CN104491496B - Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared - Google Patents
Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared Download PDFInfo
- Publication number
- CN104491496B CN104491496B CN201510019139.5A CN201510019139A CN104491496B CN 104491496 B CN104491496 B CN 104491496B CN 201510019139 A CN201510019139 A CN 201510019139A CN 104491496 B CN104491496 B CN 104491496B
- Authority
- CN
- China
- Prior art keywords
- gastrodin
- rhizoma gastrodiae
- influence
- liver
- rat liver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/898—Orchidaceae (Orchid family)
- A61K36/8988—Gastrodia
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Alternative & Traditional Medicine (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Medical Informatics (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Medicines Containing Plant Substances (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to field of medicaments, it is related to application of the Gastrodin in anti-hepatic fibrosis medicines are prepared, proved by the inhibitory action to the promoter activity of NTx protein alpha 1, to the system research such as the influence of ALT and AST contents, the influence to rat liver tissue pathologic structure, the influence to rat liver tissue hydroxyproline content, the influence to rat liver tissue response to oxidative stress and influence to rat liver fibrosis degree in rat blood serum, Gastrodin has good anti-hepatic fibrosis activity, is expected to new drug of the research and development as anti-hepatic fibrosis.
Description
Technical field：
The invention belongs to field of medicaments, it is related to application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared.
Background technology：
Liver fibrosis is the pathologic process of liver extracellular matrix (particularly NTx α 1) over-deposit, and it is machine
Body is reacted a kind of repair of acute and chronic hepatic injury.Chronic liver disease caused by the various causes of disease and the liver caused by some noxious materials
Dirty damage, can cause the necrosis of liver cell inflammation, and the pathological characters of secondary fibrosis.Liver fibrosis
(hepaticfibrosis, HF) is, to the hepatic sclerosis even important step of primary hepatoma development, to cause liver fine in China
The principal disease of dimensionization is virus B hepatitis.Traditional view thinks that the liver of people, Yi Dan occurring after fibrosis, is impossible
Take a turn for the worse, and famous hepatopathy expert Rogking is proposed after being furtherd investigate to liver fibrosis, the typical liver liver of people
Fibrosis can be reversed, and this has important meaning to effectively control liver diseases from hepatitis to hepatic sclerosis, liver cancer malignant development
Justice.For many years, domestic and foreign scholars have carried out largely grinding in terms of the mechanism of liver fibrosis, regulation factor, diagnosis and treatment
Study carefully.Although experimental study medication is many, so far in addition to the cause of disease for causing liver fibrosis, clinic still can be used for
Western medicine efficient, without obvious toxic-side effects.Clinical practice shows that Chinese medicine liver fibrosis is improving the side such as clinical symptoms
Face shows very big potentiality.At present, the anti-hepatic fibrosis Chinese medicine of China's Clinical practice has：FUZHENG HUAYU JIAONANG, compound turtle shell
Soft liver slice, Radix Et Rhizoma Rhei et Eupolyphaga Seu Steleophaga Pilulae, small bupleurum preparation, liver-strengthening capsule etc..The medicine is compound Chinese medicinal preparation, by kinds of traditional Chinese medicines group
Into, and rhizoma Gastrodiae composition is not contained in all compound preparations.
Rhizoma Gastrodiae is orchid family rhizoma Gastrodiae platymiscium, and its dry tuber is also known as rhizoma Gastrodiae (GastrodiaelataBlume), is normal simply
With and more rare Chinese medicine, clinic is used for the diseases such as dizziness of having a headache, extremity numbness, child convulsion, epilepsy, tic, lockjaw.My god
Numb element (Gastrodin) is one of effective monomer component of rhizoma Gastrodiae, is clinically mainly used in treating cardiovascular and cerebrovascular disease at present
And the nervous system disease.Gastrodin CAS 62499-27-8, molecular formula C13H18O7, molecular weight 286.3, molecular structural formula is：
In recent years, this laboratory is found by the systems biology activity research to Gastrodin/Rhizoma Gastrodiae powder, is used as simple
Gastrodin/Rhizoma Gastrodiae powder, the activity with anti-hepatic fibrosis then carried out follow-up further investigation work.The Gastrodin/
Application of the Rhizoma Gastrodiae powder in anti-hepatic fibrosis, so far, there is not yet relevant report both domestic and external.
The content of the invention：
The invention provides application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared.
It is the composition that active ingredient is constituted with pharmaceutically acceptable carrier present invention also offers Gastrodin/Rhizoma Gastrodiae powder
Application in anti-hepatic fibrosis medicines are prepared.
The present invention constructs anti-liver fiber by the use of the gene C OL1A1 promoters of NTx α 1 as the target of drug screening
Chemical drug thing cell screening model, and go out Gastrodin/Rhizoma Gastrodiae powder to COL1A1 promoters with significant suppression using the model discrimination
Make and use.To further determine that the effect of anti hepatic fibrosis of Gastrodin/Rhizoma Gastrodiae powder, the present invention prepares the SD rats of common bile duct ligation
Model, and to Liver Function, hepatic tissue pathology structure, extent of liver fibrosis, collagen contents and oxidative stress journey
Degree is detected that as a result show, Gastrodin/Rhizoma Gastrodiae powder can suppress the generation of liver fibrosis.
When the present invention is used for Strategies of Anti-fibrosis Therapy, Rhizoma Gastrodiae powder is administered orally, and Gastrodin oral or non-oral administration belongs to
Safely and effectively.Any regular dosage form, such as tablet, capsule, powder, particle can be made in oral medication；Non-oral administration, can
Injection liquid etc. is made.
Gastrodin dosage of the present invention can be adjusted according to factors such as mode of taking, state of an illness weight and patient ages
Change, be generally selected from 1-100mg/ days into human oral dosage form；Adult injection dosage is selected from 1-50mg/ days.
When the present invention is used to prepare anti-hepatic fibrosis medicines, its auxiliary material and preparation method can select pharmaceutically acceptable
What form.
Brief description of the drawings：
Inhibitory action of Fig. 1-Gastrodin to the promoter activity of NTx protein alpha 1
Wherein：*p<0.05 compared with control group (administration concentration is zero).
Influence of Fig. 2-Gastrodin to rat liver tissue pathologic structure
Wherein：A is rats in sham-operated group liver tissue slices HE coloration results；B is model group rats liver tissue slices
HE coloration results；C is administration Gastrodin group rat liver tissue section HE coloration results；D is that all animal tissue's bile ducts are increased
The statistical chart of raw situation；E is the statistical chart * p to the downright bad situation of all animal tissues<0.05, * * p<0.01 with BDL group phases
Than；##p<0.01 compared with sham-operation group.
Influence of Fig. 3-Gastrodin to rat liver fibrosis degree
Wherein：A is rats in sham-operated group liver tissue slices sirius red stains result；B is model group rats liver group
Knit section sirius red stains result；C is administration Gastrodin group rat liver tissue section sirius red stains result；D for pair
The statistical chart of all animal tissue's sirius red stains areas
*p<0.05 compared with BDL groups；##p<0.01 compared with sham-operation group.
Influence of Fig. 4-Gastrodin to rat liver tissue hydroxyproline content
Wherein：*p<0.05 compared with BDL groups；##p<0.01 compared with sham-operation group.
Influence of Fig. 5-Gastrodin to rat liver tissue response to oxidative stress
Wherein：*p<0.05 compared with BDL groups；##p<0.01 compared with sham-operation group.
Inhibitory action of Fig. 6-Rhizoma Gastrodiae powder to the promoter activity of NTx protein alpha 1
Wherein：*p<0.05, * * p<0.01 compared with control group (administration concentration is zero).
Influence of Fig. 7-Rhizoma Gastrodiae powder to rat liver tissue pathologic structure
Wherein：A is rats in sham-operated group liver tissue slices HE coloration results；B is model group rats liver tissue slices
HE coloration results；C is administration Rhizoma Gastrodiae powder group rat liver tissue section HE coloration results；D is to the downright bad feelings of all animal tissues
The statistical chart of condition
**p<0.01 compared with BDL groups；##p<0.01 compared with sham-operation group.
Influence of Fig. 8-Rhizoma Gastrodiae powder to rat liver fibrosis degree
Wherein：A is rats in sham-operated group liver tissue slices sirius red stains result；B is model group rats liver group
Knit section sirius red stains result；C is administration Rhizoma Gastrodiae powder group rat liver tissue section sirius red stains result；D for pair
The statistical chart of all animal tissue's sirius red stains areas
##p<0.01 compared with sham-operation group.
Influence of Fig. 9-Rhizoma Gastrodiae powder to rat liver tissue hydroxyproline content
Wherein：##p<0.01 compared with sham-operation group.
Embodiment：
The present invention will be described in detail with reference to the accompanying drawings and examples, but the content be explanation of the invention and
It is not to limit.
《Embodiment 1》Gastrodin suppresses the promoter activity experiment of NTx protein alpha 1
1.1 build the stable promoter COL1A1P of expression NTx protein alpha 1 monoclonal cell strain LX2-COL
Using genome DNA extracting reagent kit, LX2 cells (Mount Sinai School of Medicine) are extracted
Genomic DNA.Utilize the gene C OL1A1 sequence (sequence numbers of ncbi database people's full-length genome information NTx α 1：NC_
000017.11) about 2400bp before, is used as COL1A1 promoter sequences.Using primer premier5.0 primer-design softwares,
The primer of COL1A1 promoters is designed, upstream and downstream primer sequence is respectively that 5 ' AAGAGCTCGTGGGAAAGCCTGGATGG3 ' (contain
The restriction enzyme sites of Sac I), 5 ' AAAGATCTTTTGGGACTTACTGTCTTCGT 3 ' (restriction enzyme site containing Bgl II).With LX2 cells
Genomic DNA is template, enters performing PCR amplification, obtains the gene C OL1A1 promoters of purpose fragment NTx α 1, and utilize agar
Sugared gel electrophoresis Preliminary Identification PCR primer.
By the gene C OL1A1 promoter fragments of NTx α 1 and pGL4.17 [luc2/Neo] carriers through Sac I and Bgl II couple
Connected after digestion, in coupled reaction liquid conversion bacillus coli DH 5 alpha competence, in LB solid plates, 37 DEG C are inverted culture 16-
20h, picking amicillin resistance monoclonal extracts DNA.Utilize the technology such as bacterium colony PCR, digestion Preliminary Identification positive gram
It is grand, recombinant plasmid is obtained, pGL4.17-COL1A1P is named as
In DMEM (Gibco) culture medium containing 10% hyclone, 37 DEG C, LX2 cells are cultivated under the conditions of 5%CO2.According to
Per hole 5 × 104Individual cell is laid on 48 orifice plates, and culture 24h cultivates LX2 cells in 6 orifice plates and reached to be converged close to 90%-95%
When, carry out cell transfecting.After 24h, concentration gradient G418 (AMERCO) is added, final choice concentration is 100 μ gmL-1G418
Continue to cultivate the LX2 cells for transfecting pGL4.17-COL1A1P plasmids, and change liquid in time.After the cell in 6 orifice plates is covered with, paving
It is unicellular to 96 orifice plates.Treat it is unicellular grow up to clone (about 1 week -2 week), plus D- fluoresceins (Thermo Fisher) are to final concentration
60μg·mL-1, shot using living body biological luminescence imaging system (IVIS 200, Xenogen), selection signal most strong monoclonal
Cell line LX2-COL, and expand culture.
The 1.2 stable promoter COL1A1P of expression NTx protein alpha 1 built by more than monoclonal cell LX2-COL
96 hole blanks are laid on, per hole 2 × 104Individual cell.After after cell confluency degree about 90%, free serum culture 24h, plus TGF-β 1
(2ng/ml) is induced, while adding the Gastrodin (commercially available prod) of concentration gradient, concentration is respectively 1 μ g/ml, 3 μ g/ml, 30 μ g/
Ml, every group of experiment sets 3 multiple holes.According to Bright-GloTMLuciferase Assay System specification operating procedures, 24h
Inhale afterwards and abandon culture medium, add any μ l/ holes of culture medium 50.Detected after adding the μ l/ holes of luciferase substrate 50,2min.Knot
Fruit shows, with the rise of Gastrodin concentration, and fluorescence intensity weakens, and when Gastrodin concentration is 3 μ g/ml and 30 μ g/ml, it is glimmering
Luminous intensity substantially weakens (Fig. 1).Show, Gastrodin has when concentration is 3 μ g/ml and 30 μ g/ml to COL1A1 promoter activities
Obvious inhibitory action.
《Embodiment 2》It is prepared by the Liver Fibrosis Model of SD rats common bile duct ligation induction
Body weight is selected in 180-220g SD male rats 19, sham-operation group, model group, Gastrodin administration is randomly divided into
(500mg/kg) group, wherein sham-operation group 5, model group 7, Gastrodin group 7.Before zoopery after fasting 12h, different fluorine is used
Alkane anesthetized animal is performed the operation.Wherein model group and administration group do common bile duct ligation (BDL), under sterile working, are making upper abdomen just
Middle otch, raises liver edge, pulls open duodenum, separation ductus choledochus 2-3cm.With No. 000 at nearly duodenum and at nearly hepatic portal
Silk thread respectively ligatures twice, and choledochus is cut from centre.Sham-operation group is only made Median incision on upper abdomen and sutured, and choledochus knot is not done
Prick.After Animal Anesthesia is clear-headed, normal diet, free water, intramuscular injection penicillin 3 days, to prevent infection, experimental temperature (22 ± 2) DEG C.
Start gastric infusion within the 2nd day after modeling, give respectively physiological saline (sham-operation group, model group) and Gastrodin 500mg/kg (my god
Numb element administration group), 1 time a day, it is administered 14 days.
《Embodiment 3》The elevated inhibitory action of rat blood serum ALT/AST levels that Gastrodin is induced BDL
Fasting 12h, with 10% chloral hydrate anesthesia rat, takes abdominal aorta blood before sampling.800rpm centrifuges 5min, takes blood
The clear Activity determination for carrying out glutamic-oxalacetic transaminease (AST) and glutamic-pyruvic transaminase (ALT).As a result show, Gastrodin can substantially suppress
ALT and AST content (table 1), shows that Gastrodin can improve Liver Function in rat blood serum.
The influence for the rat blood serum ALT/AST levels that the Gastrodin of table 1. is induced BDL
**p<0.01 compared with BDL groups；##p<0.01 compared with sham-operation group.
《Embodiment 4》The inhibitory action that the rat liver pathologic structure that Gastrodin is induced BDL changes
Fasting 12h before sampling, puts to death rat, takes liver organization, cut hepatomegaly leaf texture block and be put into 10% formalin
It is fixed.Paraffin section is made by dehydration, FFPE, section, roasting piece etc..Carried out using Hematoxylin-eosin (HE) dyeing liquor
Dyeing, observes rat liver tissue pathologic structure situation of change.As a result show, rats in sham-operated group liver organization liver cell rule
Arrangement, lobuli hepatis is complete, no inflammatory cell infiltration and bile duct proliferation situation；Rat liver tissue pathologic structure occurs bright after BDL
Aobvious to change, bile duct proliferation is fairly obvious, necrosis showed increased；The liver tissues of rats structure of Gastrodin administration group is obtained substantially
Improve, bile duct proliferation situation is significantly inhibited, and necrosis degree is substantially reduced (Fig. 2).Show, Gastrodin can substantially change
The pathologic structure of kind BDL rat liver tissues.
《Embodiment 5》Inhibitory action of the Gastrodin to the BDL rat liver fibrosis induced
By paraffin section sirius red stains, rat liver tissue fibrosis situation is observed.As a result show, it is big after BDL
Mouse liver organization fibrosis substantially increase, and after Gastrodin administration, fibrosis are significantly suppressed (Fig. 3).Show, day
Numb element can substantially suppress the rat liver fibrosis of BDL inductions.
《Embodiment 6》Influence of the Gastrodin to hydroxyproline content in rat liver tissue
Fasting 12h before sampling, puts to death rat, takes liver organization, accurately weigh 30-100mg, according to hydroxyproline testing cassete
(building up Bioengineering Research Institute purchased from Nanjing) specification is operated.As a result show, compared with rats in sham-operated group, BDL groups
Hydroxyproline content is significantly raised in rat liver tissue；Compared with BDL groups, after administration Gastrodin, hydroxyl in rat liver tissue
Proline content is significantly reduced (Fig. 4).Show, Gastrodin can substantially reduce the content of hydroxyproline in liver organization, i.e. day
Numb element can substantially suppress the generation of collagenous fibres in BDL rats.
《Embodiment 7》The inhibitory action for the rat liver tissue response to oxidative stress that Gastrodin is induced BDL
Fasting 12h before sampling, puts to death rat, takes liver organization, be cut into small pieces and temporarily preserved in liquid nitrogen, then transfer
To -80 DEG C of preservations.Tissue weight accurately is weighed, according to weight (g)：Volume (ml)=1:9 ratio adds the precooling of 9 times of volumes
Physiological saline, grinds in ice bath, prepares homogenate, and 3000-4000rpm centrifuges 10-15min, takes 10% homogenate supernatant to be measured.
According to MDA, nitric oxide (one-step method), superoxide dismutase testing cassete (building up Bioengineering Research Institute purchased from Nanjing)
Operating procedure, MDA (MDA), the content of nitric oxide (NO) and superoxide dismutase (SOD) in detection hepatic tissue
Change.As a result show, compared with the rat of sham-operation group, MDA and NO contents are significantly raised in the rat liver tissue of BDL groups,
SOD contents are substantially reduced；Compared with BDL groups, after Gastrodin administration, MDA and NO contents are significantly reduced in rat liver tissue,
SOD contents are significantly raised (Fig. 5).Show, Gastrodin can substantially suppress the response to oxidative stress of rat liver tissue.
《Embodiment 8》Rhizoma Gastrodiae powder suppresses the promoter activity of NTx protein alpha 1
According to《Embodiment 1》Described in method, detection Rhizoma Gastrodiae powder (commercially available prod, granularity 250-800 mesh) to NTx egg
The inhibitory action of the white promoter activities of α 1, the wherein concentration gradient of Rhizoma Gastrodiae powder are 1 μ g/ml, 30 μ g/ml, 100 μ g/ml.As a result show
Show, with the rise of Rhizoma Gastrodiae powder concentration, fluorescence intensity weakens, and when Rhizoma Gastrodiae powder concentration is 30 μ g/ml and 00 μ g/ml, fluorescence
Intensity substantially weakens (Fig. 6).Show, Rhizoma Gastrodiae powder has when concentration is 30 μ g/ml and 00 μ g/ml to COL1A1 promoter activities
Obvious inhibitory action.
《Embodiment 9》The elevated inhibitory action of rat blood serum ALT/AST levels that Rhizoma Gastrodiae powder is induced BDL
According to《Experimental example 2》And《Embodiment 3》In method, the rat blood serum ALT/AST that induces BDL of detection Rhizoma Gastrodiae powder
The influence of level.Wherein, the gastric infusion amount of Rhizoma Gastrodiae powder is the daily 5g/kg of every rat.As a result show, Rhizoma Gastrodiae powder can be obvious
Suppress the content (table 2) of ALS and AST in rat blood serum.Show, Rhizoma Gastrodiae powder can improve Liver Function.
The influence for the rat blood serum ALT/AST levels that the Rhizoma Gastrodiae powder of table 2. is induced BDL
**p<0.01 compared with BDL groups；##p<0.01 compared with sham-operation group.
《Embodiment 10》The influence for the rat liver tissue pathologic structure that Rhizoma Gastrodiae powder is induced BDL
According to《Embodiment 4》Methods described, the shadow that the rat liver pathologic structure that observation Rhizoma Gastrodiae powder is induced BDL changes
Ring.As a result show, rats in sham-operated group liver organization cell is regularly arranged, lobuli hepatis is complete, no inflammatory cell infiltration and bile duct
Proliferative conditions；Obvious change occurs for rat liver tissue pathologic structure after BDL, and bile duct proliferation is fairly obvious, and necrosis is obvious
Increase；The liver tissues of rats structure of Rhizoma Gastrodiae powder administration group is improved, and necrosis degree is substantially reduced (Fig. 7).Show, rhizoma Gastrodiae
Powder is obviously improved the downright bad situation of BDL rat liver tissues.
《Embodiment 11》Influence of the Rhizoma Gastrodiae powder to the BDL rat liver fibrosis induced
By paraffin section sirius red stains, rat liver tissue fibrosis situation is observed.As a result show, it is big after BDL
Mouse liver organization fibrosis substantially increase, and after Rhizoma Gastrodiae powder administration, fibrosis are improved, but not statistically significant
(Fig. 8).Show, Rhizoma Gastrodiae powder has certain inhibitory action to the BDL rat liver fibrosis induced.
《Embodiment 12》Influence of the Rhizoma Gastrodiae powder to hydroxyproline content in rat liver tissue
According to《Embodiment 6》Described in method, influence of the detection Rhizoma Gastrodiae powder to hydroxyproline content in rat liver tissue.
As a result show, compared with rats in sham-operated group, hydroxyproline content is significantly raised in BDL group rat liver tissues；With BDL group phases
Than after Rhizoma Gastrodiae powder administration, hydroxyproline content is reduced in rat liver tissue, but not statistically significant (Fig. 9).Show, rhizoma Gastrodiae
Powder has certain inhibitory action to collagenous fibres in rat liver.
Claims (3)
1. application of the Gastrodin in anti-hepatic fibrosis medicines are prepared.
The composition that 2. Gastrodin described in claim 1 is active ingredient to be constituted with pharmaceutically acceptable carrier is in system
Application in standby anti-hepatic fibrosis medicines.
3. the application described in claim 1 or 2, it is characterized in that, Gastrodin peroral dosage form can be made and parenteral in clinical application
Formulation；Peroral dosage form is tablet, capsule, powder, particle, and non-oral dosage forms is injection liquid.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019139.5A CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
| PCT/CN2016/000019 WO2016112787A1 (en) | 2015-01-14 | 2016-01-12 | Application of gastrodin or gastrodin powder in preparing anti-hepaticfibrosis pharmaceutical |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019139.5A CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104491496A CN104491496A (en) | 2015-04-08 |
| CN104491496B true CN104491496B (en) | 2017-08-18 |
Family
ID=52933010
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510019139.5A Active CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104491496B (en) |
| WO (1) | WO2016112787A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104491496B (en) * | 2015-01-14 | 2017-08-18 | 中国医学科学院医药生物技术研究所 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103566198A (en) * | 2012-08-06 | 2014-02-12 | 中国医学科学院医药生物技术研究所 | Application of gastrodia elata and gastrodin in preparation of product used for treating non-alcoholic fatty liver disease |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101683411B (en) * | 2008-09-24 | 2012-09-19 | 汪鋆植 | Application of crab apple extract in preparing hepatic or health-care food |
| CN101524386B (en) * | 2009-04-17 | 2011-11-16 | 暨南大学 | Chinese herbal main component prescription for curing fatty liver |
| CN104491496B (en) * | 2015-01-14 | 2017-08-18 | 中国医学科学院医药生物技术研究所 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
-
2015
- 2015-01-14 CN CN201510019139.5A patent/CN104491496B/en active Active
-
2016
- 2016-01-12 WO PCT/CN2016/000019 patent/WO2016112787A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103566198A (en) * | 2012-08-06 | 2014-02-12 | 中国医学科学院医药生物技术研究所 | Application of gastrodia elata and gastrodin in preparation of product used for treating non-alcoholic fatty liver disease |
Non-Patent Citations (1)
| Title |
|---|
| 天麻素对CCl4 诱导小鼠肝损伤的保护作用;王志平等;《武警医学院学报》;20080930;第17卷(第9期);第762-764页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104491496A (en) | 2015-04-08 |
| WO2016112787A1 (en) | 2016-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6441372B2 (en) | Application of alphavirus to the production of antitumor drugs | |
| CN106729757A (en) | MiR 378 suppresses the purposes of myocardial hypertrophy and myocardial fibrosis and diagnosis of heart failure | |
| CN108079317A (en) | Orally active receptor activators treat obesity-related disease method and system | |
| CN108392575B (en) | Application of LIAOSHIHUAFENGDAN in preparing anti-leukemia medicine | |
| CN104491496B (en) | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared | |
| CN104083368A (en) | Application of G-1 in preparation of G protein coupled receptor 30-based triple negative breast cancer targeting drugs | |
| CN102274234A (en) | Application of ganoderic acid Y to preparation of medicament for treating or preventing enterovirus 71 infection | |
| CN104906080A (en) | Application of metformin in preparation of medicine for treating viral myocarditis caused by Coxsackie virus B3 | |
| CN108339113A (en) | Applications of the E3 ubiquitin ligases RNF14 in preparing treatment fatty liver and relevant disease drug | |
| CN113388615A (en) | MiRNA for preventing and/or treating acute pancreatitis and pharmaceutical application thereof | |
| CN102895671B (en) | Application of microRNA to prevention and / or treatment of heart disease | |
| CN113599412A (en) | Application of radix codonopsis and radix astragali composition in preparation of medicine for preventing and treating symptoms related to advanced tumor | |
| CN112494487A (en) | Application of hirsutine in preparation of medicines for improving insulin resistance, diabetes and complications thereof | |
| CN110496225A (en) | Stephanine and autophagy inhibitor are combined the application in preparation treatment liver-cancer medicine | |
| CN109908167A (en) | Application of the linarin in preparation protection renal cells ischemical reperfusion injury drug/pharmaceutical composition | |
| CN102526072B (en) | Application of Lanosta-7,9(11),24-trien-3-one 15,26-dihydroxy-sterane triterpene in preparation of medicament for preventing and/or treating EV71 infection | |
| CN110755621B (en) | Composition containing Senp expression regulating reagent and application of composition in preparation of anti-hepatic fibrosis medicine | |
| CN114452280B (en) | Application of atractylone in preparation of glioma treatment drug | |
| CN107582525A (en) | TRIM31 inhibitor magnetic target drug bearing microspheres are preparing the application in suppressing PDAC multiplication capacity medicines | |
| CN107496390A (en) | Application of the protosappanin A derivative in caused by chemotherapeutic medicines heart injury is protected | |
| CN102008493A (en) | Application of panaxadiol saponin in preparing medicines combined with glucocorticoid receptor | |
| CN106749548A (en) | ATF3 albumen excitement polypeptide and its application | |
| CN105147684B (en) | Application of the pipering in the anti-medicine that cures the septicaemia is prepared | |
| CN116270934A (en) | Traditional Chinese medicine composition with effects of inhibiting PTP1B over-expression and regulating and controlling allogenic adhesion crosstalk | |
| CN101195814B (en) | Cell vaccine for preventing and controlling hepar damnification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |