.4.0 (FIP, BIP, F3, and B3) and molecular beacons were designed using the program of DNA STAR, Inc., Madison, W1, USA. The designed primer sets and molecular beacons were designed by Xenotech (Table 1).

LAMP primer set and molecular beacon sequence information The base sequence (5 '- > 3') FIP TATCGCACCAGCTACTCGAAAGCATCTTCGTTTTTTGCCCAT (SEQ ID NO: 1) BIP ACAGCGAACATAGGTATAGGTTTGGAGAGCCAACCTTATCACC (SEQ ID NO: 2) F3 CACCAGTAGCCGTCAATG (SEQ ID NO: 3) B3 TAACTGCATTACTCCCGC (SEQ ID NO: 4) 분자형 CTGTTGGTAT GGGTAGGGCGGGTTGGGT GATGATCCAG (SEQ ID NO: 5)

LAMP reaction conditions

Isothermal colorimetric PCR was performed using the method of Notomi et al. (Nucleic Acids Research, 2000, 28 (12): E63), and the total reaction solution was prepared as follows per reaction tube. , 10 μl of 10 × reaction buffer (20 mM Tris-HCl, 10 mM (NH ₄ ) SO ₄ , 10 mM KCl, 2 mM MgSO ₄ , 0.1% Triton ^® X-100, pH 8.8, Enzynomics, Korea), 40 μM internal primer ) And 10 μM of external primers (F3 and B3), 2.0 μl of a 100 μM molecular beacon, 8.0 μl of a 10 nM dNTP mix (2.5 mM each, Cosmo, Korea), and Bst DNA polymerase (Large length, Enzynomics ) And sterilized water to make 44 가. The mixture was prepared and dispensed once. To this was added 6 μl of DNA at a concentration of 50 μg / ml to obtain a final volume of 50 μl, followed by reaction at 58.8 ° C. for 30 minutes.

Confirmation of amplification product by electrophoresis

PCR products were analyzed by Mupid-α electrophoresis using 1.0% (w / v) agarose gel. 5 μl of the amplification products and 1 μl of the 6 × loading star (Dyne Bio, Korea) were added to each lane, and 5 μl of the amplification product was loaded and electrophoresed at 100 V for 25 minutes. The gel was then placed on a UV transilluminator to confirm amplification of the target product.

Identification of amplification products by colorimetric method

1 μl of 100 μM hemin (Sigma) in DMSO (Sigma, USA) as a solvent was added to each well, 10 μl of the PCR product was added, and 2 μl of 30% hydrogen peroxide and 1 ml of TMB solution 100 μl was added to each well, and reacted for 2 minutes. Thereafter, 100 쨉 l of 2 M sulfuric acid was added to terminate the reaction, and the absorbance at 450 nm was measured.

Example 1: Detection ability of Vibrio bacteria using LAMP primer set and molecular beacon

The detection ability of Vibrio parahaemolyticus was analyzed using the primer set and the molecular beacon shown in Table 1 above.

As a result, it was confirmed that the absorbance of the positive sample containing Vibrio bacteria was lower than that of the negative sample (FIG. 2A, B). As a result of loading the isothermal reaction product into the agarose gel, the reaction product was not confirmed in the negative sample (Fig. 2C).

In the LAMP reaction of the present invention, molecular beacon concentrations (1, 2, 4, 8 and 10 μM) and isothermal amplification reaction times (10, 20, 30, 40, 50 and 60 min) Respectively. As a result, it was confirmed that the optimal LAMP reaction occurred when the molecular beacon was at a final concentration of 4 μM (FIG. 3A) and when the isothermal amplification reaction time was 30 to 40 minutes (FIG. 3B).

Example  2. LAMP primer  Set and Molecular beacon  Sensitivity and Specificity Analysis

The sensitivity and specificity of detection of Vibrio bacteria were analyzed using the LAMP primer set of SEQ ID NOS: 1 to 4 and the molecular beacon of SEQ ID NO: 5, which were confirmed to be Vibrio sp.

To confirm the sensitivity, genomic DNA of Vibrio parahaemolyticus was prepared from 1 fg (10 ^-15 ) to 10 μg and LAMP reaction was performed. As a result, a distinct amplified signal was confirmed for the 1fg DNA sample as compared with the negative control (Fig. 4).

For the identification of specificity, it is preferred to use a microorganism such as Vibrio parahaemolyticus, Bacillus cereus , Listeria monocytogenes , Salmonella Typhimurium , Escherichia coli and Staphylococcus aureus, A DNA sample was prepared by mixing Staphylococcus aureus alone or with Vibrio bacteria, and LAMP reaction was performed. As a result, the samples containing Vibrio parahaemolyticus alone and the Vibrio fungi showed lighter color than those of Bacillus cereus, Escherichia coli, Listeria monocytogenes, Salmonella typhimurium, and Staphylococcus aureus alone The results of the reaction were confirmed (FIGS. 5A and 5B), and a LAMP-specific ladder-like band was confirmed in the samples containing Vibrio bacteria even in the result of agarose gel loading (FIG. 5C).

Example 3. Analysis of false positive according to use of molecular beacon

The false positive results of the LAMP reaction according to the use of the molecular beacon containing the HRPzyme DNA sequence were analyzed. In the condition optimization experiment using the DNA primer set for LAMP of the present invention using the DNA of Vibrio germ (positive) and E. coli (negative) as a template, under the condition that the isothermal amplification reaction time was 60 minutes, False positive was confirmed (Fig. 6A). Therefore, the inventors of the present invention confirmed the possibility of correcting the interpretation of the result through the colorimetric reaction using the molecular beacon.

As a result, it was confirmed that the positive and negative samples can be distinguished from each other by a clear difference in the degree of color development through the colorimetric reaction using the molecular beacon (sample not capable of accurate detection through agarose gel loading) 6B). In the electrophoresis of the LAMP reaction product, it was impossible to discriminate the target microorganism accurately. However, the discrimination of the positive sample with the weak coloring level compared with the strong coloring of the negative sample can be easily distinguished from the naked eye through the colorimetric reaction Respectively. From the above results, it was confirmed that the accuracy of detection results can be improved by effectively solving the false positives of the LAMP method of the present invention using molecular beacons.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY          Gwangju Institute of Science and Technology <120> Composition for colorimetric isothermal detecting of vibrio          species containing molecular beacon and uses thereof <130> PN17377 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tatcgcacca gctactcgaa agcatcttcg ttttttgccc at 42 <210> 2 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 acagcgaaca taggtatagg tttggagagc caaccttatc acc 43 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 caccagtagc cgtcaatg 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 taactgcatt actcccgc 18 <210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> molecular beacon <400> 5 ctgttggtat gggtagggcg ggttgggtga tgatccag 38

Claims (6)

An oligonucleotide primer of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5 and a primer set comprising an oligonucleotide primer of SEQ ID NO: 4 and a LAMP (Loop for detection of Vibrio parahaemolyticus ) -mediated isothermal amplification. delete The LAMP composition of claim 1; A reagent for carrying out an amplification reaction; And a kit for detecting Vibrio parahaemolyticus bacteria containing a reagent for detecting an amplification reaction product. Isolating the genomic DNA from the suspect sample of the Vibrio infection;
Using the separated genomic DNA as a template, an oligonucleotide primer of SEQ ID NO: 1; An oligonucleotide primer of SEQ ID NO: 2; An oligonucleotide primer of SEQ ID NO: 3; And an oligonucleotide primer of SEQ ID NO: 4; and a molecular beacon consisting of an oligonucleotide of SEQ ID NO: 5; and amplifying the target sequence by performing an isothermal amplification reaction; And
And detecting the product of said isothermal amplification step. &Lt; Desc / Clms Page number 19 &gt; 5. The method of claim 4, wherein the isothermal amplification reaction is performed at 57 to 62 &lt; 0 &gt; C. 5. The method of claim 4, wherein detection of the amplification step product is performed through a colorimetric reaction.

Images