CN104257696B - A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application - Google Patents

A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application Download PDF

Info

Publication number
CN104257696B
CN104257696B CN201410448434.8A CN201410448434A CN104257696B CN 104257696 B CN104257696 B CN 104257696B CN 201410448434 A CN201410448434 A CN 201410448434A CN 104257696 B CN104257696 B CN 104257696B
Authority
CN
China
Prior art keywords
glp
yeast
inorganic
vanadium
selenium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410448434.8A
Other languages
Chinese (zh)
Other versions
CN104257696A (en
Inventor
李元
师长宏
赵金礼
张明杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
XI'AN GUOYU BIOTECHNOLOGY Co Ltd
Original Assignee
XI'AN GUOYU BIOTECHNOLOGY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by XI'AN GUOYU BIOTECHNOLOGY Co Ltd filed Critical XI'AN GUOYU BIOTECHNOLOGY Co Ltd
Priority to CN201410448434.8A priority Critical patent/CN104257696B/en
Publication of CN104257696A publication Critical patent/CN104257696A/en
Application granted granted Critical
Publication of CN104257696B publication Critical patent/CN104257696B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/06—Fungi, e.g. yeasts
    • A61K36/062—Ascomycota
    • A61K36/064—Saccharomycetales, e.g. baker's yeast
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/10—Preparation or pretreatment of starting material
    • A61K2236/19—Preparation or pretreatment of starting material involving fermentation using yeast, bacteria or both; enzymatic treatment

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Mycology (AREA)
  • Inorganic Chemistry (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention discloses steady sugar yeast bacterium powder of a kind of hypoglycemic and its preparation method and application, it is described it is yeast expressed have a GLP 1, and containing converting the GTF formed, yeast selenium and yeast vanadium by inorganic chromium, inorganic selenium and inorganic vanadium.The present invention promotes Islet Cells Insulin secretion using glucagon-like peptide 1；GTF lowers insulin resistance, promotes the sensitiveness of insulin；Organic yeast selenium promotes the reparation of islet cells.From islet cells reparation, insulin releasing to insulin sensitivity enhancing；Organic vanadium directly plays para-insulin, and the cause of disease for type-II diabetes carries out comprehensive treatment, and effect is much better than single therapy scheme, and single dusty yeast production can complete the multiple drug effect factor and prepare, it is easy to large-scale production, cost is low, it is more economical to be applicable.

Description

A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application
Technical field
The invention belongs to diabetes control technical field, it is related to steady sugar yeast bacterium powder of a kind of hypoglycemic and preparation method thereof and answers With.
Background technology
Diabetes have been listed in the third-largest killer after cardiovascular and cerebrovascular disease and tumour.With life pattern, drink The change of structure is eaten, global diabetes prevalence is in the trend steeply risen.Expect the year two thousand thirty, world's diabetes number of patients 3.66 hundred million people will be increased to, diabetes are by as many families and a social heavy burden.
The cause of disease of type 2 diabetes patient is many, and some patients are due to the deficiency of amount of insulin secretion, but Insulin is not only had no lack of on the contrary higher than normal in some diabetes patient's bodies, and its cause of disease is to insulin insensitivity (i.e. insulin Resistance).Vast majority of people is inevitably treated with medicine in type 2 diabetes patient.Etiotropic difference, orally Antidiabetic drug can be divided into three major types：The first kind is yellow urea class, such as glibenclamide, Gliquidone, Diamicron, mindiab；Yellow urea class medicine energy Enough stimulate islet secretion insulin, but after insulin secretion is more, hypoglycemia can be caused, hypoglycemia is one for patients Individual less negligible hazards, and some drugs have larger side effect, can such as cause liver dysfunction.Equations of The Second Kind Medicine is biguanide drug, such as phenformin and melbine.Biguanide drug does not stimulate insulin secretion, and it stimulates body in cellular water The flat upper utilization for improving insulin, it is directed to the patient to insulin insensitivity, but for the sugar of hypoinsulinism Urinate for patient, the effect that it is played is just very limited, and the also adverse reaction such as lactic acidosis.3rd class medicine is a Glycosidase inhibitor, such as Acarbose.The effect of this kind of medicine is to reduce human body to absorption sugared in diet, is reduced because absorbing, from And slow down blood glucose rise.But the side effect of the medicine includes gastrointestinal reaction；And the bad assurance of its dosage, easily occur after taking low Blood glucose response, at that time will oral or intravenous glucose.
In recent years to the progress of insulinotropic peptide GLP-1-1 quickly, and type II diabetes is treated with it to have been achieved with Preferable curative effect.GLP-1 promotes islet β cell insulin in concentration of glucose dependence mode, and it is thin to reduce pancreatic islet alpha Intracrine hyperglycemic factor (glucagon), so as to reduce blood glucose.Normal person is entering after the meal, and secretin starts secretion, wherein GLP-1 promote insulin secretion, to reduce the fluctuation of postprandial blood sugar.But " the secretin's effect " of type 2 diabetes patient by Damage, be mainly shown as into GLP-1 concentration elevation amplitude after the meal and reduced compared with normal person, and its GLP-1 promotes insulin secretion And hypoglycemic effect has no substantially impaired, therefore GLP-1 and the like is an important target for treating type ii diabetes Point.
GLP-1 mainly plays blood sugar reducing function by following several respects：1. beta Cell of islet is acted on, promotes insulin gene Transcription, the synthesis and secretion of insulin, and can stimulate propagation and the differentiation of beta Cell of islet, suppress islet beta-cell apoptosis, increase Plus beta Cell of islet quantity.2. alpha Cell of islet is acted on, consumingly the release of glucagon suppression, and it is thin to act on pancreas islet δ Born of the same parents, promote the secretion of growth hormone release inhibiting hormone, and growth hormone release inhibiting hormone participates in the secretion of glucagon suppression but also as paracrine hormone.GLP- 1 has concentration of glucose dependence blood sugar reducing function.As a kind of Entero hormone, GLP-1 is in nutriment particularly carbon water Blood is just released under the stimulation of compound, its promoting insulin secretion is in concentration of glucose dependence.So, GLP-1 has Concentration of glucose dependence blood sugar reducing function, i.e., only in the case where blood sugar level is raised, GLP-1 just plays blood sugar reducing function；And When blood sugar level is normal, then it will not be made further to reduce.GLP-1 this concentration of glucose dependence hypoglycemic characteristic is it The basis of clinical practice security is with ensureing, so that eliminate people is likely to result in trouble to existing Remedies for diabetes and scheme The worry of person's severe hypoglycemia.
In addition, Organic Selenium can strengthen repairs of the GLP-1 to beta Cell of islet.Now it has proven convenient that selenium deficiency and more than 40 kinds of disease Disease has direct or indirect relation, particularly cancer, angiocardiopathy, diabetes, hepatopathy etc..There are some researches show the morbidity of tumour Rate and the death rate and selenium level are negatively correlated；The incidence of disease and the death rate of the regional tumour of low selenium are higher, selenium water in tumor patient body It is flat low compared with normal person.The incidence of disease of diabetes is 20.44% in more than 40 years old crowd of China.The state-run health-nutrition research of Japan It was found that：Selenium deficiency is to suffer from one of inducement of diabetes.Selenium is set to " king of anticancer " by medical field, and selenium-supply contributes to disease damage simultaneously Islet cells is repaired.Yeast selenium is the preferably source of current selenium-supply, Se-enriched yeast be using yeast develop it is a kind of organic Selenium source, it is to be produced by Se accumulation in the cell protein structure of growth yeast, it has therefore proved that Se-enriched yeast is more than inorganic selenium Safe and stable, easy absorption, effective and pollution less, and have many healthcare functions.
The main function of selenium-supply includes 1. anti-oxidant：The height of selenium level directly affects antioxidant ability of organism, and To the resistivity of relevant disease；2. normal immunological function is maintained；3. antitumor action：U.S. Combs GF Jr in 1989 from To being found in the analysis of more than 100 epidemiological studies report, the selenium for having 2/3 account visible subsidy to fill higher than nutritional requirements can Lower cancer morbidity, the account publicly price-reduction of half of which is low up to more than 50%；4. the effect of anti-aging：Free radical and Lipid peroxidation is the principal element for causing membrane damage and promoting ager process.Internal oxidant defense system, particularly The synergy of vitamin E and selenium serves effect that is anti-oxidant, slowing down ager process.Show in diabetes study, selenium exists Obvious facilitation is played in beta Cell of islet repair process.
Insulin releasing is stimulated, the subproblem of type 2 diabetes patient can only be solved, supported while should also solve insulin The problem of anti-effect, that is, strengthen the sensitiveness of insulin.Nineteen fifty-seven, Schwarz and Mertz observe work of the chromium in glycometabolism With, it was demonstrated that Cr3+It is the activity composition of GTF (Glucose Tolerance Factor, GTF) in brewer's yeast Part.Later, Mertz confirmed that GTF was glutamic acid, glycine and half Guang using niacin-trivalent chromium-niacin as axle center Propylhomoserin is the material of part, is the reinforcing agent of insulin, and the metabolism of sugar, protein, fat and nucleic acid is influenceed by insulin.Chromium Mechanism of action be that can increase the adhesion of insulin and acceptor, increase insulin receptor quantity, increase the phosphorus of insulin receptor Acidifying etc..
During inorganic chromium is through yeast cells sorption enhanced Organic Chromium, GTF is formed, yeast chromium is used as Main chromium component be natural Regulation of blood glucose agent.Chromium plays special effect in body glycometabolism and lipid metaboli, is that human body must The trace element needed, it can activate insulin active, adjust blood glucose, suppress sugar and be converted into fat.The biology contained in yeast chromium Active chromium may be up to 10%-15% in the absorptivity of human body, and its absorptivity is the 672% of inorganic chlorinating chromium；Effect of yeast chromium It is embodied in：The blood glucose of diabetic is reduced, its hypoglycemic reaction can also be improved, with the dual regulation effect to blood glucose, Diabetes can be effectively controlled, the anomaly in terms of glucose tolerance is eliminated；Zhi serum cholesterol levels can be substantially dropped, mitigate dynamic Arteries and veins hardens symptom；Human muscle can be effectively increased, fat is reduced；Organism endocrine can be improved, strengthen anti-stress ability.
Effect is to surround insulin main shaft above, that is, stimulates insulin releasing and strengthen insulin sensitivity.Whether have straight Pick up insulin action nutriment whichVanadium is necessary trace element in human body, and vanadium has the effect of similar insulin, right The treatment and prevention tool of diabetes has certain effect.The blood glucose of 1 type and diabetes B experimental animal can be reduced.Give certain The vanadium of amount, can be obviously improved the insulin resistance of diabetic, reduce insulin requirement.Vanadium can also increase insulin Sensitiveness, extends the action time of insulin
Heyliger in 1985 etc. has found that vanadate has blood sugar reducing function to diabetes white mouse for the first time, thereafter numerous science The a series of animal experiments research of family shows that vanadium is to insulin-dependent diabetes mellitus (IDDM) and Non-Insulin Dependent Diabetes Mellitus (NIDDM) effectively, it is particularly effective to severe insulin resistance type animal.Vanadium has the same work(of insulin in human body Effect, promotes Fatty synthesis, suppresses the effect decomposed.It is to suppress hepatic gluconeogenic enzymatic activity that it, which is acted on, reduces gluconeogenesis, suppresses junket ammonia The activity of sour phosphatidase, and play a part of acceptor in insulin transmission signal path, so as to reduce hyperglycaemia.Japan Science Family finds that vanadium has fatty " natural decomposition " suppressed caused by obesity and the effect for suppressing free fatty (FFA), can be with Promote to suppress the lipolysis produced by catecholamine while the Fatty synthesis because of insulin, can effectively reduce hyperglycaemia. The great professor (capital of a country pharmaceutical university) of nineteen ninety-five Sakurai takes the clinical test of 60mg vanadic sulfates by diabetic daily, it was demonstrated that Vanadium effectively reduces blood glucose.Confirm that vanadium has the effect of insulin equally, especially vanadium does not influence insulin secretion also, can increase group Knit the sensitiveness to insulin.Even when insulin application is failed, vanadate can still effectively act as antidiabetic effect, This will open new approach for the treatment of the diabetes patient of insulin resistance.
Research shows, even if cutting out vfanadium compound, blood sugar reducing function can still maintain the long period, this be insulin and The incomparable advantage of the antidiabetic drug that uses at present.Vanadium can increase the combination rate of insulin receptor in GDM pregnant women placentals, can be with Improve glycometabolism, Winter etc. compares vfanadium compound and Rosiglitazone (pancreas islet in Britain has already been through 1 clinical trial phase Plain sensitizing agent) therapeutic action to diabetes white mouse, as a result show that vanadium is obviously improved white mouse insulin sensitivity, and keep The form of normal pancreatic islet cells and distribution, it is close with rosiglitazone in treating group curative effect, and also its white mouse body weight control is more steady It is fixed.
The content of the invention
Present invention solves the problem in that providing steady sugar yeast bacterium powder of a kind of hypoglycemic and its preparation method and application, pass through list One dusty yeast completes the preparation of the multiple drug effect factor of the Different types of etiopathogenises for diabetes, and effect is much better than single therapy scheme, And it is easy to large-scale production, cost is low, more economical to be applicable.
The present invention is to be achieved through the following technical solutions：
A kind of steady sugar yeast bacterium powder of hypoglycemic, it is described it is yeast expressed have a GLP-1, and containing by inorganic chromium, inorganic selenium and Inorganic vanadium converts the GTF to be formed, yeast selenium and yeast vanadium.
Described yeast expressed GLP-1 is the GLP-1 of rite-directed mutagenesis, and its deputy alanine residue sports sweet Histidine residue；The amino acid residue sequence of GLP-1 after mutation is as shown in SEQ.ID.NO.1.
Described saccharomycete is the saccharomycete of restructuring, using yeast as host cell, is cloned into comprising such as SEQ.ID.NO.2 The expression vector of shown sequence.
Described host cell is GS115 Pichia yeasts or SMD-1168 Pichia yeasts, and described expression vector is PPIC9K carriers, sequence shown in SEQ.ID.NO.2 is cloned in the downstream of pPIC9K carrier alpha factor signal peptides.
Described saccharomycete is the liquid fermentation carried out under methanol induction：15~25mg/L is also added with its culture medium Inorganic chromium, 5~15mg/L inorganic selenium and 10~30mg/L inorganic vanadium；It is inoculated with and amplification cultivation is after 24 hours, stream adds 0.5-1ml/min methanol inductions carry out fermentation expression, and equivalent stream adds the nothing that 30~40mg/L is added with sorbierite, sorbierite The inorganic vanadium of machine chromium, 12~15mg/L inorganic selenium and 30~40mg/L.
A kind of preparation method of the steady sugar yeast bacterium powder of hypoglycemic, including following operation：
1) GLP-1 gene order of the synthesis as shown in SEQ.ID.NO.2, and being cloned into expression vector, is built into GLP-1 recombinant expression carriers；
2) it is transformed into after GLP-1 recombinant expression carriers are linearized in yeast cells, obtains GLP-1 recombination yeasts；
3) GLP-1 recombination yeasts are inoculated on the culture medium in fermentation tank, inorganic chromium is also added with wherein on culture medium Salt, inorganic selenium salt and inorganic vanadium salt；
After amplification cultivation 24 hours, stream plus methanol induction fermentation expression, while stream plus the inorganic salt liquid with methanol equivalent, Contain inorganic chromate salt, inorganic selenium salt and inorganic vanadium salt in inorganic salt liquid；
4) after the completion of induced expression fermentation, saccharomycete is collected by centrifugation, and fully wash；Vacuumize baking to stay overnight, obtain thin Intracellular GLP-1 containing restructuring, GTF, the steady sugar yeast bacterium powder of the hypoglycemic of yeast selenium and yeast vanadium.
Described GLP-1 genes are that the method based on following primer and use fusion DNA vaccine is spliced, described primer For：
GLP-F1:5’tactcgagaaaagacatggtgaagggacctttaccagtg 3’；
GLP-R1:5’tccaaataagaacttacatcactggtaaaggtccc 3’；
GLP-R2:5’tccttggcagcttggccttccaaataagaacttac 3’；
GLP-R3:5’accagccaagcaatgaactccttggcagcttggcc 3’；
GLP-R4:5’atgcggccgctcggcctttcaccagccaagcaatg 3’；
Described GLP-1 recombinant expression carriers are that GLP-1 gene orders are cloned into pPIC9K carrier alpha factor signal peptides Downstream and obtain；
Described yeast is GS115 Pichia yeasts or SMD-1168 Pichia yeasts.
Described culture medium is BSM inorganic mediums, and 15~25mg/L inorganic chromium, 5~15mg/L are also added with base Inorganic selenium and 10~30mg/L inorganic vanadium；After the completion of culture medium configuration, addition ammoniacal liquor is adjusted or ammonium sulfate adjusts pH to be 5.0, is lured Lead and adjust pH to be 6.0 before expression；
30~40mg/L inorganic chromium, 12~15mg/L inorganic selenium and 30~40mg/L are added with described sorbierite Inorganic vanadium.
Application of the steady sugar yeast bacterium powder of described hypoglycemic in reduction blood glucose, the medicine of stabilizing blood sugar or preparation is prepared.
Application of the steady sugar yeast bacterium powder of described hypoglycemic in the medicine or health products for the treatment of type II diabetes is prepared.
Compared with prior art, the present invention has following beneficial technique effect：
Steady sugar yeast bacterium powder of hypoglycemic that the present invention is provided and preparation method thereof, in view of diabetic not draw by single factors Rise, often Different types of etiopathogenises exists simultaneously, and single therapy effect is not good, cleverly propose that single dusty yeast production can be completed Prepared by the multiple drug effect factor, by building GLP-1 recombination yeasts and carrying out inorganic chromium, inorganic selenium and nothing using Yeast fermentation process The conversion of machine vanadium, thus prepare GTF (Glucose Tolerance Factor, GTF) rich in Organic Chromium and Yeast selenium, yeast vanadium.
Steady sugar yeast bacterium powder of hypoglycemic that the present invention is provided and preparation method thereof, realizes effective group of a variety of drug effect factors Close, Islet Cells Insulin secretion is promoted using glucagon-like-peptide-1；GTF lowers insulin resistance, increases Enter the sensitiveness of insulin；Organic yeast selenium promotes the reparation of islet cells, from islet cells reparation, insulin releasing to pancreas islet Plain enhanced sensitivity；Organic vanadium directly plays para-insulin, and the cause of disease for type-II diabetes carries out comprehensive treatment.It is particularly important , these efficiency factors can just be completed by one time fermentation, and be enriched in last fermented yeast, be both easy to Large-scale production, cost is low, and preparation is convenient, safe.
The steady sugar yeast bacterium powder of hypoglycemic that the present invention is provided has hypoglycemic, the effect of steady sugar, can be applied to reduction blood glucose, stably The preparation of the medicine or preparation of blood glucose；Blood glucose can significantly decline upon administration, and after being discontinued 7 days, appropriate administration The blood glucose value of amount illustrates high dose (2mg) stabilizing sugar yeast powder energy stabilizing blood sugar longer time still in normal value；And high dose The ability of the oral steady steady sugar of sugar yeast group is substantially better than melbine positive controls.Experiment also shows that steady sugar yeast is injected intraperitoneally Powder can remarkably promote the secretion of insulin, as a result show that a variety of drug effect factors can play corresponding effect, hypoglycemic, steady sugared effect Substantially.
The present invention can be used for stable and reduce the patients with NIDDM blood glucose for not yet using Remedies for diabetes and auxiliary Help the patients with NIDDM therapeutic effect using treatment Remedies for diabetes；Application including oral tablet or capsule. Oral tablet or capsule include conversion inorganic chromium and selenium formation rich in the expression weight for having GTF and organic yeast selenium The saccharomycete of group glucagon-like-peptide-1, and medical acceptable stabilizer, shape-fixing agent.
Brief description of the drawings
Fig. 1 is zymotic fluid liquid chromatogram；
Fig. 2 is the peptide liquid chromatogram of GLP-1 standard items 26.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, it is described be explanation of the invention and It is not to limit.
To overcome the problem of current diabetes medicament mechanism of action is single, the present invention is pierced from islet cells reparation, insulin Swash release, insulin sensitivity enhancing and directly play the comprehensive consideration such as insulin action, GLP-1 is recombinated using gene technology construction expression The saccharomycete of analog, and easily degraded to solve natural GLP-1 by internal dipeptidyl peptidase IV (DPP-IV), its blood plasma half Decline shortcoming of the phase less than 2 minutes, for DPP-IV degrade GLP-1 recognition site in the second amino acids A, be changed to not by It is the G of enzyme identification, while bioactivity is not influenceed, extends half-life period.With this recombinant gene expression saccharomycete, convert inorganic Chromium, inorganic selenium and inorganic vanadium, form GTF, yeast selenium and yeast vanadium.It is easy to large-scale culture using saccharomycete, The characteristics of cost is low, prepares dusty yeast, and the medicine or health products for preparing treatment type ii diabetes are used for as raw material.
Glucagon-like-peptide-1 (GLP-1) sequence used in the present invention is following ((shown in SEQ.ID.NO.1)：
HXEGTFTSDVSSYLEGQAAKEFIAWLVKGR。
Amino acid abbreviations in sequence：A alanine；R arginine；N asparagines；D aspartic acids；C cysteines；Q paddy Glutamine；E glutamic acid；G glycine；H histidines；I isoleucines；L-Leu；K lysines；M methionines；F phenylalanines； P proline；S serines；T threonines；W tryptophans；Y tyrosine；V a word used in person's names propylhomoserins；X：G glycine.Pass through the second amino acids sequence X change is arranged, being changed to glycine G by natural alanine A makes the simulated series for changing structure to resist dipeptidyl peptidase enzyme degradation, So that Increased Plasma Half-life, drug effect enhancing.
Specific practice is that above-mentioned GLP-1 is expressed in Pichia pastoris.It is synthesis GLP-1 genes first：
The primer used in GLP-1 gene chemical synthesis is as follows：
GLP-F1:5’tactcgagaaaagacatggtgaagggacctttaccagtg 3’；
GLP-R1:5’tccaaataagaacttacatcactggtaaaggtccc 3’；
GLP-R2:5’tccttggcagcttggccttccaaataagaacttac 3’；
GLP-R3:5’accagccaagcaatgaactccttggcagcttggcc 3’；
GLP-R4:5’atgcggccgctcggcctttcaccagccaagcaatg 3’；
The detailed process of fusion DNA vaccine is：25 μM of the μ l of GLP-F1 primers 1 and 25 μM of μ l of GLP-R1 primers 1, be in volume The denaturation (94 DEG C 20 seconds) of 10 circulations, annealing (55 DEG C 20 seconds), extension (72 DEG C 20 seconds) are carried out in 50 μ l PCR reaction solutions, Other components in reaction solution are identical with Standard PCR.Electrophoresis reclaims the fragment that GLP-F1 primers are expanded with GLP-R1 primers, with this Fragment is template, and secondary PCR amplifications are carried out with GLP-F1 primers and GLP-R2 primers, and reaction condition ibid, but is 20 Circulation.Second of the PCR primer reclaimed using electrophoresis carries out the PCR of third time with GLP-F1 primers and GLP-R3 primers as template Amplification, 20 circulations, reaction condition is ibid.The third time PCR primer reclaimed using electrophoresis is template, with GLP-F1 primers and GLP- R4 primers carry out the PCR amplifications of the 4th time, and 25 circulate, and reaction condition is ibid.The product of 4th PCR amplification is complete GLP-1 genes.
They are spliced into using the method for fusion DNA vaccine by complete GLP-1 genes, spliced GLP-1 gene orders are such as Under (shown in SEQ.ID.NO.2)：
5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagc tgccaaggagttcattgcttggctggtgaaaggccgagcggccgcat 3’；
There are 6 bases of xho I restriction endonuclease sites and alpha factor signal peptide end at 5 ' ends of the sequence i.e. tactcgagaaaaga；3 ' ends introduce Not I restriction endonuclease sites.
The structure of expression vector：
By GLP-1 gene outcomes Xho I and Not the I double digestions rear clone expanded with PCR to pPIC9K carriers, digestion The positive colony tentatively confirmed carries out sequencing, confirms that GLP-1 genes are cloned under pPIC9K carrier alpha factor signal peptides Trip.The positive colony of confirmation is extracted plasmid, after Sal I digestions are linear, GS115 Pichia yeasts converted, then is G418 and resist Property screening, obtain anti-4mg/ml G418 Yeast engineering bacteria.
It is prepared by the fermented and cultured and bacterium powder of saccharomycete：
Yeast engineering bacteria uses conventional method culture with fermentation tank, and fermentation expression is carried out under methanol induction, in induction table Up to phase addition chromium trichloride 0.2g/L, sodium selenite 30mg/L and ammonium metavanadate 0.1g/L, induced expression is after 10 hours.Zymotic fluid Through saccharomycete is collected by centrifugation, distilled water centrifuge washing three times removes the medium component being infected with harvested saccharomycete thalline, Inorganic chromium and inorganic selenium remaining in zymotic fluid is removed, 80 DEG C vacuumize baking and stay overnight, be made intracellular rich in GLP-1 and grape Yeast selenium, the vanadium dry powder of the sugar tolerance factor.
Specifically fermentation expression is：
Yeast engineering bacteria carries out fermentation expression using conventional method under methanol induction.Fermentation is in Germany ' Bei Lang ' 30-L hairs Carried out in fermentation tank, first in BSM inorganic mediums：Composition is H3PO426.7ml/L；CaSO4-H2O0.93g/L；K2SO418.2g/ L；MgSO4-2H2O14.9g/L；KOH4.13g/L；Glycerine 40g/L；PMT1 4.0ml/L.On this basis, 15~25mg/ is added L chromium (preferred chromium 20mg/L is 0.1g/L using additive capacity during chromium trichloride), 5~15mg/L selenium (preferably selenium 8mg/L, Using additive capacity during sodium selenite be 20mg/L) and 10~30mg/L vanadium (preferably vanadium 20mg/L, adds during using ammonium metavanadate Plus dosage is 50mg/L).
After the completion of culture medium configuration, 100% ammoniacal liquor of addition adjusts pH5.0 or 10g/L ammonium sulfate to adjust pH5.0, and ammoniacal liquor is used for Tank adjusts pH.PH6.0 is adjusted before induced expression.PH5.0 be in order to prevent BSM formation calcium phosphate precipitation, pH6.0 be expressing protein most Suitable pH.Add the PTM14.0ml/L of 4.0ml/L filtration sterilizations after BSM autoclavings again.
PMT1 (1L) is formulated：CuSO4-5H2O6.0g/L；KI0.088g/L；MnSO4-H2O3.0g/L；Na2MoO4- 2H2O0.2g/L；H3BO30.02g/L；CoCl2-6H2O0.5g/L；ZnCl220.0g/L；FeSO4-7H2O65.0g/L；Biotin 0.2g/L；Dense H2SO45.0ml。
Amplification cultivation 24 hours, then stream plus 0.5-1ml/min methanol inductions progress fermentation expression, flow in the induced expression phase Plus while methanol, stream plus the inorganic chromium that with the addition of 30~40mg/L of Isodose, 12~15mg/L inorganic selenium and 30~ 40mg/L inorganic vanadium (preferred chromium 40mg/L, selenium 12mg/L and vanadium 40mg/L, it is specific using addition chromium trichloride 0.2g/L, Sodium selenite 30mg/L and ammonium metavanadate 0.1g/L) sorbitol solution, induced expression is after 10 hours.Saccharomycete is crushed into supernatant Liquid carries out liquid-phase chromatographic analysis and is compared with the peptide of GLP-1 standard items 26, determines the main component of zymotic fluid.
As a result respectively as shown in Figure 1 and Figure 2, it can be seen that the appearance time of zymotic fluid and standard items is basically identical, as a result table Bright expression of recombinant yeast has GLP-1.
Zymotic fluid is through being collected by centrifugation saccharomycete, distilled water centrifuge washing three times, removes in zymotic fluid remaining in the medium Inorganic chromium, inorganic selenium and inorganic vanadium, 80 DEG C are dried in vacuum overnight, be made it is intracellular be rich in GLP-1 and GTF Yeast selenium, vanadium dry powder.Stabilizing sugar yeast powder is prepared as raw material and is used subsequently to Experiment on therapy to diabetic animal models.
The measure of chromium, selenium and vanadium in stabilizing sugar yeast powder
Dusty yeast distilled water centrifuge washing three times, fully removes out inorganic ions in the culture medium that may be infected with, and vacuum is done Dry dehydration, accurately weighs 1 gram of yeast dry powder, with inductance couples high frequency plasma emission spectrometry (ICP-AES) determine chromium, selenium, The content of vanadium, using commercially available Angel Yeast as control.
Chromium, selenium, vanadium, lead content testing result
Stabilizing sugar yeast powder is used for the Experiment on therapy of GK type ii diabetes rat models：
GK type ii diabetes rat 40 (every body weight is in 200g ± 10g), is divided into 4 groups, every group 10；First group is Diformin tablet positive controls, second group is physiological saline negative control group, the 3rd, the 4th group be stabilizing sugar yeast powder experiment Group；Blood is all extracted before 40 GK rat experiments, serum is separated, stored frozen is to be measured.The daily mouth of every rat of experimental group is fed 0.5ml, the 3rd group of dusty yeast containing 10mg；4th group of dusty yeast containing 2mg.Every Oral Administration in Rats of diformin tablet positive controls 0.5ml, the melbine containing 40 μ g；Every Oral Administration in Rats 0.5ml of negative control group physiological saline.After continuous 30 days, immediately Blood drawing, separates serum, and stored frozen is to be measured.After being discontinued 7 days, then take a blood sample respectively, serum is separated, together with above two batches stored frozen Serum to be measured together, detects the concentration of blood glucose, as a result see the table below 1：
The stabilizing sugar yeast powder of table 1 is used for the blood glucose test results of GK type ii diabetes rat models
3 groups and the positive controls blood glucose value after successive administration 30 days are tested as can be seen from the above table all falls below normal value Level (normal rat blood glucose value 4.9-6.2), experiment 4 groups of blood glucose also significantly decline.The blood of positive controls after being discontinued 7 days Sugared value has been returned to exceptional value again, and the blood glucose value for testing 3 groups illustrates that high dose stabilizing sugar yeast powder can be maintained more still in normal value The long time.
Stabilizing sugar yeast powder glucose tolerance test：
In above-mentioned experiment, stabilizing sugar yeast powder is after oral 30 days, every rats by intraperitoneal injection 0.5ml, 40% glucose, In 0.5 hour after injectable dextrose monohydrate, 1 hour, 2 hours take a blood sample, separate serum, determine blood glucose.Blood sugar detection the results are shown in Table 2, from As can be seen that the ability of heavy dose of oral steady steady sugar of sugar yeast group is substantially better than melbine positive controls in table.
2 oral 30 days later blood glucose test results of table
GLP-1 promoting insulin secretion
Experiment material and method：
NOD mouse (Chinese Academy of Sciences's Shanghai animal center is provided)
0.9%NaCl solution, stabilizing sugar yeast powder, melbine
Radio-immunity insulin assay kit (ministry of Health of China Shanghai institute of Biological Products product)
NOD mouse are divided into three groups.First with scale capillary (elder generation is with 1mg/mL heparin rinse capillary tube inner walls and dries) Take 50 microlitres of blood from eye sinus, then three groups of mouse be injected intraperitoneally respectively 200 microlitres containing 40 micrograms melbine liquid, 200 microlitres Dusty yeast liquid and 200 microlitres of physiological saline containing 10mg, and remember to be now zero moment.Then respectively at 5, press within 10,20,30 minutes Same operation takes blood.Take each blood sample after blood to be added immediately in the centrifuge tube for filling 50 microlitres of physiological saline, mix, 3000 revs/min Red blood cell is centrifuged off, serum insulin concentration is determined by radioimmunoassay kitss application method, to examine GLP-1 rush pancreas Island element secretion.
Experimental result is as shown in table 3.The result shows that intraperitoneal injection stabilizing sugar yeast powder can remarkably promote point of insulin Secrete.
The promoting insulin secretion of the stabilizing sugar yeast powder of table 3.
Time after administration 0min 5min 10min 20min 30min
Melbine 2.88 3.56 2.88 2.67 2.45
Stabilizing sugar yeast powder 3.11 9.76 10.63 11.23 6.27
Control group 2.09 2.07 1.80 1.90 1.86
Note：Insulin levels are in table：10- 6International unit
Above-mentioned detection shows that intraperitoneal injection hypoglycemic stabilizing sugar yeast powder can remarkably promote the secretion of insulin, as a result shows many Corresponding effect can be played by planting the drug effect factor, and hypoglycemic, steady sugar effect are obvious.It can be applied to reduction blood glucose, the medicine of stabilizing blood sugar The preparation of thing or preparation；The patients with NIDDM blood glucose of Remedies for diabetes and auxiliary is not yet used available for stable and reduction Help the patients with NIDDM therapeutic effect using treatment Remedies for diabetes.The steady sugar yeast bacterium powder of described hypoglycemic is in system Application in the medicine or health products of standby treatment type II diabetes.

Claims (8)

1. a kind of steady sugar yeast bacterium powder of hypoglycemic, it is characterised in that it is described it is yeast expressed have a GLP-1, and containing by inorganic chromium, Inorganic selenium and inorganic vanadium convert the GTF to be formed, yeast selenium and yeast vanadium；
Described yeast expressed GLP-1 is the GLP-1 of rite-directed mutagenesis, and its deputy alanine residue sports glycine Residue；The amino acid residue sequence of GLP-1 after mutation is as shown in SEQ.ID.NO.1；
Described saccharomycete is the liquid fermentation carried out under methanol induction：15~25mg/L nothing is also added with its culture medium The inorganic vanadium of machine chromium, 5~15mg/L inorganic selenium and 10~30mg/L；It is inoculated with and amplification cultivation is after 24 hours, stream plus 0.5- 1ml/min methanol inductions carry out fermentation expression, and equivalent stream add it is inorganic added with 30~40mg/L in sorbierite, sorbierite The inorganic vanadium of chromium, 12~15mg/L inorganic selenium and 30~40mg/L.
2. the steady sugar yeast bacterium powder of hypoglycemic as claimed in claim 1, it is characterised in that described saccharomycete is the yeast of restructuring Bacterium, using yeast as host cell, is cloned into the expression vector for including the sequence as shown in SEQ.ID.NO.2.
3. the steady sugar yeast bacterium powder of hypoglycemic as claimed in claim 2, it is characterised in that described host cell is finished red for GS115 Saccharomycete or SMD-1168 Pichia yeasts, described expression vector are pPIC9K carriers, the clone of sequence shown in SEQ.ID.NO.2 In the downstream of pPIC9K carrier alpha factor signal peptides.
4. a kind of preparation method of the steady sugar yeast bacterium powder of hypoglycemic, it is characterised in that including following operation：
1）The GLP-1 gene orders as shown in SEQ.ID.NO.2 are synthesized, and are cloned into expression vector, GLP-1 is built into Recombinant expression carrier；
2）It is transformed into after GLP-1 recombinant expression carriers are linearized in yeast cells, obtains GLP-1 recombination yeasts；
3）GLP-1 recombination yeasts are inoculated on the culture medium in fermentation tank, inorganic chromate salt, nothing are also added with wherein on culture medium Machine selenium salt and inorganic vanadium salt；
After amplification cultivation 24 hours, stream plus methanol induction fermentation expression, while stream plus the sorbierite with methanol equivalent, sorbierite In contain inorganic chromate salt, inorganic selenium salt and inorganic vanadium salt；
4）After the completion of induced expression fermentation, saccharomycete is collected by centrifugation, and fully wash；Vacuumize baking to stay overnight, obtain intracellular The GLP-1 containing restructuring, GTF, the steady sugar yeast bacterium powder of the hypoglycemic of yeast selenium and yeast vanadium.
5. the preparation method of the steady sugar yeast bacterium powder of hypoglycemic as claimed in claim 4, it is characterised in that described GLP-1 genes It is that the method based on following primer and use fusion DNA vaccine is spliced, described primer is：
GLP-F1: 5’ tactcgagaaaagacatggtgaagggacctttaccagtg 3’；
GLP-R1: 5’ tccaaataagaacttacatcactggtaaaggtccc 3’；
GLP-R2: 5’ tccttggcagcttggccttccaaataagaacttac 3’；
GLP-R3: 5’ accagccaagcaatgaactccttggcagcttggcc 3’；
GLP-R4: 5’ atgcggccgctcggcctttcaccagccaagcaatg 3’；
Described GLP-1 recombinant expression carriers are the downstreams that GLP-1 gene orders are cloned into pPIC9K carrier alpha factor signal peptides And obtain；
Described yeast is GS115 Pichia yeasts or SMD-1168 Pichia yeasts.
6. the preparation method of the steady sugar yeast bacterium powder of hypoglycemic as claimed in claim 4, it is characterised in that described culture medium is BSM inorganic mediums, wherein be also added with 15~25mg/L inorganic chromium, 5~15mg/L inorganic selenium and 10~30mg/L Inorganic vanadium；After the completion of culture medium configuration, addition ammoniacal liquor is adjusted or ammonium sulfate adjusts pH to be 5.0, and it is 6.0 that pH is adjusted before induced expression；
The nothing of inorganic chromium added with 30~40mg/L, 12~15mg/L inorganic selenium and 30~40mg/L in described sorbierite Machine vanadium.
7. the steady sugar yeast bacterium powder of hypoglycemic described in claim 1 is in reduction blood glucose, the medicine of stabilizing blood sugar or preparation is prepared Using.
8. application of the steady sugar yeast bacterium powder of hypoglycemic in the medicine for preparing treatment type II diabetes described in claim 1.
CN201410448434.8A 2014-09-04 2014-09-04 A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application Expired - Fee Related CN104257696B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410448434.8A CN104257696B (en) 2014-09-04 2014-09-04 A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410448434.8A CN104257696B (en) 2014-09-04 2014-09-04 A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application

Publications (2)

Publication Number Publication Date
CN104257696A CN104257696A (en) 2015-01-07
CN104257696B true CN104257696B (en) 2017-08-25

Family

ID=52149353

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410448434.8A Expired - Fee Related CN104257696B (en) 2014-09-04 2014-09-04 A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application

Country Status (1)

Country Link
CN (1) CN104257696B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105153311B (en) * 2015-07-17 2018-09-04 山东泉港药业有限公司 Recombinant human glucagon-like peptide-1 mutant fusion protein and preparation method thereof
CN106666380A (en) * 2016-12-29 2017-05-17 广东省农业科学院蚕业与农产品加工研究所 Preparation method and application of compound food base material enriched with blood glucose reducing factors
CN109652355A (en) * 2019-02-12 2019-04-19 西安培华学院 A kind of hypoglycemic bafillus natto and preparation method and application
CN109730270B (en) * 2019-02-12 2022-06-28 西安培华学院 Sugar-reducing yeast fermented pumpkin powder and preparation method and application thereof
CN113512520B (en) * 2021-04-29 2022-04-26 右江民族医学院 Chromium-and zinc-rich acetobacter and preparation method and application thereof
CN113462713B (en) * 2021-09-06 2021-12-07 中国农业科学院生物技术研究所 Method for improving expression level of glucagon-like peptide hexa-linked peptide in pichia pastoris

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1483041A (en) * 2000-12-07 2004-03-17 GLP-1 fusion protein
CN101003574A (en) * 2006-02-21 2007-07-25 大连帝恩生物工程有限公司 Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
CN102783636A (en) * 2012-06-04 2012-11-21 于长富 Food nutrition supplement for prophylaxis and treatment of diabetes and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1483041A (en) * 2000-12-07 2004-03-17 GLP-1 fusion protein
CN101003574A (en) * 2006-02-21 2007-07-25 大连帝恩生物工程有限公司 Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
CN102783636A (en) * 2012-06-04 2012-11-21 于长富 Food nutrition supplement for prophylaxis and treatment of diabetes and application thereof

Also Published As

Publication number Publication date
CN104257696A (en) 2015-01-07

Similar Documents

Publication Publication Date Title
CN104257696B (en) A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application
CN101624570B (en) Method for cultivating cultured ganoderma lucidum with Chinese medicaments and method for preparing cultured ganoderma lucidum health-care product
CN104082740B (en) A kind of have intervention or the composition improving diabetes and preparation method thereof
CN102428832A (en) Fungal pharmaceutical mycoplasm with blood sugar lowering efficacy and preparation method thereof
CN101724667A (en) Technology for extracting dendrobium polysaccharide by applying biology engineering enzyme technology and product thereof and application
EP3574912B1 (en) Composition for treating diabetic disease
CN100473415C (en) Health-care product for treating cardiovascular and cerebralvascular disease
CN103168882A (en) Health-care tea beneficial to reducing blood glucose and slowing down diabetic complications
CN107343889A (en) A kind of peacilomyce hepiahi bacterium fermentation culture medium for being used to treat the 1st type or diabetes B
CN102266388B (en) Pharmaceutical composition for preventing and treating type 2 diabetes and complication thereof
CN107095300A (en) A kind of biological nutrition compound composition of auxiliary treatment diabetes
CN102657730A (en) Rhodiola rosea buccal preparations for resisting altitude reaction
CN107537028B (en) Formula for simultaneously assisting in reducing blood sugar and blood pressure and preparation method thereof
CN104857180B (en) Composition for resisting fatigue and improving immunity and preparation method and application thereof
CN1895540A (en) Medicinal composition for treating cardiovascular disease, its making method and use
CN103251876A (en) Traditional Chinese medicine composition used for treating chronic liver diseases
CN106138900A (en) Auxiliary treats hyperglycemia and the compositions of diabetic complication and application thereof
CN106474455A (en) A kind of application in preparing anti-type ii diabetes medicine or health product for Folium Camelliae sinensis polypeptide
CN108812051B (en) Cordyceps militaris culture method
CN105941768A (en) Camellia chrysantha tuyama containing ganoderma lucidum hyphae
CN102274285B (en) Pharmaceutical composition for treating type 2 diabetes and complications thereof
CN101032562A (en) Health care product having functions of conditioning blood pressure and protecting haemal system of heart and brain
CN1857509A (en) Health composition for strengthening women's immunity and its preparing method
CN104491496B (en) Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared
CN102274514B (en) Medicinal composition for preventing and treating type-II diabetes and complications thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20170825

Termination date: 20180904

CF01 Termination of patent right due to non-payment of annual fee