CN104491496A - Application of gastrodin/gastrodia powder in anti-liver fibrosis medicine preparation - Google Patents
Application of gastrodin/gastrodia powder in anti-liver fibrosis medicine preparation Download PDFInfo
- Publication number
- CN104491496A CN104491496A CN201510019139.5A CN201510019139A CN104491496A CN 104491496 A CN104491496 A CN 104491496A CN 201510019139 A CN201510019139 A CN 201510019139A CN 104491496 A CN104491496 A CN 104491496A
- Authority
- CN
- China
- Prior art keywords
- gastrodine
- rat
- rhizoma gastrodiae
- liver tissue
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/898—Orchidaceae (Orchid family)
- A61K36/8988—Gastrodia
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Alternative & Traditional Medicine (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Medical Informatics (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Medicines Containing Plant Substances (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to the field of medicine and relates to application of gastrodin in anti-liver fibrosis medicine preparation. Systematic research on the I-type collagen alpha1 promoter activity inhibiting effect, the influence on ALT and AST contents in rat serum, the influence on a rat liver tissue pathogeny structure, the influence on rat liver tissue hydroxyproline content, the influence on rat liver tissue oxidative stress reaction and the influence on rat liver fibrosis degree proves that the gastrodin has good anti-liver fibrosis acitivity and is hopeful to be developed to be new anti-liver fibrosis medicine.
Description
Technical field:
The invention belongs to field of medicaments, relate to gastrodine/Rhizoma Gastrodiae powder and preparing the application in anti-hepatic fibrosis medicines.
Background technology:
Hepatic fibrosis is the pathological process of liver extracellular matrix (particularly NTx α 1) over-deposit, and it is that body reacts the one reparation of acute and chronic hepatic injury.The chronic hepatopathy that the various cause of disease causes and some hepar damnification caused by noxious substance, all can cause hepatocyte inflammation downright bad, and the Fibrotic pathological characters of secondary.Hepatic fibrosis (hepaticfibrosis, HF) is to the liver cirrhosis even important step of primary hepatoma development, causes the principal disease of hepatic fibrosis to be hepatitis B in China.Traditional view is thought, once after there is fibrosis in the liver of people, can not take a turn for the worse, and famous hepatopathy expert Rogking proposes after furtheing investigate hepatic fibrosis, the typical liver hepatic fibrosis of people can reverse, and this is significant to liver cirrhosis, hepatocarcinoma malignant development by hepatitis to effectively controlling hepatic disease.For many years, Chinese scholars has carried out large quantity research in the mechanism of hepatic fibrosis, regulate factors, Treatment and diagnosis.Although experimentation medication is many, so far except for except causing the cause of disease of hepatic fibrosis, still can not be used for clinical efficient, without the Western medicine of obvious toxic-side effects.Clinical practice shows, Chinese medicine hepatic fibrosis shows very large potentiality improving in clinical symptoms etc.At present, the anti-hepatic fibrosis Chinese medicine of China's Clinical practice has: FUZHENG HUAYU JIAONANG, FUFANG BIEJIA RUANGAN PIAN, Radix Et Rhizoma Rhei et Eupolyphaga Seu Steleophaga Pilulae, little bupleurum preparation, liver-strengthening capsule etc.Described medicine is compound Chinese medicinal preparation, is made up of kinds of traditional Chinese medicines, and all not containing Rhizoma Gastrodiae composition in all compound preparations.
Rhizoma Gastrodiae is the orchid family Gastrodia plant, and its dry tuber, also known as Rhizoma Gastrodiae (GastrodiaelataBlume), is commonly use and famousr and precious Chinese medicine simply, is clinically used for the disease such as headache dizzy, numb limbs and tense tendons, infantile convulsion, epilepsy, tic, tetanus.Gastrodine (Gastrodin) is one of effective monomer component of Rhizoma Gastrodiae, is mainly used in treatment cardiovascular and cerebrovascular disease and nervous system disease at present clinically.Gastrodine CAS 62499-27-8, molecular formula C
13h
18o
7, molecular weight 286.3, molecular structural formula is:
In recent years, this laboratory, by finding, as the gastrodine/Rhizoma Gastrodiae powder of single medicinal material, to have the activity of anti-hepatic fibrosis to the systems biology activity research of gastrodine/Rhizoma Gastrodiae powder, has carried out follow-up further investigation work then.The application of described gastrodine/Rhizoma Gastrodiae powder in anti-hepatic fibrosis, up to now, there is not yet relevant report both domestic and external.
Summary of the invention:
The invention provides gastrodine/Rhizoma Gastrodiae powder and prepare the application in anti-hepatic fibrosis medicines.
Present invention also offers gastrodine/Rhizoma Gastrodiae powder is that the compositions that effective ingredient and pharmaceutically acceptable carrier form is preparing the application in anti-hepatic fibrosis medicines.
The present invention utilizes NTx α 1 gene C OL1A1 promoter as the target of drug screening, constructs anti-hepatic fibrosis medicines cell screening model, and uses this model discrimination to go out gastrodine/Rhizoma Gastrodiae powder to have significant inhibitory action to COL1A1 promoter.For determining the effect of anti hepatic fibrosis of gastrodine/Rhizoma Gastrodiae powder further, the present invention prepares the SD rat model of common bile duct ligation, and Liver Function, hepatic tissue pathology structure, extent of liver fibrosis, collagen contents and oxidative stress degree are detected, result shows, and gastrodine/Rhizoma Gastrodiae powder can suppress the generation of hepatic fibrosis.
When the present invention is used for Strategies of Anti-fibrosis Therapy, Rhizoma Gastrodiae powder oral administration, the oral or non-oral administration of gastrodine all belongs to safely and effectively.Oral medication can make any regular dosage form, as tablet, capsule, powder, granule etc.; Non-oral administration, can be made into injection liquid etc.
Gastrodine dosage of the present invention can change according to factor adjustment such as taking mode, state of an illness weight and patient age, is generally human oral dosage form and is selected from 1-100mg/ day; Adult injection dosage is selected from 1-50mg/ day.
When the present invention is for the preparation of anti-hepatic fibrosis medicines, its adjuvant and preparation method can the upper acceptable any forms of drug of choice.
Accompanying drawing illustrates:
Fig. 1-gastrodine is to the inhibitory action of NTx protein alpha 1 promoter activity
Wherein: * p<0.05 is compared with matched group (administration concentration is zero).
Fig. 2-gastrodine is on the impact of rat liver tissue pathologic structure
Wherein: A is rats in sham-operated group liver tissue slices HE coloration result; B is model group rats liver tissue slices HE coloration result; C is administration gastrodine group rat liver tissue section HE coloration result; D is the cartogram to all animal tissues bile duct proliferation situation; E is the cartogram * p<0.05 to the downright bad situation of all animal tissues, and * * p<0.01 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
Fig. 3-gastrodine is on the impact of rat liver fibrosis degree
Wherein: A is rats in sham-operated group liver tissue slices sirius red stains result; B is model group rats liver tissue slices sirius red stains result; C is administration gastrodine group rat liver tissue section sirius red stains result; D is the cartogram to all animal tissues sirius red stains area
* p<0.05 and BDL group is compared; ##p<0.01 is compared with sham operated rats.
Fig. 4-gastrodine is on the impact of rat liver tissue hydroxyproline content
Wherein: * p<0.05 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
Fig. 5-gastrodine is on the impact of rat liver tissue response to oxidative stress
Wherein: * p<0.05 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
Fig. 6-Rhizoma Gastrodiae powder is to the inhibitory action of NTx protein alpha 1 promoter activity
Wherein: * p<0.05, * * p<0.01 is compared with matched group (administration concentration is zero).
Fig. 7-Rhizoma Gastrodiae powder is on the impact of rat liver tissue pathologic structure
Wherein: A is rats in sham-operated group liver tissue slices HE coloration result; B is model group rats liver tissue slices HE coloration result; C is administration Rhizoma Gastrodiae powder group rat liver tissue section HE coloration result; D is the cartogram to the downright bad situation of all animal tissues
* p<0.01 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
Fig. 8-Rhizoma Gastrodiae powder is on the impact of rat liver fibrosis degree
Wherein: A is rats in sham-operated group liver tissue slices sirius red stains result; B is model group rats liver tissue slices sirius red stains result; C is administration Rhizoma Gastrodiae powder group rat liver tissue section sirius red stains result; D is the cartogram to all animal tissues sirius red stains area
##p<0.01 is compared with sham operated rats.
Fig. 9-Rhizoma Gastrodiae powder is on the impact of rat liver tissue hydroxyproline content
Wherein: ##p<0.01 is compared with sham operated rats.
Detailed description of the invention:
Describe the present invention below in conjunction with drawings and Examples, but described content is explanation of the invention instead of restriction.
" embodiment 1 " gastrodine suppresses the test of NTx protein alpha 1 promoter activity
The monoclonal cell strain LX2-COL of 1.1 structure stably express NTx protein alpha 1 promoter COL1A1P
Adopt genome DNA extracting reagent kit, extract the genomic DNA of LX2 cell (Mount Sinai School ofMedicine).Utilize ncbi database people full-length genome information NTx α 1 gene C OL1A1 sequence (serial number: NC_000017.11) precontract 2400bp, as COL1A1 promoter sequence.Application primer premier5.0 primer-design software, the primer of design COL1A1 promoter, upstream and downstream primer sequence is respectively 5 ' AAGAGCTCGTGGGAAAGCCTGGATGG3 ' (containing Sac I restriction enzyme site), 5 ' AAAGATCTTTTGGGACTTACTGTCTTCGT 3 ' (containing Bgl II restriction enzyme site).With the genomic DNA of LX2 cell for template, carry out pcr amplification, obtain object fragment NTx α 1 gene C OL1A1 promoter, and utilize agarose gel electrophoresis Preliminary Identification PCR primer.
NTx α 1 gene C OL1A1 promoter fragment is connected after Sac I and Bgl II double digestion with pGL4.17 [luc2/Neo] carrier, in coupled reaction liquid transformation of E. coli DH5 α competence, at LB solid plate, be inverted for 37 DEG C and cultivate 16-20h, picking amicillin resistance monoclonal, extracts plasmid DNA.Utilize the technology Preliminary Identification positive colonies such as bacterium colony PCR, enzyme action, obtain recombiant plasmid, called after pGL4.17-COL1A1P
In DMEM (Gibco) culture medium containing 10% hyclone, 37 DEG C, under 5%CO2 condition, cultivate LX2 cell.According to every hole 5 × 10
4individual cell is laid on 48 orifice plates, cultivates 24h and in 6 orifice plates, cultivates LX2 cell reach when converging close to 90%-95%, carry out cell transfecting.After 24h, add Concentraton gradient G418 (AMERCO), final selection concentration is 100 μ gmL
-1g418 continue the LX2 cell cultivating transfection pGL4.17-COL1A1P plasmid, and change liquid in time.After the cell in 6 orifice plates covers with, spread unicellular to 96 orifice plates.Treat unicellularly to grow up to clone (about 1 week-2 week), add D-fluorescein (ThermoFisher) to final concentration 60 μ gmL
-1, utilize living body biological luminescence imaging system (IVIS 200, Xenogen) to take, select the monoclonal cell strain LX2-COL that signal is the strongest, and amplification culture.
The monoclonal cell LX2-COL of the stably express NTx protein alpha 1 promoter COL1A1P built above is laid on 96 hole blanks, every hole 2 × 10 by 1.2
4individual cell.After cell confluency degree about 90%, serum-free culture 24h, adds TGF-β 1 (2ng/ml) induction, adds the gastrodine (commercially available prod) of Concentraton gradient simultaneously, concentration is respectively 1 μ g/ml, 3 μ g/ml, 30 μ g/ml, often organizes experiment and establishes 3 multiple holes.According to Bright-Glo
tMluciferase Assay System description operating procedure, inhales after 24h and abandons culture medium, add any culture medium 50 μ l/ hole.Add luciferase substrate 50 μ l/ hole, detect after 2min.Result shows, and along with the rising of gastrodine concentration, fluorescence intensity weakens, and when gastrodine concentration is 3 μ g/ml and 30 μ g/ml, fluorescence intensity obviously weakens (Fig. 1).Show, gastrodine, when concentration is 3 μ g/ml and 30 μ g/ml, has obvious inhibitory action to COL1A1 promoter activity.
The Liver Fibrosis Model preparation of " embodiment 2 " SD rat common bile duct ligation induction
Select body weight at the SD male rat 19 of 180-220g, be divided into sham operated rats, model group, gastrodine administration (500mg/kg) group at random, wherein sham operated rats 5, model group 7, gastrodine group 7.Before zoopery after fasting 12h, perform the operation with isoflurane anesthesia animal.Wherein model group and administration group do common bile duct ligation (BDL), under sterile working, make Median incision on upper abdomen, raise liver edge, pull open duodenum, are separated ductus choledochus 2-3cm.In No. 000 each ligation twice of silk thread in nearly duodenum place and nearly hepatic portal place, cut off common bile duct from centre.Sham operated rats is only made Median incision on upper abdomen and is sewed up, and does not do common bile duct ligation.After Animal Anesthesia is clear-headed, normal diet, freely drinks water, intramuscular injection penicillin 3 days, in case infect, experimental temperature (22 ± 2) DEG C.After modeling the 2nd day starts gastric infusion, gives normal saline (sham operated rats, model group) and gastrodine 500mg/kg (gastrodine administration group) respectively, every day 1 time, administration 14 days.
The inhibitory action that the rat blood serum ALT/AST level that " embodiment 3 " gastrodine is induced BDL raises
Fasting 12h before sampling, with 10% chloral hydrate anesthesia rat, gets ventral aorta blood.The centrifugal 5min of 800rpm, gets the Activity determination that serum carries out glutamic oxaloacetic transaminase, GOT (AST) and glutamate pyruvate transaminase (ALT).Result shows, and gastrodine obviously can suppress the content (table 1) of ALT and AST in rat blood serum, shows that gastrodine can improve Liver Function.
Table 1. gastrodine is on the impact of the rat blood serum ALT/AST level that BDL induces
* p<0.01 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
The inhibitory action that the rat liver pathologic structure that " embodiment 4 " gastrodine is induced BDL changes
Sampling before fasting 12h, put to death rat, get liver organization, cut hepatomegaly leaf texture block put into 10% formalin fix.Paraffin section is made through dehydration, paraffin embedding, section, roasting sheet etc.Utilize Hematoxylin-eosin (HE) dyeing liquor to dye, observe rat liver tissue pathologic structure situation of change.Result shows, and rats in sham-operated group liver organization hepatocyte is regularly arranged, and lobules of liver is complete, without inflammatory cell infiltration and bile duct proliferation situation; After BDL, rat liver tissue pathologic structure occurs obviously to change, and bile duct proliferation is fairly obvious, tissue necrosis showed increased; The liver tissues of rats structure of gastrodine administration group be improved significantly, bile duct proliferation situation is significantly suppressed, and tissue necrosis degree obviously reduces (Fig. 2).Show, gastrodine obviously can improve the pathologic structure of BDL rat liver tissue.
" embodiment 5 " gastrodine is to the inhibitory action of the rat liver fibrosis that BDL induces
By paraffin section sirius red stains, observe rat liver tissue fibrosis situation.Result shows, and after BDL, rat liver tissue fibrosis obviously increases, and after gastrodine administration, fibrosis is obviously suppressed (Fig. 3).Show, the rat liver fibrosis that gastrodine can obviously suppress BDL to induce.
" embodiment 6 " gastrodine is on the impact of hydroxyproline content in rat liver tissue
Fasting 12h before sampling, puts to death rat, gets liver organization, accurately take 30-100mg, operate according to hydroxyproline testing cassete (building up Bioengineering Research Institute purchased from Nanjing) description.Result shows, and compared with rats in sham-operated group, in BDL group rat liver tissue, hydroxyproline content obviously raises; Compared with BDL group, after administration gastrodine, in rat liver tissue, hydroxyproline content significantly reduces (Fig. 4).Show, gastrodine obviously can reduce the content of hydroxyproline in liver organization, and namely gastrodine obviously can suppress the generation of collagen fiber in BDL rat.
" embodiment 7 " gastrodine is to the inhibitory action of the rat liver tissue response to oxidative stress that BDL induces
Fasting 12h before sampling, puts to death rat, gets liver organization, is cut into small pieces and temporarily preserves in liquid nitrogen, transfer to-80 DEG C of preservations subsequently.Accurately take tissue weight, according to weight (g): the ratio of volume (ml)=1:9 adds the pre-cold saline of 9 times of volumes, grinds in ice bath, preparation homogenate, 3000-4000rpm, centrifugal 10-15min, get 10% homogenate supernatant to be measured.According to the operating procedure of malonaldehyde, nitric oxide (one-step method), superoxide dismutase testing cassete (building up Bioengineering Research Institute purchased from Nanjing), detect the changes of contents of malonaldehyde (MDA), nitric oxide (NO) and the superoxide dismutase (SOD) in hepatic tissue.Result shows, and compared with the rat of sham operated rats, in the rat liver tissue of BDL group, MDA and NO content obviously raises, and SOD content obviously reduces; Compared with BDL group, after gastrodine administration, in rat liver tissue, MDA and NO content significantly reduces, and SOD content significantly raises (Fig. 5).Show, gastrodine obviously can suppress the response to oxidative stress of rat liver tissue.
" embodiment 8 " Rhizoma Gastrodiae powder suppresses NTx protein alpha 1 promoter activity
According to method described in " embodiment 1 ", detect Rhizoma Gastrodiae powder (commercially available prod, the granularity 250-800 order) inhibitory action to NTx protein alpha 1 promoter activity, wherein the Concentraton gradient of Rhizoma Gastrodiae powder is 1 μ g/ml, 30 μ g/ml, 100 μ g/ml.Result shows, and along with the rising of Rhizoma Gastrodiae powder concentration, fluorescence intensity weakens, and when Rhizoma Gastrodiae powder concentration is 30 μ g/ml and 00 μ g/ml, fluorescence intensity obviously weakens (Fig. 6).Show, Rhizoma Gastrodiae powder, when concentration is 30 μ g/ml and 00 μ g/ml, has obvious inhibitory action to COL1A1 promoter activity.
The inhibitory action that the rat blood serum ALT/AST level that " embodiment 9 " Rhizoma Gastrodiae powder is induced BDL raises
According to the method in " experimental example 2 " and " embodiment 3 ", detect Rhizoma Gastrodiae powder to the impact of the rat blood serum ALT/AST level that BDL induces.Wherein, the gastric infusion amount of Rhizoma Gastrodiae powder is every rat 5g/kg every day.Result shows, and Rhizoma Gastrodiae powder obviously can suppress the content (table 2) of ALS and AST in rat blood serum.Show, Rhizoma Gastrodiae powder can improve Liver Function.
Table 2. Rhizoma Gastrodiae powder is on the impact of the rat blood serum ALT/AST level that BDL induces
* p<0.01 is compared with BDL group; ##p<0.01 is compared with sham operated rats.
" embodiment 10 " Rhizoma Gastrodiae powder is on the impact of the rat liver tissue pathologic structure that BDL induces
According to " embodiment 4 " described method, observe the impact that Rhizoma Gastrodiae powder changes the rat liver pathologic structure that BDL induces.Result shows, and rats in sham-operated group liver organization cell is regularly arranged, and lobules of liver is complete, without inflammatory cell infiltration and bile duct proliferation situation; After BDL, rat liver tissue pathologic structure occurs obviously to change, and bile duct proliferation is fairly obvious, tissue necrosis showed increased; The liver tissues of rats structure of Rhizoma Gastrodiae powder administration group improves, and tissue necrosis degree obviously reduces (Fig. 7).Show, Rhizoma Gastrodiae powder obviously improves the downright bad situation of BDL rat liver tissue.
" embodiment 11 " Rhizoma Gastrodiae powder is on the impact of the rat liver fibrosis that BDL induces
By paraffin section sirius red stains, observe rat liver tissue fibrosis situation.Result shows, and after BDL, rat liver tissue fibrosis obviously increases, and after Rhizoma Gastrodiae powder administration, fibrosis improves, but not statistically significant (Fig. 8).Show, Rhizoma Gastrodiae powder has certain inhibitory action to the rat liver fibrosis that BDL induces.
" embodiment 12 " Rhizoma Gastrodiae powder is on the impact of hydroxyproline content in rat liver tissue
According to method described in " embodiment 6 ", detect Rhizoma Gastrodiae powder to the impact of hydroxyproline content in rat liver tissue.Result shows, and compared with rats in sham-operated group, in BDL group rat liver tissue, hydroxyproline content obviously raises; Compared with BDL group, after Rhizoma Gastrodiae powder administration, in rat liver tissue, hydroxyproline content reduces, but not statistically significant (Fig. 9).Show, Rhizoma Gastrodiae powder has certain inhibitory action to the generation of collagen fiber in rat liver.
Claims (4)
1. gastrodine is preparing the application in anti-hepatic fibrosis medicines.
2. gastrodine described in claim 1 is that the compositions that effective ingredient and pharmaceutically acceptable carrier form is preparing the application in anti-hepatic fibrosis medicines.
3. the application described in claim 1 or 2, is characterized in that, clinical application can make gastrodine peroral dosage form and non-oral dosage forms; Peroral dosage form comprises tablet, capsule, powder, granule etc., and non-oral dosage forms can be injection liquid etc.
4. the application described in claim 1,2 or 3, is characterized in that, gastrodine dosage can change according to factor adjustment such as taking mode, state of an illness weight and patient age, is generally human oral dosage form and is selected from 1-100mg/ day; Adult injection dosage is selected from 1-50mg/ day.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019139.5A CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
| PCT/CN2016/000019 WO2016112787A1 (en) | 2015-01-14 | 2016-01-12 | Application of gastrodin or gastrodin powder in preparing anti-hepaticfibrosis pharmaceutical |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019139.5A CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104491496A true CN104491496A (en) | 2015-04-08 |
| CN104491496B CN104491496B (en) | 2017-08-18 |
Family
ID=52933010
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510019139.5A Active CN104491496B (en) | 2015-01-14 | 2015-01-14 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104491496B (en) |
| WO (1) | WO2016112787A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016112787A1 (en) * | 2015-01-14 | 2016-07-21 | 中国医学科学院医药生物技术研究所 | Application of gastrodin or gastrodin powder in preparing anti-hepaticfibrosis pharmaceutical |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103566198A (en) * | 2012-08-06 | 2014-02-12 | 中国医学科学院医药生物技术研究所 | Application of gastrodia elata and gastrodin in preparation of product used for treating non-alcoholic fatty liver disease |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101683411B (en) * | 2008-09-24 | 2012-09-19 | 汪鋆植 | Application of crab apple extract in preparing hepatic or health-care food |
| CN101524386B (en) * | 2009-04-17 | 2011-11-16 | 暨南大学 | Chinese herbal main component prescription for curing fatty liver |
| CN104491496B (en) * | 2015-01-14 | 2017-08-18 | 中国医学科学院医药生物技术研究所 | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared |
-
2015
- 2015-01-14 CN CN201510019139.5A patent/CN104491496B/en active Active
-
2016
- 2016-01-12 WO PCT/CN2016/000019 patent/WO2016112787A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103566198A (en) * | 2012-08-06 | 2014-02-12 | 中国医学科学院医药生物技术研究所 | Application of gastrodia elata and gastrodin in preparation of product used for treating non-alcoholic fatty liver disease |
Non-Patent Citations (1)
| Title |
|---|
| 王志平等: "天麻素对CCl4 诱导小鼠肝损伤的保护作用", 《武警医学院学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016112787A1 (en) * | 2015-01-14 | 2016-07-21 | 中国医学科学院医药生物技术研究所 | Application of gastrodin or gastrodin powder in preparing anti-hepaticfibrosis pharmaceutical |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016112787A1 (en) | 2016-07-21 |
| CN104491496B (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Kupffer cells in non-alcoholic fatty liver disease: friend or foe? | |
| KR20160105523A (en) | Use of alphavirus in preparation of antitumor drugs | |
| Wang et al. | Traditional Chinese Medicine Ginseng Dingzhi Decoction Ameliorates Myocardial Fibrosis and High Glucose‐Induced Cardiomyocyte Injury by Regulating Intestinal Flora and Mitochondrial Dysfunction | |
| CN111420030B (en) | Application of FGF21 in preparation of medicine for treating colorectal cancer | |
| Ao et al. | Matrine inhibits synovial angiogenesis in collagen-induced arthritis rats by regulating HIF-VEGF-Ang and inhibiting the PI3K/Akt signaling pathway | |
| CN105232501B (en) | Pierce the purposes of your ketone of Radix Glycyrrhizae Check | |
| Tan et al. | Traditional Chinese medicine Bao Gan Ning increase phosphorylation of CREB in liver fibrosis in vivo and in vitro | |
| Tan et al. | Erchen Plus Huiyanzhuyu Decoction Inhibits the Growth of Laryngeal Carcinoma in a Mouse Model of Phlegm‐Coagulation‐Blood‐Stasis Syndrome via the STAT3/Cyclin D1 Pathway | |
| US20230057861A1 (en) | Use of corydalis saxicola bunting and formulation thereof in preparation of drug for treating non-alcoholic fatty liver diseases | |
| CN109045035A (en) | Application of 7- (2,2- dimethyl -3- crotonoyl the amido)-octahydro benzene quinoline acetic acid esters in preparation treatment liver disease drug | |
| CN103191106B (en) | Application of genipin amino acid derivative as NF-kappa B inhibitor | |
| CN106265620A (en) | The clever C of Aunar and the like application in the medicine of preparation preventing and treating metabolic disease | |
| CN104491496A (en) | Application of gastrodin/gastrodia powder in anti-liver fibrosis medicine preparation | |
| Mao et al. | Yunpi Heluo decoction attenuates insulin resistance by regulating liver miR-29a-3p in Zucker diabetic fatty rats | |
| CN104257656B (en) | A kind of collaborative pharmaceutical composition strengthening suppression tumor growth | |
| CN110090209A (en) | Application of the formoononetin in treatment nonalcoholic fatty liver | |
| CN102038772A (en) | Method for preparing Chinese medicinal pawpaw decoction pieces | |
| CN111110672B (en) | Application of DYZ-9 in preparation of anti-myocardial hypertrophy products | |
| CN112933120B (en) | Application of kauri pine extract in preparing product for resisting non-alcoholic fatty liver disease | |
| CN103565819A (en) | Composition for inhibiting tumor stem cells | |
| CN105213405A (en) | Dihydrotanshinone I is preparing the application in anti-hepatic fibrosis medicines | |
| CN102247347A (en) | Application of taurine in preparing medicament for preventing nerve cell damage caused by dependence producing medicaments | |
| CN112494487A (en) | Application of hirsutine in preparation of medicines for improving insulin resistance, diabetes and complications thereof | |
| CN105748448A (en) | Application of D-chiro-inositol in preparation of hepatic fibrosis resisting medicine | |
| He et al. | Efficacy and mechanism of a chinese classic prescription of Yueju in treating nonalcoholic steatohepatitis and protecting hepatocytes from apoptosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |