CN103923978A - Molecular diagnostic method for nitrogen nutrition of field potato plants and application of method in fertilization - Google Patents
Molecular diagnostic method for nitrogen nutrition of field potato plants and application of method in fertilization Download PDFInfo
- Publication number
- CN103923978A CN103923978A CN201410094874.8A CN201410094874A CN103923978A CN 103923978 A CN103923978 A CN 103923978A CN 201410094874 A CN201410094874 A CN 201410094874A CN 103923978 A CN103923978 A CN 103923978A
- Authority
- CN
- China
- Prior art keywords
- nitrogen
- gene
- potato plant
- land
- field crops
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular diagnostic method for nitrogen nutrition of field potato plants. Specifically speaking, a nitrate reductase (NR) gene related to nitrogen absorption by potato plants is used as a molecular marker for judging the states of nitrogen nutrition of field potato plants. During diagnosis, RNA of a field potato plant is used as a template, reverse transcription is carried out to obtain cDNA, the expression level of the NR gene is detected by using real-time PCR, the state of nitrogen nutrition of the field potato plant is judged according to the expression level of the NR gene, and whether to carry out topdressing of a nitrogenous fertilizer and the amount of topdressing of the nitrogenous fertilizer can be further determined. The diagnostic method has the advantages of good accuracy in judgment, high sensitivity, etc.
Description
Technical field
The invention belongs to nutrition and the fertilizing management technical field of potato, the molecular diagnosis method that relates to the potato plant nitrogen nutrition of a kind of land for growing field crops, more particularly, adopt the expression amount of the method quantitative analysis plant leaf nitrate reductase NR gene of Real time PCR, judge the nitrogen nutritional status of land for growing field crops potato plant, and determine whether to need fertilising and concrete rate of fertilizer application, for land for growing field crops nitrogen fertilizer management provides guidance.
Background technology
Nitrogen is the indispensable nutritive element of crop growth, and it is the integral part of plant materials inner chlorophyll, protein, nucleic acid, is again the integral part of a lot of endogenous hormones, accounts for 1%～7% of plant dry weight.The height of chlorophyll content, directly affects photosynthetic size, and in certain degree, has reflected that blade is containing nitrogen level.Nitrogenous fertilizer management plays an important role to potato planting benefit and environmental influence, and in China's crop production ubiquity to execute nitrogen level too high, cause waste and the environmental pollution of nitrogen.Nitrogenous fertilizer is under-supply or excessive, all can affect the nitrogen metabolism in plant materials, thereby destroys carbon nitrogen metabolism balance, reduces the yield and quality of crop.Nitrogen under-supply reduction stem tuber output and size, too much nitrogen supply affect stem tuber quality as reduced dry matter content, and nitrate concentration increases, and increases l-asparagine and accumulates, and this can cause forming in cooking process acrylamide.Nitrogen in environment runs off with Nitrate leaching and nitrous oxide discharging modes.Therefore, effective means is to realize executing nitrogen and crop needs nitrogen budgets, according to the needs of crop, execute nitrogen, but the in the situation that of Production of Large Fields, there is very large difficulty in the balance that realizes both, because the soil between different year, different field needs nitrogen to have larger difference for nitrogen and crop.Conventional potato nitrogen nutrition diagnosis method has the diagnosis of plant outward appearance at present, total nitrogen diagnosis, soil nitrogen test, the methods such as plant Nitrate quick test and measuring chlorophyll content, wherein the most common optical means is to measure chlorophyllous relative content (SPAD value) with chlorophyll meter (SPAD502), chemical process is the content of nitric nitrogen, according to the content of SPAD value and nitric nitrogen, evaluate plant nitrogen nutritional status (Zebarth and Rosen, 2007), but these methods are indirect determination methods, and be subject to soil moisture, the impact (Olfs et al. 2005) of the environmental factorss such as nutrient and potato fertility phase.Plant is by the variation response environment stress (Hazen et al., 2003) of genetic expression, and therefore, gene quantification is expressed can provide a kind of measurement plant nitrogen abundance whether more direct measure.
When sufficient for nitrogen in soil, nitric nitrogen is present in Vacuoles of Plants with a kind of half deposit state as non-metabolic substd, therefore the nitric nitrogen in plant materials comprises nitric nitrogen (storage vault) and the intracytoplasmic nitric nitrogen (metabolic pool) of laying in vacuole, when plant needs nitrogen increase or nitrogen stress, the increased activity of nitrate reductase, utilize the nitric nitrogen of laying in Vacuoles of Plants, there is corresponding relation in the nitric nitrogen of laying in the activity of nitrate reductase and Vacuoles of Plants, the nitric nitrogen of laying in the activity of nitrate reductase and vacuole more directly and delicately reflects the demand of crop to nitrogen than the content of plant nitric nitrogen, and the nitric nitrogen of laying in vacuole is difficult to measure separately, therefore, can replace full nitrogen with the activity of nitrate reductase or the expression level of nitrate reductase gene, nitric nitrogen is as Nitrogen Nutrition Diagnosis index, estimate more accurately plant nitrogen nutritional status.Li etc. find in nitrogen stress situation potato test-tube plantlet nitrate reductase and nitrite reductase down regulation of gene expression in 3 days by ciltivating process, but under artificial greenhouse condition, adopt nutritive medium, nitrogen is nitric nitrogen, the nitrogen concentration gradients that arranges is less, and (nitrogen concentration reduces suddenly or significantly reduces, sufficient (7.5 mM NO
3 -), limited (0.75 mM NO
3 -), and nitrogen stress (0 mM NO
3 -), the plant adopting is thin and weak test-tube plantlet (plant height 8-10cm, the thick 2-3mm of stem), only carry out the short period of time cultivation of (7 days), do not relate to the formation of potato tuber, expand, more do not relate to output, the nitrogen needing is few, and potato production is to carry out in field, what adopt is potato seed stripping and slicing plantation, robust plant (plant height 50-70cm, the thick 10-15mm of stem), in soil, itself contain certain density nitrogen, in potato seed, containing certain nutrition supplying plant strain growth absorbs in earlier stage, the nitrogen that use in field is urea or composite fertilizer, the nitric nitrogen that is different from water planting, what Fertilization Level adopted is not volumetric molar concentration, but unit surface rate of fertilizer application (south China potato generally adopt be that mu is executed the pure N of 15kg), the time of plantation is a longer growth season, more than 80 days, comprise the potato seeding stage, seedling stage, stem tuber forms the phase, 5 periods such as stem tuber expanding stage and stem tuber ripening stage, relate to the formation of output, need a large amount of nitrogen, so the potato plant under the environment of land for growing field crops is complicated more than water planting test-tube plantlet, the result of study of Li etc. to land for growing field crops potato plant Nitrogen Nutrition Diagnosis and fertilising without any reference.Up to now, also do not using NR gene expression amount as the research report of weighing land for growing field crops potato plant nitrogen nutritional status.
Summary of the invention
Technical problem to be solved by this invention is: for the deficiency of existing indirect determination method, provide a kind of high-accuracy
nRgene expression amount is as the molecular diagnosis method of weighing plant nitrogen nutritional status.
In order to solve the problems of the technologies described above, the technical solution adopted in the present invention is:
A molecular diagnosis method for land for growing field crops potato plant nitrogen nutrition is to using the expression amount of the relevant nitrate reductase gene NR of potato plant Nitrogen Absorption as the molecule marker of diagnosis land for growing field crops potato plant nitrogen nutritional status.
Specifically comprise that the method for Real time PCR detects the expression of nitrate reductase gene NR, diagnoses land for growing field crops potato plant nitrogen nutritional status.
The sequence of Real time PCR the primer is as follows:
Forward primer: 5'-TGGACATATCTATGATGCCTCACG-3'(SEQ ID NO.1),
Reverse primer: 5'-AGTTCACCAATCCTAAAGTCCTCCA-3'(SEQ ID NO.2).
House-keeping gene is Actin
Forward primer: 5'-AGGTCCTCTTCCAGCCATCCA-3'(SEQ ID NO.3),
Reverse primer: 5'-CCACTGAGCACAATGTTACCGTAG-3'(SEQ ID NO.4).
Detection method of the present invention specifically comprises the following steps:
1) acquisition of potato plant blade RNA
Field is got potato plant top first and is launched leaf completely, the 4th leaf normally, and laboratory is processed and taken back to liquid nitrogen, takes trizol method to extract RNA;
2) take the RNA that step 1) obtains is template, by reverse transcription, obtains cDNA;
3) take step 2) cDNA that obtains is template, carries out Real time pcr amplification;
4) take Actin gene as internal reference, by analyzing, calculate the relative expression quantity Δ Ct of NR gene.Wherein, Δ Ct=Ct
nR-Ct
actin, Ct
nRand Ct
actinrepresent that respectively nitrate reductase gene NR and the reference gene actin gene Actin fluorescent signal in each reaction tubes in Real time pcr amplification process reaches the cycle number that the threshold value of setting experiences, and threshold value is the fluorescence detection limit of setting on appropriate location in the exponential growth region of amplification curve, the larger required cycle number that increases of Ct value is more, the expression amount of gene is just less, otherwise the expression amount of gene is larger; Δ Ct value is less than zero, represents that the required cycle number of NR gene amplification is less than Actin gene, the Ct of Actin gene
actinmore stable, therefore, Δ Ct value is less, and the expression amount of NR gene is larger, otherwise expression amount is less.
According to fitting formula, calculate the amount of answering nitrogen fertilizer application again, one of them preferred fitting formula is: N=-6.7891* Δ Ct
2-37.622* Δ Ct-43.033, wherein the unit of amount of nitrogen N is purity nitrogen kg/667m
2.
The present invention has determined the calculation formula of nitrogen fertilizer application amount by great many of experiments, the expression amount of NR gene and rate of fertilizer application are carried out to clear and definite quantification, and can directly instruct amount of nitrogen, has practical significance.This is unredeemed in the prior art, is also the aspect that the present invention breaks through.
The present invention replaces full nitrogen, nitric nitrogen as Nitrogen Nutrition Diagnosis index with the expression level of nitrate reductase gene, estimates more accurately plant nitrogen nutritional status, determines nitrogen fertilizer application amount.With at present conventional potato nitrogen nutrition diagnosis method: the indirect determination methods such as the diagnosis of plant outward appearance, total nitrogen diagnosis, soil nitrogen test, plant Nitrate quick test and measuring chlorophyll content are compared, the inventive method is not subject to the environmental factorss such as soil moisture, nutrient, and the impact of potato fertility phase, more accurate, faster and more convenient operation.
Accompanying drawing explanation
Fig. 1 Real time PCR amplification curve, wherein A is ActB gene; B is NR gene.
The matched curve of Fig. 2 Δ Ct and amount of nitrogen.
The matched curve of Fig. 3 SPAD and amount of nitrogen.
Embodiment
Below in conjunction with specific embodiment, the present invention is done to explain further, but specific embodiment is not done any restriction to the present invention.
(1) test arranges 7 and executes nitrogen level (0,3,6,9,12,18 and 24 kg/667m
2) 7 processing, repeat community area 24m 3 times
2, random district group is arranged, wherein 9 kg/667m
2for producing upper suggestion, developed country potato executes nitrogen level.
All communities gather in the crops in emerging for latter 70 days, measurement and calculation cell production, individual plant knot potato number etc.
Stem tuber expanding stage potato, random parietal lobules SPAD value and the Net Photosynthetic Rate of measuring the 4th leaf of 10 strain potato plant (launching leaf completely) in every community, every community is chosen 10 of the parietal lobuleses of the 4th leaf of potato plant (launching leaf completely) at random, liquid nitrogen is preserved and is taken back laboratory, adopt Trizol test kit to extract total RNA, measure RNA concentration, each RNA diluted sample same concentration 0.2 μ g/ μ l.
(2) according to potato Actin in GenBank and NR gene order, with Primer 5.0 design primers, cover this Gene Partial encoding sequence, NR gene (gene accession number GenBank:U76701.1) primer sequence is:
Forward primer: 5'-TGGACATATCTATGATGCCTCACG-3'(SEQ ID NO.1),
Reverse primer: 5'-AGTTCACCAATCCTAAAGTCCTCCA-3'(SEQ ID NO.2);
Actin muscle is one of the most conservative ancient protein of ubiquity in eukaryotic cells.In all cells, all there is expression, its product is necessary to maintaining radical cellular activities, gene expression dose is subject to such environmental effects less, at the great majority of each growth phase or whole continuous expression in tissue almost, or change very little, thereby the present invention adopts actin gene as reference gene, to improve accuracy and reliability.
Actin gene primer sequence is as follows:
Forward primer: 5'-AGGTCCTCTTCCAGCCATCCA-3'(SEQ ID NO.3),
Reverse primer: 5'-CCACTGAGCACAATGTTACCGTAG-3'(SEQ ID NO.4).
Primer is synthetic by Shanghai Sheng Gong Bioisystech Co., Ltd.
(3) with above-mentioned primer, respectively the total RNA extracting is carried out to real time RT-PCR amplification.
The first step is reverse transcription,
First prepare RNA and reverse transcription primer mixture (5 μ l): RNA 2 μ l, [Oligo (dT) 15 primer 0.5 μ l(concentration are 10 μ/M), random primer (concentration is 10 μ/M) 0.5 μ l, ultrapure water mend to 5 μ l.70 ℃ of sex change of mixture 5 minutes, 4 ℃ are cooling 5 minutes;
Configure subsequently inverse transcription reaction liquid (5 μ l), 5 * reaction buffer, 2 μ l, 25mM MgCl
2solution 1 μ l, 10mM dNTPs 0.5 μ l, RNA enzyme inhibitors 0.25 μ l, ThermoScript II 0.5 μ l, ultrapure water are mended to 5 μ l.
5 μ l reaction solutions are joined in RNA/ primer mixture, mix, 42 ℃ are extended 1 hour, 70 ℃ of sex change 15 minutes.
Second step quantitative fluorescent PCR
20 μ l reaction systems: each 1 μ l(concentration of 2 * SYBR Green Real time-PCR mix, 10 μ l, template (cDNA) 2 μ l, forward primer and reverse primer is 10 μ/M), ultrapure water is mended to volume required.
PCR program: after 95 ℃ of 2 minutes denaturations, 40 PCR loop parameters are: 95 ℃ 5 seconds, 60 ℃ 30 seconds.
According to above-mentioned experimental technique, obtain testing data, threshold value and Ct value carry software by quantitative real time PCR Instrument and automatically draw.The relative expression quantity Δ Ct=Ct of NR gene
nR-Ct
actin, Δ Ct value is less, and the expression amount of NR gene is higher, and Δ Ct value is larger, and the expression amount of NR gene is lower.
Wherein: Δ Ct=Ct
nR-Ct
actin, Ct
nRand Ct
actinrepresent that respectively nitrate reductase gene NR and the reference gene actin gene Actin fluorescent signal in each reaction tubes in Real time pcr amplification process reaches the cycle number that the threshold value of setting experiences, and threshold value is the fluorescence detection limit of setting on appropriate location in the exponential growth region of amplification curve, the larger required cycle number that increases of Ct value is more, the expression amount of gene is just less, otherwise the expression amount of gene is larger; Δ Ct value is less than zero, represents that the required cycle number of NR gene amplification is less than Actin gene, the Ct of Actin gene
actinmore stable, therefore, Δ Ct value is less, and the expression amount of NR gene is larger, otherwise expression amount is less.
(4), according to the expression level of respectively executing nitrogen and process NR gene, by setting up fitting formula, can calculate the nitrogen nutritional status of plant and the amount that need to add nitrogenous fertilizer, the quantification of setting up land for growing field crops potato plant nitrogen nutrition molecular diagnostic techniques.
Test-results is shown in Fig. 1 and table 1, and as can be seen from Table 1, along with executing the raising of nitrogen level, chlorophyll content is the trend of rising; The Δ Ct value of NR gene increases with the raising of executing nitrogen level, and the expression amount of NR gene reduces with the raising of executing nitrogen level.And potato yield is the rear downward trend that first rises, 9 kg/667m
2time output the highest, be 1357.27 kg/667m
2, but 6-18 kg/667m
2it is not remarkable that each processes volume variance.Autumn sowing potato is because the season of growth is short, and temperature is high, and plant strain growth and output are not as good as winter sowing potato, and therefore, every mu of nitrogen requirement is lower, 6 kg/667 m
2just can meet its growth, and obtain 1141.25 kg/667m
2output, does not execute nitrogen or too low (3 kg/667m
2), plant strain growth is bad, and chlorophyll is synthetic receives impact, and leaf colour cast is light, and output significantly reduces; Execute nitrogen and cross not remarkable (12, the 18 kg/667m of high yield increase
2) or significantly reduce (24 kg/667m
2), fertilizer utilization efficiency reduces, and causes waste.Aborning, along with target output improves, plant nitrogen requirement increases, and in soil, for nitrogen, reduces, and needs Nitrogen Top Dressing.Because execute the execute nitrogen level that nitrogen level and developed countries potato produce suggestion of output when the highest is 9kg/667m
2, according to the Δ Ct in table 1 and Fertilization Level matched curve (see figure 2), the fit equation 1 that obtains imposing nitrogen is N=-6.7891* Δ Ct
2-37.622* Δ Ct-43.033(R
2=0.9895),, according to SPAD value of chlorophyll content and Fertilization Level matched curve (see figure 3), the fit equation 2 that obtains imposing nitrogen is N=-0.0887*SPAD
2-5.7819*SPAD-85.518(R
2=0.9575), the degree of fitting R of visible Δ Ct
2be greater than the degree of fitting of SPAD, illustrate that the expression of NR gene more can directly reflect that plant nitrogen nutritional status and soil supply nitrogen status, according to fit equation 1 and Δ Ct value, try to achieve amount of nitrogen N(purity nitrogen kg/667m
2), when N is greater than zero, need Nitrogen Top Dressing, when N is less than zero, without Nitrogen Top Dressing.Therefore, nitrate reductase gene (NR), as the molecule marker of weighing potato plant nitrogen nutritional status, is taked Real time PCR to detect plant nitrogen nutrition and is had the advantages such as judgment accuracy is good, sensitivity is high.
Table 1 difference is executed the impact of nitrogen level on potato planted in autumn chlorophyll content, NR gene expression amount and output
In table, mean number is through the multiple extreme difference test of DucanShi, and lowercase represents 5% level, and capitalization represents 1% level.
<110> Agricultural University Of Hunan
<120> land for growing field crops potato plant nitrogen nutrition molecular diagnosis method and the application in fertilising
<160> 4
<210> 1
<211> 24
<212> DNA
<213> artificial sequence
<220>
The description of <223> artificial sequence: the sequence of synthetic
<400> 1
TGGACATATCTATGATGCCTCACG 24
<210> 2
<211> 25
<212> DNA
<213> artificial sequence
<220>
The description of <223> artificial sequence: the sequence of synthetic
<400> 2
AGTTCACCAATCCTAAAGTCCTCCA
25
<210> 3
<211> 21
<212> DNA
<213> artificial sequence
<220>
The description of <223> artificial sequence: the sequence of synthetic
<400> 3
AGGTCCTCTTCCAGCCATCCA
21
<210> 4
<211> 24
<212> DNA
<213> artificial sequence
<220>
The description of <223> artificial sequence: the sequence of synthetic
<400> 4
CCACTGAGCACAATGTTACCGTAG
24
Claims (8)
1. a land for growing field crops potato plant nitrogen nutrition molecular diagnosis method, is characterized in that, with the expression amount of the relevant nitrate reductase gene NR of potato plant Nitrogen Absorption, determines diagnosis land for growing field crops potato plant nitrogen nutritional status.
2. potato plant nitrogen nutrition molecular diagnosis method in land for growing field crops according to claim 1, it is characterized in that, the actin gene Actin gene of take is internal reference, adopt the relative expression quantity of Real time PCR method detection nitrate reductase gene NR, to judge land for growing field crops potato plant nitrogen nutritional status.
3. the molecular diagnosis method of land for growing field crops according to claim 1 potato plant nitrogen nutrition, is characterized in that, the sequence for the primer of the NR gene that increases in Real time PCR is: forward primer is as shown in SEQ ID NO.1; Reverse primer is as shown in SEQ ID NO.2.
4. the molecular diagnosis method of land for growing field crops according to claim 1 potato plant nitrogen nutrition, is characterized in that, is: forward primer is as shown in SEQ ID NO.3 as the amplimer of the Actin gene of reference gene; Reverse primer is as shown in SEQ ID NO.4.
5. according to the molecular diagnosis method of the land for growing field crops potato plant nitrogen nutrition described in claim 1 to 4 any one, it is characterized in that comprising the steps:
1) acquisition of potato plant blade RNA: field is got potato plant top first and launched leaf completely, the 4th leaf normally, laboratory is processed and taken back to liquid nitrogen, takes trizol method to extract RNA;
2) take the RNA that step 1) obtains is template, by reverse transcription, obtains cDNA;
3) take step 2) cDNA that obtains is template, carries out Real time pcr amplification;
4) by analyzing, calculate the relative expression quantity of NR gene, according to fitting formula, calculate amount of nitrogen.
6. the application in the potato plant applied nitrogen of land for growing field crops according to molecular diagnosis method described in claim 1 to 5 any one, is characterized in that,
The first step, obtains the relative expression quantity of nitrate reductase gene NR according to the molecular diagnosis method of the land for growing field crops potato plant nitrogen nutrition described in claim 1 to 5 any one,
Second step, determines land for growing field crops potato plant nitrogen nutritional status according to the resulting expression amount of the first step, and determines whether applied nitrogen or its rate of fertilizer application,
The 3rd step, uses definite nitrogenous fertilizer to described land for growing field crops potato plant.
7. the fertilizing method of land for growing field crops according to claim 5 potato plant nitrogenous fertilizer, is characterized in that,
Second step determines that amount of nitrogen N calculates by formula: N=-6.7891* Δ Ct
2-37.622* Δ Ct-43.033
Wherein, amount of nitrogen N unit is pure N kg/667m
2, and when N is greater than zero, need Nitrogen Top Dressing, when N is less than zero, without Nitrogen Top Dressing; Δ Ct=Ct
nR-Ct
actin, Ct
nRand Ct
actinrepresent that respectively nitrate reductase gene NR and the reference gene actin gene Actin fluorescent signal in each reaction tubes in Real time pcr amplification process reaches the cycle number that the threshold value of setting experiences.
8. the fertilizing method of land for growing field crops according to claim 7 potato plant nitrogenous fertilizer, is characterized in that, uses definite nitrogenous fertilizer and calculates by following fitting formula: N=-6.7891* Δ Ct
2-37.622* Δ Ct-43.033, wherein the unit of amount of nitrogen N is purity nitrogen kg/667m
2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410094874.8A CN103923978B (en) | 2014-03-14 | 2014-03-14 | A kind of land for growing field crops potato plant nitrogen nutrition molecular diagnosis method and the application in fertilising |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410094874.8A CN103923978B (en) | 2014-03-14 | 2014-03-14 | A kind of land for growing field crops potato plant nitrogen nutrition molecular diagnosis method and the application in fertilising |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103923978A true CN103923978A (en) | 2014-07-16 |
| CN103923978B CN103923978B (en) | 2016-04-13 |
Family
ID=51142373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410094874.8A Active CN103923978B (en) | 2014-03-14 | 2014-03-14 | A kind of land for growing field crops potato plant nitrogen nutrition molecular diagnosis method and the application in fertilising |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103923978B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110455990A (en) * | 2019-07-12 | 2019-11-15 | 内蒙古农业大学 | A kind of potato potassium nutrition quick diagnosis device and method using the progress of portable potassium ion meter |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1760366A (en) * | 2004-10-15 | 2006-04-19 | 东北农业大学 | Method for diagnosing nitrogen nutrition of sugar beet, and forecasting output of sugar through activity of nitrate reductase |
-
2014
- 2014-03-14 CN CN201410094874.8A patent/CN103923978B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1760366A (en) * | 2004-10-15 | 2006-04-19 | 东北农业大学 | Method for diagnosing nitrogen nutrition of sugar beet, and forecasting output of sugar through activity of nitrate reductase |
Non-Patent Citations (3)
| Title |
|---|
| HEMAL DHAMMIKE: "Changes in Nitrate Reductase Activity of Leaf and Nitrogen Distribution with Growth in Potato Plants", 《JPN. J. CROP. SCI.》, vol. 66, no. 4, 31 December 1997 (1997-12-31), pages 673 * |
| JAVAD SHARIFI RAD: "Regulation of the Expression of Nitrate Reductase genes in Leaves of Medical plant, Foeniculum vulgare by Different Nitrate Sources", 《INTERNATIONAL JOURNAL OF AGRICULTURE AND CROP SCIENCES》, vol. 5, no. 24, 31 December 2013 (2013-12-31), pages 2911 - 2916 * |
| 陈煜: "不同氮源对大豆硝酸还原酶活性及基因表达的影响", 《西北农林科技大学植物学》, 31 December 2004 (2004-12-31) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110455990A (en) * | 2019-07-12 | 2019-11-15 | 内蒙古农业大学 | A kind of potato potassium nutrition quick diagnosis device and method using the progress of portable potassium ion meter |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103923978B (en) | 2016-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kadiyala et al. | Identifying irrigation and nitrogen best management practices for aerobic rice–maize cropping system for semi-arid tropics using CERES-rice and maize models | |
| Meena et al. | Irrigation management strategies in wheat for efficient water use in the regions of depleting water resources | |
| Liu et al. | Effect of regulated deficit irrigation on alfalfa performance under two irrigation systems in the inland arid area of midwestern China | |
| Li et al. | Evaluation and application of ORYZA2000 for irrigation scheduling of puddled transplanted rice in north west India | |
| Li et al. | Effects of irrigation and fertilization on grain yield, water and nitrogen dynamics and their use efficiency of spring wheat farmland in an arid agricultural watershed of Northwest China | |
| CN104584751A (en) | Fertilizing method based on nitrogen nutrition nondestructive detection of winter rapes | |
| Ohyama et al. | Amino acid metabolism and transport in soybean plants | |
| Shen et al. | Soil water, soil nitrogen and productivity of lucerne–wheat sequences on deep silt loams in a summer dominant rainfall environment | |
| CN102283062A (en) | Method for double-cropping rice nitrogen regulation, fertilizer reduction and efficiency improvement | |
| CN102986355A (en) | Precise nitrogen application method aiming at flue-cured tobacco | |
| CN103868891A (en) | Method for rapidly diagnosing nitrogen nutrition in oilseed rape leaves and recommending application of nitrogen | |
| CN104488432A (en) | High-yield drop irrigation maize soil nutrient diagnosis and nitrogen fertilizer recommendation method | |
| CN105453787A (en) | Fertilization method of organic fertilizer in farmland and application thereof | |
| Villar et al. | Laboratory methods for the estimation of soil apparent N mineralization and wheat N uptake in calcareous soils | |
| CN108450108B (en) | Method for determining semi-quantitative irrigation amount of biogas slurry of double-cropping cane shoots and irrigation method | |
| CN102577852A (en) | Method for identifying salt tolerance of cotton | |
| CN106591471A (en) | Method for analyzing hypoxia stress on shrimps by detecting HURP1 gene expression | |
| CN103210727A (en) | Method for forecasting application amount of rice nitrogen fertilizer | |
| CN107155665B (en) | Method for making crop irrigation strategy based on leaf area growth model | |
| CN103923978B (en) | A kind of land for growing field crops potato plant nitrogen nutrition molecular diagnosis method and the application in fertilising | |
| CN112314379A (en) | Sugarcane barrel-cultivation drought stress test method | |
| CN103468791A (en) | Molecular marker assisted method used for variety selection of cowpea variety with grain-filling resistance, and PCR primer set used in molecular marker assisted method | |
| CN110317899A (en) | A method of drought resistance of maize is identified based on polygalacturonase gene expression | |
| CN105210750A (en) | A kind of method based on chlorophyll fluorescence power screening eurytopicity paddy rice | |
| Karki | Yield prediction and nitrogen recommendation in maize using Normalized difference vegetation index. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |