CN104257696A - Yeast powder for reducing and stabilizing blood sugar as well as preparation method and application of yeast powder - Google Patents
Yeast powder for reducing and stabilizing blood sugar as well as preparation method and application of yeast powder Download PDFInfo
- Publication number
- CN104257696A CN104257696A CN201410448434.8A CN201410448434A CN104257696A CN 104257696 A CN104257696 A CN 104257696A CN 201410448434 A CN201410448434 A CN 201410448434A CN 104257696 A CN104257696 A CN 104257696A
- Authority
- CN
- China
- Prior art keywords
- yeast
- inorganic
- glp
- selenium
- insulin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
- A61K36/062—Ascomycota
- A61K36/064—Saccharomycetales, e.g. baker's yeast
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/10—Preparation or pretreatment of starting material
- A61K2236/19—Preparation or pretreatment of starting material involving fermentation using yeast, bacteria or both; enzymatic treatment
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Mycology (AREA)
- Inorganic Chemistry (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Engineering & Computer Science (AREA)
- Alternative & Traditional Medicine (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Medical Informatics (AREA)
- Microbiology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention discloses yeast powder for reducing and stabilizing blood sugar as well as a preparation method and application of the yeast powder. The yeast is expressed as GLP-1, and contains a glucose tolerance factor, selenium yeast and vanadium yeast converted by inorganic chromium, inorganic selenium and inorganic vanadium. According to the yeast powder disclosed by the invention, islet cells are promoted to secrete insulin through glucagon-like peptide-1; through the glucose tolerance factor, insulin resistance is reduced and insulin sensitivity is enhanced; and through the organic selenium yeast, repairing of the islet cells is promoted. From islet cell repairing and insulin releasing to insulin sensitizing, the organic vanadium directly serves as para-insulin and comprehensively treats pathogen of type II diabetes, and an effect is much better than that of a single treatment scheme; moreover, multiple efficacy factors are prepared through single yeast powder production; the yeast powder is easy for mass production, low in cost, and more economical and applicable.
Description
Technical field
The invention belongs to diabetes control technical field, relate to steady sugar yeast mycopowder of a kind of blood sugar lowering and its preparation method and application.
Background technology
Diabetes have been listed in the third-largest killer after cardiovascular and cerebrovascular disease and tumor.Along with the change of life pattern, dietary structure, global diabetes prevalence is in the trend sharply risen.Expect the year two thousand thirty, world's diabetes number of patients will increase to 3.66 hundred million people, and diabetes will become a heavy burden of a lot of family and society.
The cause of disease of type ii diabetes patient is many-sided, some patients are the deficiencies due to amount of insulin secretion, but insulin not only has no lack of on the contrary higher than normally in some diabetes human body, its cause of disease is to insulin insensitivity (i.e. insulin resistant).In type ii diabetes patient, most people inevitably treats with medicine.Etiotropic difference, oral antidiabetic drug can be divided into three major types: the first kind is yellow ureas, as glyburide, gliquidone, diamicron, glipizide etc.; Yellow ureas medicine can stimulate islet secretion insulin, but insulin secretion many after, can cause hypoglycemia, hypoglycemia is a more very important risk factor for patients, and some drugs has larger side effect, as caused liver dysfunction.Equations of The Second Kind medicine is biguanide drug, as insoral and metformin.Biguanide drug does not stimulate insulin secretion, it stimulates body to improve the utilization of insulin on a cellular level, it for be patient to insulin insensitivity, but for the diabetics of hypoinsulinism, its effect played is just very limited, and also has the untoward reaction such as lactic acidosis.3rd class medicine is a glycosidase inhibitor, as acarbose.The effect of this kind of medicine reduces the absorption of human body to sugar in diet, reduces, thus slow down blood glucose rising because absorb.But the side effect of this medicine comprises gastrointestinal reaction; And the bad assurance of its dosage, take rear easy generation hypoglycemic reaction, when the time comes will oral or intravenous glucose injection.
Very fast to insulinotropic peptide GLP-1-1 progress in recent years, and achieved good curative effect with its treatment type Ⅱdiabetes mellitus.GLP-1 promotes islet β cell insulin in concentration of glucose dependency mode, and reduces alpha Cell of islet secretion glucagon (glucagon), thus reduces blood glucose.Normal person is after dining, and secretin starts secretion, and GLP-1 wherein promotes insulin secretion, to reduce the fluctuation of post-prandial glycemia.But " secretin's effect " of type ii diabetes patient is impaired, main manifestations is that after having meal, GLP-1 concentration elevation amplitude calibration ordinary person reduces to some extent, and its GLP-1 promotes that insulin secretion and hypoglycemic effect there is no obviously impaired, therefore GLP-1 and analog thereof are important target spots for the treatment of type ii diabetes.
GLP-1 plays blood sugar reducing function mainly through following several respects: 1. act on beta Cell of islet, promote the transcribing of insulin gene, the synthesis of insulin and secretion, and propagation and the differentiation of beta Cell of islet can be stimulated, suppress islet beta-cell apoptosis, increase beta Cell of islet quantity.2. act on alpha Cell of islet, consumingly the release of glucagon suppression, and act on delta Cell of islet, the secretion of growth promoting effects chalone, somatostatin can be used as again the secretion that paracrine hormone participates in glucagon suppression.GLP-1 has concentration of glucose dependency blood sugar reducing function.As a kind of Entero hormone, GLP-1 is just released into blood under the stimulation of nutrient substance particularly carbohydrate, and its promoting insulin secretion is concentration of glucose dependency.So GLP-1 has concentration of glucose dependency blood sugar reducing function, namely only when blood sugar level raises, GLP-1 just plays blood sugar reducing function; And when blood sugar level is normal, then it can not be made to reduce further.This concentration of glucose dependency blood sugar lowering characteristic of GLP-1 is basis and the guarantee of its clinical practice safety, thus eliminates people may cause patient's severe hypoglycemia worry to existing Remedies for diabetes and scheme.
In addition, organic selenium can strengthen the repair of GLP-1 to beta Cell of islet.Now confirm, scarce selenium and 40 various diseases have direct or indirect relation, particularly cancer, cardiovascular disease, diabetes, hepatopathy etc.There are some researches show, M & M and the selenium level of tumor are negative correlation; Sickness rate and the mortality rate of low selenium area tumor are higher, and in tumor patient body, selenium horizontal calibration ordinary person is low.In China more than 40 years old crowd, the sickness rate of diabetes is 20.44%.The state-run health-nutrition institute of Japan finds: scarce selenium is one of inducement suffering from diabetes.Selenium is decided to be by medical circle " anticancer king ", and selenium supplement contributes to the islet cells reparation of disease damage simultaneously.Yeast selenium is the preferably source of current selenium supplement, yeast rich in selenium is the organic selenium source of one utilizing yeast to develop, it is produced in the cell protein structure of growth yeast by Se accumulation, proved yeast rich in selenium more than inorganic selenium safety, stable, easily to absorb, effectively and pollute few, and there is many-sided health care.
The Main Function of selenium supplement comprises 1. antioxidation: the height of selenium level directly affects antioxidant ability of organism, and the resistivity to relevant disease; 2. normal immunological function is maintained; 3. antitumor action: U.S. Combs GF Jr found from the analysis to more than 100 epidemiological study reports in 1989, the selenium having the account visible subsidy of 2/3 to fill higher than nutritional requirement can lower cancer morbidity, wherein has that the account publicly price-reduction of half is low reaches more than 50%; 4. the effect of slow down aging: free radical and lipid peroxidation are the principal elements causing membrane damage and promote ager process.Oxidant defense system, particularly vitamin E in body and the synergism of selenium serve antioxidation, slow down the effect of ager process.Show in diabetes study, selenium plays obvious facilitation in beta Cell of islet repair process.
Stimulate insulin releasing, the subproblem of type ii diabetes patient can only be solved, also should solve the problem of Insulin Resistance simultaneously, namely strengthen the sensitivity of insulin.Nineteen fifty-seven, Schwarz and Mertz observes the effect of chromium in carbohydrate metabolism, confirms Cr
3+it is the active ingredient of glucose tolerance factor in beer yeast (Glucose Tolerance Factor, GTF).Afterwards, Mertz confirmed that GTF was that glutamic acid, glycine and cysteine are the material of part with nicotinic acid-trivalent chromium-nicotinic acid for axle center, was the reinforcing agent of insulin, by the metabolism of insulin impact sugar, protein, fat and nucleic acid.The mechanism of action of chromium is the adhesion that can increase insulin and receptor, the phosphorylation etc. increasing Insulin receptor INSR quantity, increase Insulin receptor INSR.
Inorganic chromium is in the process of yeast cells sorption enhanced organic chromium, and form glucose tolerance factor, the main chromium component as yeast chromium is natural Regulation of blood glucose agent.Chromium plays special effect in body carbohydrate metabolism and lipid metabolism, and be the trace element of needed by human, it can activate insulin active, regulates blood glucose, suppresses sugar to be converted into fat.The biological activity chromium contained in yeast chromium can up to 10%-15% at the absorbance of human body, and its absorbance is 672% of inorganic chlorinating chromium; Effect of yeast chromium is embodied in: the blood glucose reducing diabetics, also can improve its hypoglycemic reaction, have the dual regulation effect to blood glucose, effectively can control diabetes, eliminates the abnormal phenomena of glucose tolerance aspect; Can obviously fall Zhi serum cholesterol level, alleviate arteriosclerosis symptom; Effectively can increase human muscle, reduce fat; Can organism endocrine be improved, strengthen anti-stress ability.
More than effect is around insulin main shaft, namely stimulates insulin releasing and strengthens insulin sensitivity.Have directly play insulin action nutrient substance which? vanadium is trace element necessary in human body, and vanadium has the effect of similar insulin, has certain effect to the treatment of diabetes and prevention tool.The blood glucose of 1 type and type 2 diabetes mellitus laboratory animal can be reduced.Give a certain amount of vanadium, obviously can improve the insulin resistant of diabetics, reduce insulin requirement amount.Vanadium can also increase the sensitivity of insulin, extends the action time of insulin
The first time such as Heyliger in 1985 finds that vanadate has blood sugar reducing function to diabetes white mouse, thereafter the series of animal experiments research of numerous scientist shows, vanadium is all effective, particularly effective to severe insulin opposing type animal to insulin dependent diabetes mellitus (IDDM) (IDDM) and non-insulin-dependent diabetes mellitus (NIDDM).Vanadium has the same effect of insulin in human body, promotes lipogenesis, suppresses the effect of decomposing.Its effect suppresses hepatic gluconeogenic enzymatic activity, reduces glyconeogenesis, suppresses the activity of tyrosine phospholipase, and in insulin transmission signal path, play the effect of receptor, thus reduce hyperglycemia.Japanese Scientists finds, vanadium has " natural decomposition " of the fat suppressed caused by obesity and suppresses the effect of free fatty (FFA), the steatolysis suppressing catecholamine to produce while can promoting the lipogenesis because of insulin, effectively can reduce hyperglycemia.The great professor (capital of a country pharmaceutical university) of nineteen ninety-five Sakurai takes the clinical trial of 60mg Sulfovanadic acid every day by diabetics, prove that vanadium effectively reduces blood glucose.Confirm that vanadium has the same effect of insulin, especially vanadium does not also affect insulin secretion, can increase the sensitivity of tissue to insulin.Even when insulin application was lost efficacy, vanadate still can play antidiabetic effect effectively, and the approach made new advances is opened up in the treatment of the diabetes patient for insulin resistant by this.
Research shows, even if cut out vfanadium compound, blood sugar reducing function still can maintain the long period, and this is the incomparable advantage of insulin and the antidiabetic drug that uses at present.Vanadium can increase the combination rate of insulin receptor in GDM pregnant women placental, carbohydrate metabolism can be improved, have passed Winter etc. in 1 clinical trial phase in Britain and compare vfanadium compound and rosiglitazone (insulin sensitizers) to the therapeutical effect of diabetes white mouse, result display vanadium makes white mouse insulin sensitivity obviously improve, and maintain form and the distribution of normal pancreatic islet cells, close with rosiglitazone in treating group curative effect, and its white mouse body weight control is more stable.
Summary of the invention
The problem that the present invention solves is to provide steady sugar yeast mycopowder of a kind of blood sugar lowering and its preparation method and application, the preparation of the multiple drug effect factor of the Different types of etiopathogenises for diabetes is completed by single yeast powder, effect is much better than single therapy scheme, and be easy to large-scale production, cost is low, is suitable for more economically.
The present invention is achieved through the following technical solutions:
The steady sugar yeast mycopowder of a kind of blood sugar lowering, described yeast expressedly have GLP-1, and containing transforming by inorganic chromium, inorganic selenium and inorganic vanadium the glucose tolerance factor, yeast selenium and the yeast vanadium that are formed.
Described yeast expressed GLP-1 is the GLP-1 of rite-directed mutagenesis, and its deputy alanine residue sports glycine residue; The amino acid residue sequence of the GLP-1 after sudden change is as shown in SEQ.ID.NO.1.
Described yeast is the yeast of restructuring, using yeast as host cell, is cloned into the expression vector comprising sequence as shown in SEQ.ID.NO.2.
Described host cell is GS115 Pichia yeast or SMD-1168 Pichia yeast, and described expression vector is pPIC9K carrier, and sequence clone shown in SEQ.ID.NO.2 is in the downstream of pPIC9K carrier alpha factor signal peptide.
Described yeast is the liquid fermentation carried out under methanol induction: the inorganic vanadium being also added with the inorganic chromium of 15 ~ 25mg/L, the inorganic selenium of 5 ~ 15mg/L and 10 ~ 30mg/L in its culture medium; Also amplification cultivation is after 24 hours in inoculation, and stream adds 0.5-1ml/min methanol induction and carries out fermentation expression, and equivalent stream adds sorbitol, is added with the inorganic vanadium of the inorganic chromium of 30 ~ 40mg/L, the inorganic selenium of 12 ~ 15mg/L and 30 ~ 40mg/L in sorbitol.
A preparation method for the steady sugar yeast mycopowder of blood sugar lowering, comprises following operation:
1) the GLP-1 gene order of synthesis as shown in SEQ.ID.NO.2, and be cloned in expression vector, be built into GLP-1 recombinant expression carrier;
2) will be transformed in yeast cells after the linearisation of GLP-1 recombinant expression carrier, obtain GLP-1 recombination yeast;
3) GLP-1 recombination yeast is inoculated in the culture medium in fermentation tank, wherein culture medium is also added with inorganic chromate salt, inorganic selenium salt and inorganic vanadic salts;
In amplification cultivation after 24 hours, stream adds methanol induction fermentation expresses, and stream adds the inorganic salt liquid with methanol equivalent simultaneously, containing inorganic chromate salt, inorganic selenium salt and inorganic vanadic salts in inorganic salt liquid;
4) after abduction delivering has fermented, collected by centrifugation yeast, and fully wash; Evacuation baking is spent the night, and obtains the steady sugar yeast mycopowder of blood sugar lowering that cell includes restructuring GLP-1, glucose tolerance factor, yeast selenium and yeast vanadium.
Described GLP-1 gene is based on following primer and adopts the method for fusion DNA vaccine to be spliced, and described primer is:
GLP-F1:5’tactcgagaaaagacatggtgaagggacctttaccagtg?3’；
GLP-R1:5’tccaaataagaacttacatcactggtaaaggtccc?3’；
GLP-R2:5’tccttggcagcttggccttccaaataagaacttac?3’；
GLP-R3:5’accagccaagcaatgaactccttggcagcttggcc?3’；
GLP-R4:5’atgcggccgctcggcctttcaccagccaagcaatg?3’；
The downstream that GLP-1 gene order is cloned into pPIC9K carrier alpha factor signal peptide by described GLP-1 recombinant expression carrier obtains;
Described yeast is GS115 Pichia yeast or SMD-1168 Pichia yeast.
Described culture medium is BSM inorganic medium, is also added with the inorganic vanadium of the inorganic chromium of 15 ~ 25mg/L, the inorganic selenium of 5 ~ 15mg/L and 10 ~ 30mg/L in base; After culture medium has configured, interpolation ammonia is adjusted or ammonium sulfate adjusts pH to be 5.0, adjusts pH to be 6.0 before abduction delivering;
The inorganic vanadium of the inorganic chromium of 30 ~ 40mg/L, the inorganic selenium of 12 ~ 15mg/L and 30 ~ 40mg/L is added with in described sorbitol.
The application of the steady sugar yeast mycopowder of described blood sugar lowering in the medicine or preparation of preparation reduction blood glucose, stabilizing blood sugar.
The application of the steady sugar yeast mycopowder of described blood sugar lowering in the medicine or health product of preparation treatment type Ⅱdiabetes mellitus.
Compared with prior art, the present invention has following useful technique effect:
Steady sugar yeast mycopowder of blood sugar lowering provided by the invention and preparation method thereof, in view of diabetics is not that single factors causes, Different types of etiopathogenises exists simultaneously often, and single therapy poor effect, propose the production of single yeast powder cleverly and can complete the preparation of the multiple drug effect factor, by building GLP-1 recombination yeast and utilizing Yeast fermentation process to carry out the conversion of inorganic chromium, inorganic selenium and inorganic vanadium, thus glucose tolerance factor (Glucose Tolerance Factor, GTF) and yeast selenium, the yeast vanadium of organic chromium are rich in preparation.
Steady sugar yeast mycopowder of blood sugar lowering provided by the invention and preparation method thereof, achieves the efficient combination of the multiple drug effect factor, utilizes glucagon-like-peptide-1 to promote Islet Cells Insulin secretion; Glucose tolerance factor lowers insulin resistant, promotes the sensitivity of insulin; Organic yeast selenium promotes the reparation of islet cells, from islet cells reparation, insulin releasing to insulin sensitivity enhancing; Organic vanadium directly plays para-insulin effect, and the cause of disease for type-II diabetes carries out omnibearing treatment.Significantly, these efficiency factors just can be completed by one time fermentation, and are enriched in last fermented yeast, and be both easy to large-scale production, cost is low, and preparation is convenient, and safety is high.
The steady sugar yeast mycopowder of blood sugar lowering provided by the invention has the effect of blood sugar lowering, steady sugar, can be applicable to reduce blood glucose, the medicine of stabilizing blood sugar or the preparation of preparation; Blood glucose can significantly decline upon administration, and in drug withdrawal after 7 days, the blood glucose value of suitable dosage, still in normal value, illustrates the time that the steady sugar yeast powder energy stabilizing blood sugar of high dose (2mg) is longer; And the ability of the steady sugar of the steady sugar yeast group of high dose oral is obviously better than metformin positive controls.Experiment also shows that the steady sugar yeast powder of lumbar injection significantly can promote the secretion of insulin, and result shows the multiple drug effect factor all can play corresponding effect, blood sugar lowering, steady sugared successful.
The present invention can be used for stablizing and reducing not yet using the patients with NIDDM blood glucose of Remedies for diabetes and the auxiliary patients with NIDDM therapeutic effect having used treatment Remedies for diabetes; Comprise the application of oral tablet or capsule.Oral tablet or capsule comprise conversion inorganic chromium and selenium forms the yeast being rich in the expression Gluca Gen sample peptide-1 of glucose tolerance factor and organic yeast selenium, and medical acceptable stabilizing agent, shape-fixing agent.
Accompanying drawing explanation
Fig. 1 is fermentation liquid liquid chromatogram;
Fig. 2 is GLP-1 standard substance 26 peptide liquid chromatogram.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.
For overcoming the single problem of current diabetes medicament mechanism of action, the present invention is from islet cells reparation, insulin stimulating discharges, insulin sensitivity enhancing and directly play the comprehensive considerations such as insulin action, utilize the yeast of gene technology construction expression restructuring GLP-1 analog, and be dipeptidyl peptidase IV (DPP-IV) degraded in the natural GLP-1 of solution very easily body, the shortcoming of its plasma half-life less than 2 minutes, for DPP-IV degraded GLP-1 recognition site at second aminoacid A, changed into is not the G of enzyme identification, not affecting bioactive while, prolong half-life.With this recombinant gene expression yeast, transform inorganic chromium, inorganic selenium and inorganic vanadium, form glucose tolerance factor, yeast selenium and yeast vanadium.Utilize yeast to be easy to large-scale culture, the feature that cost is low, prepare yeast powder, as raw material for the preparation of medicine or the health product for the treatment of type ii diabetes.
The present invention's glucagon-like-peptide-1 (GLP-1) sequence used following ((shown in SEQ.ID.NO.1):
HXEGTFTSDVSSYLEGQAAKEFIAWLVKGR。
Amino acid abbreviations in sequence: A alanine; R arginine; N agedoite; D aspartic acid; C cysteine; Q glutamine; E glutamic acid; G glycine; H histidine; I isoleucine; L-Leu; K lysine; M methionine; F phenylalanine; P proline; S serine; T threonine; W tryptophan; Y tyrosine; V a word used in person's names propylhomoserin; X:G glycine.By the change of second aminoacid sequence X, change by natural alanine A the simulated series that glycine G makes to change structure into and can resist dipeptidyl peptidase enzyme degradation, thus make Increased Plasma Half-life, drug effect strengthens.
Specific practice is in Pichia sp., express above-mentioned GLP-1.First be synthesis GLP-1 gene:
The primer adopted in GLP-1 gene chemical synthesis is as follows:
GLP-F1:5’tactcgagaaaagacatggtgaagggacctttaccagtg?3’；
GLP-R1:5’tccaaataagaacttacatcactggtaaaggtccc?3’；
GLP-R2:5’tccttggcagcttggccttccaaataagaacttac?3’；
GLP-R3:5’accagccaagcaatgaactccttggcagcttggcc?3’；
GLP-R4:5’atgcggccgctcggcctttcaccagccaagcaatg?3’；
The detailed process of fusion DNA vaccine is: GLP-F1 primer 1 μ l and the 25 μM of GLP-R1 primer 1 μ l of 25 μMs, be carry out the degeneration (94 DEG C 20 seconds) of 10 circulations, annealing (55 DEG C 20 seconds) in the PCR reactant liquor of 50 μ l, extend (72 DEG C 20 seconds) at volume, other component in reactant liquor is identical with Standard PCR.Electrophoresis reclaims the fragment of GLP-F1 primer and GLP-R1 primer amplification, and with this fragment for template, carry out secondary pcr amplification with GLP-F1 primer and GLP-R2 primer, reaction condition is the same, but is 20 circulations.The second time PCR primer reclaimed with electrophoresis is for template, and carry out the pcr amplification of third time with GLP-F1 primer and GLP-R3 primer, 20 circulations, reaction condition is the same.With electrophoresis reclaim third time PCR primer for template, carry out the pcr amplification of the 4th time with GLP-F1 primer and GLP-R4 primer, 25 circulations, reaction condition is the same.The product of the 4th pcr amplification is complete GLP-1 gene.
The method of fusion DNA vaccine is adopted they to be spliced into complete GLP-1 gene, spliced GLP-1 gene order following (shown in SEQ.ID.NO.2):
5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc?aaggagttcattgcttggctggtgaaaggccgagcggccgcat?3’；
5 ' end of this sequence has 6 bases and the tactcgagaaaaga of xho I restriction endonuclease sites and alpha factor signal peptide end; 3 ' end introduces Not I restriction endonuclease sites.
The structure of expression vector:
By with the GLP-1 gene outcome Xho I of pcr amplification and Not I double digestion rear clone to pPIC9K carrier, the positive colony that enzyme action tentatively confirms carries out sequencing, confirms that GLP-1 gene is the downstream being cloned in pPIC9K carrier alpha factor signal peptide.The positive colony confirmed is extracted plasmid, after Sal I enzyme action is linear, transforms GS115 Pichia yeast, then do G418 resistance screening, obtain the Yeast engineering bacteria of anti-4mg/ml G418.
Saccharomycetic fermentation culture and mycopowder preparation:
Yeast engineering bacteria fermentation tank adopts conventional method to cultivate, and under methanol induction, carry out fermentation expression, add chromium trichloride 0.2g/L, sodium selenite 30mg/L and ammonium metavanadate 0.1g/L in the abduction delivering phase, abduction delivering is after 10 hours.Fermentation liquor collected by centrifugation yeast, distilled water centrifuge washing three times, the medium component that the yeast thalline that removal is gathered in the crops is infected with, remove remaining inorganic chromium and inorganic selenium in fermentation liquid, 80 DEG C of evacuation bakings are spent the night, and make in cell the yeast selenium, the vanadium dry powder that are rich in GLP-1 and glucose tolerance factor.
Concrete fermentation expression is:
Yeast engineering bacteria adopts conventional method to carry out fermentation expression under methanol induction.Fermentation is carried out, first at BSM inorganic medium in Germany ' Bei Lang ' 30-L fermentation tank: composition is H
3pO
426.7ml/L; CaSO
4-H
2o0.93g/L; K
2sO
418.2g/L; MgSO
4-2H
2o14.9g/L; KOH4.13g/L; Glycerol 40g/L; PMT1 4.0ml/L.On this basis, add chromium (the preferred chromium 20mg/L of 15 ~ 25mg/L, when using chromium trichloride, additive capacity is 0.1g/L), selenium (the preferred selenium 8mg/L of 5 ~ 15mg/L, use sodium selenite time additive capacity be 20mg/L) and 10 ~ 30mg/L vanadium (preferred vanadium 20mg/L, use ammonium metavanadate time additive capacity be 50mg/L).
After culture medium has configured, add 100% ammonia and adjust pH5.0 or 10g/L ammonium sulfate to adjust pH5.0, ammonia is used for upper tank and adjusts pH.PH6.0 is adjusted before abduction delivering.PH5.0 is that pH6.0 is the optimum pH of expressing protein in order to prevent BSM from forming calcium phosphate precipitation.The PTM14.0ml/L of 4.0ml/L filtration sterilization is added again after BSM autoclaving.
PMT1 (1L) formula: CuSO
4-5H
2o6.0g/L; KI0.088g/L; MnSO
4-H
2o3.0g/L; Na
2moO
4-2H
2o0.2g/L; H
3bO
30.02g/L; CoCl
2-6H
2o0.5g/L; ZnCl
220.0g/L; FeSO
4-7H
2o65.0g/L; Biotin 0.2g/L; Dense H
2sO
45.0ml.
Amplification cultivation 24 hours, then stream adds 0.5-1ml/min methanol induction and carries out fermentation expression, while the abduction delivering phase, stream added methanol, stream adds the inorganic vanadium (preferred chromium 40mg/L, selenium 12mg/L and the vanadium 40mg/L that with the addition of the inorganic chromium of 30 ~ 40mg/L, the inorganic selenium of 12 ~ 15mg/L and 30 ~ 40mg/L of Isodose, chromium trichloride 0.2g/L, sodium selenite 30mg/L and ammonium metavanadate 0.1g/L are added in concrete use) sorbitol solution, abduction delivering is after 10 hours.Broken for yeast supernatant is carried out liquid-phase chromatographic analysis and compares with GLP-1 standard substance 26 peptide, determines the main component of fermentation liquid.
Respectively as shown in Figure 1 and Figure 2, can find out that the appearance time of fermentation liquid and standard substance is basically identical, result shows that expression of recombinant yeast has GLP-1 to result.
Fermentation liquor collected by centrifugation yeast, distilled water centrifuge washing three times, remove remaining inorganic chromium, inorganic selenium and inorganic vanadium in the medium in fermentation liquid, 80 DEG C of dried in vacuo overnight, make in cell the yeast selenium, the vanadium dry powder that are rich in GLP-1 and glucose tolerance factor.Steady sugar yeast powder is prepared also subsequently for the Experiment on therapy to diabetic animal models as raw material.
The mensuration of chromium, selenium and vanadium in steady sugar yeast powder
Yeast powder distilled water centrifuge washing three times, fully remove out inorganic ions in the culture medium that may be infected with, vacuum dehydration, accurately take 1 gram of yeast dry powder, the content of chromium, selenium, vanadium is measured, with commercially available Angel Yeast for contrast with inductance couples high frequency plasma emission spectrometry (ICP-AES).
Chromium, selenium, vanadium, lead content testing result
Steady sugar yeast powder is used for the Experiment on therapy of GK type ii diabetes rat model:
GK type ii diabetes rat 40 (every body weight is at 200g ± 10g), is divided into 4 groups, often organizes 10; First group is diformin tablet positive controls, and second group is normal saline negative control group, and the 3rd, the 4th group is steady sugar yeast powder experimental group; All extract blood, separation of serum before 40 GK rat experiments, stored frozen is to be measured.Experimental group every rat mouth every day feeds 0.5ml, the 3rd group of yeast powder containing 10mg; 4th group containing 2mg yeast powder.Diformin tablet positive controls every Oral Administration in Rats 0.5ml, containing the metformin of 40 μ g; The normal saline of negative control group every Oral Administration in Rats 0.5ml.After continuous 30 days, draw blood immediately, separation of serum, stored frozen is to be measured.Drug withdrawal after 7 days, then is taken a blood sample respectively, separation of serum, together with the serum that two batches of stored frozen are above to be measured, detects the concentration of blood glucose, the results are shown in following table 1:
The steady sugar yeast powder of table 1 is used for the blood glucose test results of GK type ii diabetes rat model
Test as can be seen from the above table 3 groups and positive controls successive administration after 30 days blood glucose value all dropped to the level (normal rat blood glucose value 4.9-6.2) of normal value, test 4 groups of blood glucose and also significantly decline.The blood glucose value of drug withdrawal positive controls after 7 days has been returned to again exceptional value, and the blood glucose value of testing 3 groups is still in normal value, illustrates that high dose steady sugar yeast powder can maintain the longer time.
Steady sugar yeast powder glucose tolerance test:
In above-mentioned experiment, steady sugar yeast powder is after oral 30 days, and every rats by intraperitoneal injection 0.5ml, 40% glucose, blood sampling in 0.5 hour, 1 hour, 2 hours after injectable dextrose monohydrate, separation of serum, measures blood glucose.Blood sugar detection the results are shown in Table 2, and as can be seen from the table, the ability of the steady sugar of heavy dose of oral steady sugar yeast group is obviously better than metformin positive controls.
The blood glucose test results that oral 30 days of table 2 is later
The promoting insulin secretion of GLP-1
Experiment material and method:
NOD mice (Chinese Academy of Sciences's Shanghai animal center provides)
0.9%NaCl solution, steady sugar yeast powder, metformin
Radioimmunity insulin assay test kit (ministry of Health of China Shanghai institute of Biological Products product)
NOD mice is divided into three groups.First scale capillary tube (first with 1mg/mL heparin rinse capillary tube inner wall and dry) is used to get blood 50 microlitre from eye hole, then three groups of mices lumbar injection 200 microlitre is containing the metformin liquid of 40 micrograms, 200 microlitres containing the yeast powder liquid of 10mg and 200 microlitre normal saline respectively, and note was now zero moment.Then respectively at 5,10,20, within 30 minutes, get blood by same operation.After getting blood, each blood sample adds in the centrifuge tube filling 50 microlitre normal saline at once, mixing, and 3000 revs/min of centrifugal removing erythrocyte measure serum insulin concentration, to check the promoting insulin secretion of GLP-1 by radioimmunoassay kits using method.
Experimental result is as shown in table 3.This result shows, the steady sugar yeast powder of lumbar injection significantly can promote the secretion of insulin.
The promoting insulin secretion of the steady sugar yeast powder of table 3.
| Time after administration | 0min | 5min | 10min | 20min | 30min |
| Metformin | 2.88 | 3.56 | 2.88 | 2.67 | 2.45 |
| Steady sugar yeast powder | 3.11 | 9.76 | 10.63 | 11.23 | 6.27 |
| Matched group | 2.09 | 2.07 | 1.80 | 1.90 | 1.86 |
Note: in table, insulin levels is: 10
-6iu
Above-mentioned detection shows, the steady sugar yeast powder of lumbar injection blood sugar lowering significantly can promote the secretion of insulin, and result shows the multiple drug effect factor all can play corresponding effect, blood sugar lowering, steady sugared successful.Can be applicable to reduce blood glucose, the medicine of stabilizing blood sugar or the preparation of preparation; Can be used for stablizing and reducing not yet using the patients with NIDDM blood glucose of Remedies for diabetes and the auxiliary patients with NIDDM therapeutic effect having used treatment Remedies for diabetes.The application of the steady sugar yeast mycopowder of described blood sugar lowering in the medicine or health product of preparation treatment type Ⅱdiabetes mellitus.
Claims (10)
1. the steady sugar yeast mycopowder of blood sugar lowering, is characterized in that, described yeast expressedly have GLP-1, and containing transforming by inorganic chromium, inorganic selenium and inorganic vanadium the glucose tolerance factor, yeast selenium and the yeast vanadium that are formed.
2. the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 1, it is characterized in that, described yeast expressed GLP-1 is the GLP-1 of rite-directed mutagenesis, and its deputy alanine residue sports glycine residue; The amino acid residue sequence of the GLP-1 after sudden change is as shown in SEQ.ID.NO.1.
3. the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 1 or 2, is characterized in that, described yeast is the yeast of restructuring, using yeast as host cell, is cloned into the expression vector comprising sequence as shown in SEQ.ID.NO.2.
4. the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 3, it is characterized in that, described host cell is GS115 Pichia yeast or SMD-1168 Pichia yeast, described expression vector is pPIC9K carrier, and sequence clone shown in SEQ.ID.NO.2 is in the downstream of pPIC9K carrier alpha factor signal peptide.
5. the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 1, it is characterized in that, described yeast is the liquid fermentation carried out under methanol induction: the inorganic vanadium being also added with the inorganic chromium of 15 ~ 25mg/L, the inorganic selenium of 5 ~ 15mg/L and 10 ~ 30mg/L in its culture medium; Also amplification cultivation is after 24 hours in inoculation, and stream adds 0.5-1ml/min methanol induction and carries out fermentation expression, and equivalent stream adds sorbitol, is added with the inorganic vanadium of the inorganic chromium of 30 ~ 40mg/L, the inorganic selenium of 12 ~ 15mg/L and 30 ~ 40mg/L in sorbitol.
6. a preparation method for the steady sugar yeast mycopowder of blood sugar lowering, is characterized in that, comprise following operation:
1) the GLP-1 gene order of synthesis as shown in SEQ.ID.NO.2, and be cloned in expression vector, be built into GLP-1 recombinant expression carrier;
2) will be transformed in yeast cells after the linearisation of GLP-1 recombinant expression carrier, obtain GLP-1 recombination yeast;
3) GLP-1 recombination yeast is inoculated in the culture medium in fermentation tank, wherein culture medium is also added with inorganic chromate salt, inorganic selenium salt and inorganic vanadic salts;
In amplification cultivation after 24 hours, stream adds methanol induction fermentation expresses, and stream adds the inorganic salt liquid with methanol equivalent simultaneously, containing inorganic chromate salt, inorganic selenium salt and inorganic vanadic salts in inorganic salt liquid;
4) after abduction delivering has fermented, collected by centrifugation yeast, and fully wash; Evacuation baking is spent the night, and obtains the steady sugar yeast mycopowder of blood sugar lowering that cell includes restructuring GLP-1, glucose tolerance factor, yeast selenium and yeast vanadium.
7. the preparation method of the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 6, it is characterized in that, described GLP-1 gene is based on following primer and adopts the method for fusion DNA vaccine to be spliced, and described primer is:
GLP-F1:5’tactcgagaaaagacatggtgaagggacctttaccagtg?3’；
GLP-R1:5’tccaaataagaacttacatcactggtaaaggtccc?3’；
GLP-R2:5’tccttggcagcttggccttccaaataagaacttac?3’；
GLP-R3:5’accagccaagcaatgaactccttggcagcttggcc?3’；
GLP-R4:5’atgcggccgctcggcctttcaccagccaagcaatg?3’；
The downstream that GLP-1 gene order is cloned into pPIC9K carrier alpha factor signal peptide by described GLP-1 recombinant expression carrier obtains;
Described yeast is GS115 Pichia yeast or SMD-1168 Pichia yeast.
8. the preparation method of the steady sugar yeast mycopowder of blood sugar lowering as claimed in claim 6, it is characterized in that, described culture medium is BSM inorganic medium, is also added with the inorganic vanadium of the inorganic chromium of 15 ~ 25mg/L, the inorganic selenium of 5 ~ 15mg/L and 10 ~ 30mg/L in base; After culture medium has configured, interpolation ammonia is adjusted or ammonium sulfate adjusts pH to be 5.0, adjusts pH to be 6.0 before abduction delivering;
The inorganic vanadium of the inorganic chromium of 30 ~ 40mg/L, the inorganic selenium of 12 ~ 15mg/L and 30 ~ 40mg/L is added with in described sorbitol.
9. the application of the steady sugar yeast mycopowder of blood sugar lowering according to claim 1 in the medicine or preparation of preparation reduction blood glucose, stabilizing blood sugar.
10. the application of the steady sugar yeast mycopowder of blood sugar lowering according to claim 1 in the medicine or health product of preparation treatment type Ⅱdiabetes mellitus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410448434.8A CN104257696B (en) | 2014-09-04 | 2014-09-04 | A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410448434.8A CN104257696B (en) | 2014-09-04 | 2014-09-04 | A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104257696A true CN104257696A (en) | 2015-01-07 |
| CN104257696B CN104257696B (en) | 2017-08-25 |
Family
ID=52149353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410448434.8A Expired - Fee Related CN104257696B (en) | 2014-09-04 | 2014-09-04 | A kind of steady sugar yeast bacterium powder of hypoglycemic and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104257696B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105153311A (en) * | 2015-07-17 | 2015-12-16 | 山东泉港药业有限公司 | Recombinant glucagon-like peptide-1 mutant fusion protein and preparation method therefor |
| CN106666380A (en) * | 2016-12-29 | 2017-05-17 | 广东省农业科学院蚕业与农产品加工研究所 | Preparation method and application of compound food base material enriched with blood glucose reducing factors |
| CN109652355A (en) * | 2019-02-12 | 2019-04-19 | 西安培华学院 | A kind of hypoglycemic bafillus natto and preparation method and application |
| CN109730270A (en) * | 2019-02-12 | 2019-05-10 | 西安培华学院 | A kind of hypoglycemic yeast fermentation pumpkin powder and preparation method and application |
| CN113462713A (en) * | 2021-09-06 | 2021-10-01 | 中国农业科学院生物技术研究所 | Method for improving expression level of glucagon-like peptide hexa-linked peptide in pichia pastoris |
| CN113512520A (en) * | 2021-04-29 | 2021-10-19 | 右江民族医学院 | Chromium-and zinc-rich acetobacter and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1483041A (en) * | 2000-12-07 | 2004-03-17 | GLP-1 fusion protein | |
| CN101003574A (en) * | 2006-02-21 | 2007-07-25 | 大连帝恩生物工程有限公司 | Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes |
| CN102783636A (en) * | 2012-06-04 | 2012-11-21 | 于长富 | Food nutrition supplement for prophylaxis and treatment of diabetes and application thereof |
-
2014
- 2014-09-04 CN CN201410448434.8A patent/CN104257696B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1483041A (en) * | 2000-12-07 | 2004-03-17 | GLP-1 fusion protein | |
| CN101003574A (en) * | 2006-02-21 | 2007-07-25 | 大连帝恩生物工程有限公司 | Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes |
| CN102783636A (en) * | 2012-06-04 | 2012-11-21 | 于长富 | Food nutrition supplement for prophylaxis and treatment of diabetes and application thereof |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105153311A (en) * | 2015-07-17 | 2015-12-16 | 山东泉港药业有限公司 | Recombinant glucagon-like peptide-1 mutant fusion protein and preparation method therefor |
| CN105153311B (en) * | 2015-07-17 | 2018-09-04 | 山东泉港药业有限公司 | Recombinant human glucagon-like peptide-1 mutant fusion protein and preparation method thereof |
| CN106666380A (en) * | 2016-12-29 | 2017-05-17 | 广东省农业科学院蚕业与农产品加工研究所 | Preparation method and application of compound food base material enriched with blood glucose reducing factors |
| CN109652355A (en) * | 2019-02-12 | 2019-04-19 | 西安培华学院 | A kind of hypoglycemic bafillus natto and preparation method and application |
| CN109730270A (en) * | 2019-02-12 | 2019-05-10 | 西安培华学院 | A kind of hypoglycemic yeast fermentation pumpkin powder and preparation method and application |
| CN113512520A (en) * | 2021-04-29 | 2021-10-19 | 右江民族医学院 | Chromium-and zinc-rich acetobacter and preparation method and application thereof |
| CN113512520B (en) * | 2021-04-29 | 2022-04-26 | 右江民族医学院 | Chromium-and zinc-rich acetobacter and preparation method and application thereof |
| CN113462713A (en) * | 2021-09-06 | 2021-10-01 | 中国农业科学院生物技术研究所 | Method for improving expression level of glucagon-like peptide hexa-linked peptide in pichia pastoris |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104257696B (en) | 2017-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104257696A (en) | Yeast powder for reducing and stabilizing blood sugar as well as preparation method and application of yeast powder | |
| CN101624570B (en) | Method for cultivating cultured ganoderma lucidum with Chinese medicaments and method for preparing cultured ganoderma lucidum health-care product | |
| CN111035649B (en) | NMN + GLP compound nutritional supplement and preparation method and application thereof | |
| CN110420315A (en) | Application of the Lycium chinense glycopeptide in preparation three high drugs for the treatment of | |
| CN109939143A (en) | A kind of Chinese medicine composition and preparation method thereof for hypoglycemic control complication | |
| EP3574912B1 (en) | Composition for treating diabetic disease | |
| CN108570116B (en) | Pleurotus citrinopileatus polysaccharide, preparation method and medical application in preventing and treating diabetes | |
| CN105106300A (en) | Use of cyclocarya paliurus extract in preparation of drug for preventing and treating non-alcoholic fatty liver disease | |
| CN104906145B (en) | Medical application of the Paecilomyces hepiali chen mutagenic strain PH40 in treatment diabetes | |
| CN1895540A (en) | Medicinal composition for treating cardiovascular disease, its making method and use | |
| CN108379455B (en) | Uric acid reducing composition | |
| CN103251876A (en) | Traditional Chinese medicine composition used for treating chronic liver diseases | |
| CN109260205B (en) | Application of tetrandrine in preparation of medicine for resisting diabetes and hypertension | |
| CN101926842A (en) | Medicinal composition prepared from raw materials containing snow lotus and fermented cordyceps fungal powder | |
| CN104784192A (en) | Application of clam meat oligosaccharide in preparation of hypoglycemic drugs and preparation method of clam meat oligosaccharide | |
| CN101032534A (en) | Method of preparing jiubiying total saponins and the application thereof | |
| CN1557416A (en) | Medicine preparation for treating cardiovascular and cerebrovascular diseases and its preparing process | |
| CN104524411B (en) | A kind of compound preparation for being used to treat chronic liver disease hypoalbuminemia | |
| CN112972658B (en) | Oral pharmaceutical composition of growth hormone or analogue thereof | |
| CN102274514B (en) | Medicinal composition for preventing and treating type-II diabetes and complications thereof | |
| CN1296082C (en) | Medication and health food in use for lowering blood sugar, improving function of intestinal tract and reducing platelet aggergation | |
| CN107281408A (en) | A kind of hypoglycemic traditional Chinese medicine composition and preparation method thereof | |
| CN102579572B (en) | Heart resurrection dripping pill production process | |
| CN115487292A (en) | Combined medicine for treating diabetes and application thereof | |
| CN1857293A (en) | Medicine composition containing wild astragaloside and paeoniforin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170825 Termination date: 20180904 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |