CN106591471A - Method for analyzing hypoxia stress on shrimps by detecting HURP1 gene expression - Google Patents
Method for analyzing hypoxia stress on shrimps by detecting HURP1 gene expression Download PDFInfo
- Publication number
- CN106591471A CN106591471A CN201710025302.8A CN201710025302A CN106591471A CN 106591471 A CN106591471 A CN 106591471A CN 201710025302 A CN201710025302 A CN 201710025302A CN 106591471 A CN106591471 A CN 106591471A
- Authority
- CN
- China
- Prior art keywords
- hurp1
- litopenaeus vannamei
- temperature change
- rate temperature
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for analyzing hypoxia stress on shrimps by detecting HURP1 gene expression. The method comprises the steps as follows: step one, acquiring the sequence of an open reading frame of an HURP1 gene of litopenaeus vannamei, and designing and synthesizing a sequence-specific fluorescent quantitative PCR (polymerase chain reaction) primer; step two, acquiring to-be-detected blood lymphocytes of litopenaeus vannamei, extracting the total RNA (ribose nucleic acid) of the blood lymphocytes, reversely transcribing the total RNA into cDNA, and preparing a fluorescent quantitative PCR template; step three, performing fluorescent quantitative PCR analysis to analyze expression of HURP1 in the blood lymphocytes of litopenaeus vannamei. With the adoption of the method, whether litopenaeus vannamei is in a low-oxygen stress state is judged more conveniently, more quickly and more accurately by detecting expression of the HURP1 gene.
Description
Technical field
The invention belongs to biology field, and in particular to a kind of expression by detecting HURP1 genes is all to analyze
Whether the shore prawn that receives is in the method for Hypoxia Stress state.
Background technology
Prawn (Litopenaeus vannamei) in oceanic invertebrate Penaeus is the weight of China's aquaculture
Want species.2015, global cultured prawn yield up to 3,300,000 tons, wherein, China cultured prawn yield is 1,500,000 tons, is the world
The big country of prawn culturing first.China mainly cultivates Litopenaeus vannamei (Litopenaeus vannamei), Penaeus monodon
(Penaeus monodon), Fenneropenaeus chinensis Osbeck (Fenneropenaeus chinensis) and Marsupenaeus japonicus
(Marsupenaeus japonicus) 4 kinds of prawns, wherein Litopenaeus vannamei is primary cultivated species, accounts for cultured prawn and always produces
Amount 90%.
In prawn culturing water body, oxygen is accounted for by various biological or abiotic factor consumption, the oxygen of various factors consumption
The rate variable of total oxygen consumption is very big.Research finds that Fenneropenaeus chinensis Osbeck, water body and deposit oxygen consumption account for respectively total oxygen consumption in shrimp ponds
3.74%, 17.35% and 78.91%, and in the cultivation of batch production Litopenaeus vannamei, prawn and water body oxygen consumption are accounted for respectively
72.67% and 27.33%.Also scholar is also considered as the very little part that prawn oxygen consumption in shrimp ponds only accounts for total oxygen consumption, and heterotrophism is thin
The oxygen of bacterium, plankton and deposit consumption accounts for the overwhelming majority of total oxygen consumption.S ＆ W body in Madenjian estimation shrimp ponds
Oxygen consumption account for the 51% and 45% of total oxygen consumption respectively, be the principal element of pond oxygen consumption.Separately also there is scholar to estimate, after cultivation
The oxygen of phase prawn, water body and deposit consumption accounts for respectively 34%, 35% and the 30% of the total oxygen consumption in pond.Therefore, support in prawn
Grow in pond dissolved oxygen and non-principal is cultivated object consumption, but by the microorganism in breeding environment, plankton and chemistry
Material is consumed.Only in highdensity cultivating system, aquaculture organism can just become the main consumer of dissolved oxygen.Breeding water body
Anoxia mainly break out relevant with water body caused by self-pollution and Oxygen Consumption By Sediments increase with plankton.Due to biological and physics and chemistry
The comprehensive function of factor, also often there is the phenomenon for dissolving hypoxgia to shrimp ponds in Jing.Dissolved oxygen deficiency easily causes low to Litopenaeus vannamei
Oxdative stress, so as to have harmful effect to the speed of growth of Litopenaeus vannamei, immunologic function, often causes to damage to shrimp culture industry
Lose.Due to prawn absorb, using dissolved oxygen in water be subject to other various physical and chemical factors, such as the impact of temperature or ammonia nitrogen concentration, because
This dissolved oxygen in water does not have direct dependency with the dissolved oxygen amount in Litopenaeus vannamei body, therefore is difficult to directly from the molten of breeding water body
Oxygen amount determines whether Litopenaeus vannamei body occurs Hypoxia Stress.And still lack at present it is simple, fast and accurately judge vannamei boone
Whether prawn is in the method for Hypoxia Stress state.
The content of the invention
The purpose of the present invention is the technical problem to be solved for more than, there is provided a kind of simply, fast, accurately to analyze all
Whether the shore prawn that receives is by the method for Hypoxia Stress.
To realize object above, the invention provides following technical scheme：
Whether one kind receives anoxia by detection HURP1 (hypoxia up-regulated expression albumen 1) gene expression analysis Litopenaeus vannamei
The method of stress, its step is as follows：
Step one. obtain Litopenaeus vannamei HURP1 gene open reading frame sequence, and design, composition sequence specificity
Fluorescence quantification PCR primer；
Step 2. the Litopenaeus vannamei blood lymphocyte for intending being detected is obtained, its total serum IgE is extracted and reverse transcription is
CDNA, prepares quantitative fluorescent PCR template；
Step 3. carry out quantitative fluorescent PCR analysis, to analyze Litopenaeus vannamei blood lymphocyte in HURP1 expression feelings
Condition.
Due to Litopenaeus vannamei HURP1 gene expression dose it is related to Hypoxia Stress, by detect HURP1 expression water
It is flat, can sensitively reflect the Hypoxia Stress situation of prawn.The expression of HURP1 is higher, then show there is Hypoxia Stress shape
Condition.
As one kind preferred embodiment, the nucleotide sequence of the fluorescence quantification PCR primer in the step one
It is as follows：
QPCR-LvHURP1-F：GCCTCTTCAACCATAGCGACC；
QPCR-LvHURP1-R：ATTTCCAGCCCGCCTAATGTA.
As one kind preferred embodiment, the concrete operations of the step 2 are：Increase water body dissolved oxygen to 5mg/L with
On, the hemolymph of the Litopenaeus vannamei for intending detection is extracted, its blood lymphocyte is obtained in 10 minutes by 800rpm centrifugations；Extract blood
Lymphocyte total serum IgE, and be the cDNA of real time fluorescent quantitative by its reverse transcription, prepare quantitative fluorescent PCR template.
It is highly preferred that the reaction system of reverse transcription reaction is as follows：Buffer 2 4.0 μ l, RT
Primer Mix1.0 μ l, PrimeThe μ l of RT Enzyme Mix I 1.0, remove genomic DNA reactant liquor 10 μ l, RNase
Free dH2O4.0 μ l, cumulative volume is 20 μ l.
Preferably, it is described to remove genomic DNA reactant liquor by the μ l of 5 × gDNA Eraser Buffer 2.0, gDNA Eraser
1.0 μ l, the μ g and RNase Free dH of STb gene 1.02O supplies composition.
As one kind preferred embodiment, the PCR reactant liquors of the step 3 are consisted of：Premix Ex
TaqTM5.0 μ l, 10 μM of the μ l of forward primer 0.2,10 μM of the μ l of reverse primer 0.2, cDNA templates 1.0 μ l, aseptic dH2O 3.6
μ l, cumulative volume is 10 μ l.
As one kind preferred embodiment, the step 3 enters performing PCR amplification according to following program：Program 1：95℃、
10 seconds, rate temperature change be 4.8 DEG C/s, period be 1；Program 2：95 DEG C, 5 seconds, rate temperature change be 4.8 DEG C/s, 57
DEG C, 20 seconds, rate temperature change be 2.5 DEG C/s, 78 DEG C, 1 second, rate temperature change be 4.8 DEG C/s, period is 40；Program
3：95 DEG C, 1 second, rate temperature change be 4.8 DEG C/s, 65 DEG C, 15 seconds, rate temperature change be 2.5 DEG C/s, 95 DEG C, 0 second, temperature
Degree rate of change is 0.11 DEG C/s, and period is 1.
Test result indicate that, compared to prior art, particularly traditional method measured based on lactic acid content, the present invention
Method can pass through the expression of detection HURP1 genes, it is easier, faster, more accurately whether judge Litopenaeus vannamei
In Hypoxia Stress state.
Description of the drawings
Fig. 1 is by HURP1 gene expression water in fluorescence quantitative PCR detection experimental group and matched group shrimp haemolymph cell
Flat result.
Fig. 2 is lactate level testing result in experimental group and matched group prawn blood plasma.
Specific embodiment
Below in conjunction with the drawings and specific embodiments, further detailed is made to the specific embodiment and technical scheme of the present invention
State, it should be appreciated that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.It is such as unspecified, this
The used reagent of invention and sample can be obtained by commercial channel.
Embodiment
First, the acquisition of laboratory sample
The Litopenaeus vannamei (about 7g/ heads) 400 of neat specification is selected, experimental group and matched group is bisected at random, per group
Prawn 200.Matched group fully beats oxygen, is every two hours detected once using dissolved oxygen meter, it is ensured that water body dissolved oxygen is in more than 5mg/L；
Experimental group combines the method for beating oxygen using water body inflated with nitrogen, and control water body dissolved oxygen is in 1.2mg/L (it is generally acknowledged that water body dissolved oxygen
1.2mg/L be Litopenaeus vannamei receptible dissolved oxygen lower limit), every two hours using dissolved oxygen meter detect once.Work as experimental group
Water body dissolved oxygen is reduced to 1.2mg/L and starts timing, and all receiving is taken within 3,6,9,12,18,24,36,48 and 72 hours what experiment started
Shore shrimp haemolymph sample (is mixed into a sample per the hemolymph of 5 shrimps to eliminate the individual variation between prawn as far as possible；Each
Time point gathers 3 samples).Matched group is in the corresponding point in time sampling of experimental group.Containing fixed amount anticoagulant (NaCl
350mM, KCl 10mM, EDTA-2Na 10mM, HEPES 10mM, pH7.3) hemolymph 800rpm centrifugation 10min, precipitate
RNAlater is added, soft resuspended, -80 DEG C standby；Supernatant is put in liquid nitrogen and freezes, and -35 DEG C is placed in afterwards and treats hemolymph breast
Acid content is analyzed.
2nd, Litopenaeus vannamei blood lymphocyte Total RNAs extraction
1) tissues of Litopenaeus vannamei that will be extracted in advance takes out from -80 DEG C of refrigerators, is placed in during room temperature is melted and prepares
Good enough mortars, the pipes of 1.5ml, 2ml EP without RNase, and respective markers are carried out in lid；
2) when in advance mortar being cooled to into liquid nitrogen with liquid nitrogen no longer volatilize rapidly, blood lymphocyte is taken out about from RNAlater
30mg is added into mortar, the grind into powder under conditions of liquid nitrogen abundance；
3) treat that liquid nitrogen has just been evaporated completely in the full-time mortar being fully ground to tissue and add 600 μ l Buffer RLT (wherein
Beta -mercaptoethanol is added in 1% ratio and mixing is used), uniform fold is rapidly added liquid nitrogen, continues grind into powder
RLT can be directly added into when shape, hemocyte or other cell extraction, step be carried out and is 4. operated；
4) after mortar temperature rises to powder dissolving, rapidly sample liquid is transferred to into the right of pre-cooling with 1ml syringes
During the 2ml of labelling is answered without RNase EP pipes, and sample liquid 10 times or so is carefully lashed, avoid bubble to produce as far as possible；
5) sufficient sample liquid will be lashed and will insert centrifuge, 20～25 DEG C, 13000rpm will be centrifuged 3min；
6) by the supernatant after centrifugation it is careful be transferred to the 2ml of correspondence markings without RNase EP pipes, be careful not to inhale
To precipitation, isopyknic 70% ethanol (being configured with dehydrated alcohol with the DEPC water that sterilizes in advance, room temperature preservation) is added, mixed.
7) take the above-mentioned mixed liquors of 700 μ l to be added in RNeasy spin column, 20～25 DEG C, 8000g centrifugation 15s,
Abandon filtrate, repetitive operation this step, until all of mixed liquor all crosses post；
8) 350 μ l Buffer RW1 are added in RNeasy spin column, 20～25 DEG C, 8000g centrifugation 15s are abandoned
Filtrate；
9) by 1：7 ratio (volume ratio) adds DNase solution into Buffer RDD, careful by 80 μ l mixed enzyme
Liquid is added to the film centre on RNeasy spin column, is stored at room temperature 15～20min；
10) 350 μ l Buffer RW1 are added again in RNeasy spin column, 20～25 DEG C, 8000g is centrifuged
15s, abandons filtrate；
11) 500 μ l Buffer RPE are added in RNeasy spin column, 20～25 DEG C, 8000g is centrifuged 15s,
Abandon filtrate；Repeat this step once；
12) RNeasy spin column are put into into a new 2ml collecting pipe, 20～25 DEG C, 12000rpm from
Heart 1min；
13) RNeasy spin column are transferred to the new 1.5ml of correspondence markings of test kit offer without RNase
In EP pipes, the RNase-free H of 30 μ l test kits offer are carefully added to film central authorities20, standing 2min, 20～25 DEG C,
12000rpm be centrifuged 1min, collect RNA extracting solution, be placed in -80 DEG C it is standby；
14) RNA Quality Identification：OD values are surveyed, acquisition puies forward the concentration of RNA；Agarose gel electrophoresiies detect RNA band feelings
Condition.
3rd, prepared by quantitative fluorescent PCR template
Using Reverse Transcriptase kit (TaKaRa quantitative analyses templated synthesis test kits)：RT reagent
The total serum IgE reverse transcription of carried Litopenaeus vannamei is glimmering in real time by Kit With gDNA Eraser (Perfect Real Time)
The quantitative cDNA templates of light, its concrete operation step is as follows：
(1) genomic DNA is removed
Following reaction system (operating on ice) is configured in the EP pipes without RNase of 0.2ml：
Soft to mix and of short duration centrifugation, 42 DEG C stand 2min or are stored at room temperature 5～30min, continue with reaction or
It is momentarily placed in 4 DEG C；
(2) reverse transcription reaction：
Configure following reaction system (operating on ice)：
It is soft to mix and of short duration centrifugation, it is placed in PCR instrument and is reacted as follows：37 DEG C of incubation 15min, 85 DEG C of heating 5s.
CDNA templates obtained by reverse transcription can for a long time be saved backup for three months or -80 DEG C in -20 DEG C of preservations.
4th, in each time point sample of experimental group and matched group LvHUPR1 relative expression quantity quantitative analyses
Test kit：Premix Ex TaqTM(Perfect Real Time)；
Analysis software：The softwares of Roche LightCycler 480.
5,25,125,625,3125 times of gradient dilution is carried out using cDNA templates as mother solution, dilution 5 gradients of gained
CDNA diluents are used as preliminary experiment template.
Select Litopenaeus vannamei housekeeping gene EF-1 α (LvEF1 α, GenBank accession No.GU136229) conduct
Internal reference, obtains the open reading frame sequence of Litopenaeus vannamei HURP1 gene, using Primer Premier by RACE-PCR
5.0 software design LvEF-1 α and LvHURP1 gene quantification primers, concrete primer information is as follows：
Primers of LvHURP1for Real-Time PCR
According to following reaction system configuration PCR reactant liquors (operating on ice)：
After reaction system is equipped with completely, mixes and add after centrifugation in 384 holes of correspondence, sealer, 4 DEG C, horizontal rotor 4000g from
Heart 3min, by following program performing PCR amplification is entered：
Analysis experimental data, makes standard curve and determines the amplification efficiency of genes of interest, selects optimum extension rate
Template, is formally tested according to preliminary experiment reaction system and program.3, each sample is parallel.
Fig. 1 shows LvHURP1 gene expressions in fluorescence quantitative PCR detection experimental group and matched group shrimp haemolymph cell
Level.Wherein, EF1- α are internal reference.Shrimp haemolymph cell and hemocyanin (the oxygen carrying albumen of prawn) close contact, Neng Goumin
The Hypoxia Stress situation of sense ground reflection prawn.Therefore the present invention uses HURP1 bases in detection Litopenaeus vannamei blood lymphocyte
Because of expression.As shown in figure 1, LvHURP1 genes are little from beginning 6 is tested in experimental group (i.e. Hypoxia Stress group) blood lymphocyte
Shi Qiqi expressions are significantly higher than matched group.Significance analysis adopt Student ' s t- inspections, and (* * are represented and matched group ratio
Compared with p<0.01), the stub on pillar represents meansigma methodss ± S.D (n=3).
Lactic acid in two groups of (matched group and experimental group) prawn blood plasma is measured using lactic acid dehydrogenase activity detection kit to contain
Amount, verifies the effectiveness of method therefor of the present invention.
Fig. 2 shows the lactate level in experimental group and matched group prawn blood plasma, for verifying Litopenaeus vannamei HURP1 base
Because of expression and the dependency of Hypoxia Stress.Lactic acid is the product of anaerobic glycolysises, is generally used for judging that individual anaerobic is exhaled
Water suction is flat, is a kind of method whether traditional analysis body occurs anoxia, but operating process is relatively complicated and needs special
Lactic acid dehydrogenase activity detection kit.As shown in Fig. 2 lactic acid content is from experiment 12 in experimental group (i.e. Hypoxia Stress group) blood plasma
Hour plays its content and is significantly higher than matched group.Significance analysis adopt Student ' s t- inspections, and (* * to be represented and compare p with matched group
<0.01), the stub on pillar represents meansigma methodss ± S.D (n=3).
As can be seen here, compared with existing analysis method, the method for the present invention is simpler, quick, accurate, sensitive.
Sequence table
<110>Zhongshan University
<120>By detecting the method whether HURP1 gene expression analysis prawn coerced by anoxia
<160> 2
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<221>misc_feature
<400> 1
gcctcttcaa ccatagcgac c 21
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<221>misc_feature
<400> 2
atttccagcc cgcctaatgt a 21
Claims (7)
1. a kind of by detecting HURP1 gene expression analysis prawns whether by the method for anoxia stress, it is characterised in that include as
Lower step：
Step one. obtain Litopenaeus vannamei HURP1 gene open reading frame sequence, and design, composition sequence specificity it is glimmering
Fluorescent Quantitative PCR primer；
Step 2. the Litopenaeus vannamei blood lymphocyte for intending being detected is obtained, its total serum IgE is extracted and reverse transcription is cDNA, made
Standby quantitative fluorescent PCR template；
Step 3. carry out quantitative fluorescent PCR analysis, to analyze Litopenaeus vannamei blood lymphocyte in HURP1 expression.
2. method according to claim 1, it is characterised in that the fluorescence quantification PCR primer in the step one
Nucleotide sequence is as follows：
QPCR-LvHURP1-F：GCCTCTTCAACCATAGCGACC；
QPCR-LvHURP1-R：ATTTCCAGCCCGCCTAATGTA.
3. method according to claim 1, it is characterised in that the concrete operations of the step 2 are：Increase water body dissolved oxygen
To more than 5mg/L, the hemolymph of the Litopenaeus vannamei for intending detection is extracted, its hemolymph is obtained in 10 minutes by 800rpm centrifugations thin
Born of the same parents；Blood lymphocyte total serum IgE is extracted, and is the cDNA of real time fluorescent quantitative by its reverse transcription, prepare quantitative fluorescent PCR template.
4. method according to claim 3, it is characterised in that the reaction system of reverse transcription reaction is as follows：5×The μ l of Buffer 2 4.0, RT Primer Mix 1.0 μ l,RT Enzyme Mix I 1.0
μ l, remove the μ l of genomic DNA reactant liquor 10, RNase Free dH2The μ l of O 4.0, cumulative volume is 20 μ l.
5. method according to claim 4, it is characterised in that described to remove genomic DNA reactant liquor by 5 × gDNA
The μ l of Eraser Buffer 2.0, the μ l of gDNA Eraser 1.0, the μ g and RNase Free dH of STb gene 1.02O supplies composition.
6. method according to claim 1, it is characterised in that the PCR reactant liquors of the step 3 are consisted of：
The μ l of Premix Ex TaqTM 5.0,10 μM of the μ l of forward primer 0.2,10 μM of the μ l of reverse primer 0.2, the μ l of cDNA templates 1.0,
Aseptic dH2The μ l of O 3.6, cumulative volume is 10 μ l.
7. method according to claim 1, it is characterised in that the step 3 enters performing PCR amplification according to following program：Journey
Sequence 1：95 DEG C, 10 seconds, rate temperature change be 4.8 DEG C/s, period be 1；Program 2：95 DEG C, 5 seconds, rate temperature change be
4.8 DEG C/s, 57 DEG C, 20 seconds, rate temperature change be 2.5 DEG C/s, 78 DEG C, 1 second, rate temperature change be 4.8 DEG C/s, period
For 40；Program 3：95 DEG C, 1 second, rate temperature change be 4.8 DEG C/s, 65 DEG C, 15 seconds, rate temperature change be 2.5 DEG C/s, 95
DEG C, 0 second, rate temperature change be 0.11 DEG C/s, period is 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710025302.8A CN106591471B (en) | 2017-01-13 | 2017-01-13 | Method for analyzing whether shrimps are subjected to anoxic stress by detecting HURP1 gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710025302.8A CN106591471B (en) | 2017-01-13 | 2017-01-13 | Method for analyzing whether shrimps are subjected to anoxic stress by detecting HURP1 gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106591471A true CN106591471A (en) | 2017-04-26 |
| CN106591471B CN106591471B (en) | 2020-05-05 |
Family
ID=58584760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710025302.8A Expired - Fee Related CN106591471B (en) | 2017-01-13 | 2017-01-13 | Method for analyzing whether shrimps are subjected to anoxic stress by detecting HURP1 gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591471B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858435A (en) * | 2017-12-25 | 2018-03-30 | 镇江市第人民医院 | Detect circular rna circRNA_101835 primer, kit and detection method and application |
| CN108277282A (en) * | 2018-03-07 | 2018-07-13 | 镇江市第人民医院 | Detect primer, kit and detection method and its application of circular rna hsa_circ_0006148 |
| CN112458079A (en) * | 2020-11-28 | 2021-03-09 | 华中农业大学 | Method for extracting procambarus clarkii hemolymph total RNA |
| CN116463429A (en) * | 2023-04-18 | 2023-07-21 | 仲恺农业工程学院 | Method for detecting source components of penaeus vannamei boone in fish meal by PCR |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200160A (en) * | 2015-11-12 | 2015-12-30 | 广东海洋大学 | SNP marker relevant to low dissolved oxygen tolerance of Litopenaeus vannamei as well as screening method and application of SNP marker |
-
2017
- 2017-01-13 CN CN201710025302.8A patent/CN106591471B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200160A (en) * | 2015-11-12 | 2015-12-30 | 广东海洋大学 | SNP marker relevant to low dissolved oxygen tolerance of Litopenaeus vannamei as well as screening method and application of SNP marker |
Non-Patent Citations (3)
| Title |
|---|
| J. ZHANG等: "Effect of dietary astaxanthin on growth, antioxidant capacity and gene expression in Pacific white shrimp Litopenaeus vannamei", 《AQUACULTURE NUTRITION》 * |
| YI-HONG CHEN等: "Transcriptome analysis of the unfolded protein response in hemocytes of Litopenaeus vannamei", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| 蒋昊: "中国明对虾在胁迫条件下肝胰脏的差异蛋白质组学研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858435A (en) * | 2017-12-25 | 2018-03-30 | 镇江市第人民医院 | Detect circular rna circRNA_101835 primer, kit and detection method and application |
| CN108277282A (en) * | 2018-03-07 | 2018-07-13 | 镇江市第人民医院 | Detect primer, kit and detection method and its application of circular rna hsa_circ_0006148 |
| CN112458079A (en) * | 2020-11-28 | 2021-03-09 | 华中农业大学 | Method for extracting procambarus clarkii hemolymph total RNA |
| CN116463429A (en) * | 2023-04-18 | 2023-07-21 | 仲恺农业工程学院 | Method for detecting source components of penaeus vannamei boone in fish meal by PCR |
| CN116463429B (en) * | 2023-04-18 | 2023-09-08 | 仲恺农业工程学院 | Method for detecting source components of penaeus vannamei boone in fish meal by PCR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106591471B (en) | 2020-05-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106591471A (en) | Method for analyzing hypoxia stress on shrimps by detecting HURP1 gene expression | |
| CN112176074A (en) | Real-time fluorescent PCR primer probe and method for detecting patinopecten yessoensis | |
| CN106591477A (en) | Method of using multiple reference gene combinations to study yak embryo gene | |
| CN107400720A (en) | A kind of method and its dedicated kit of KLF3 gene Cs NV marks auxiliary detection ox growth traits | |
| CN113502333A (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| CN105176989B (en) | It is a kind of to differentiate fugu obscurus and the primer and method of Fugu Xanthopterus (Temminck et Schlegel) fry | |
| CN102344953B (en) | Primer for detecting peach-derived component in sample, method and kit | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN111321231B (en) | Method for molecular identification of rainbow trout gynogenesis offspring | |
| CN115679004B (en) | Primer, method and kit for identifying pseudobagrus vachelli, leiocassis longirostris and hybrid species | |
| CN102344951A (en) | Primer, method and kit for detecting pear-derived components in sample | |
| CN113502336B (en) | Siniperca chuatsi hypoxia-resistant character-related SNP molecular marker and application thereof | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN112725427B (en) | Primer, fluorescent probe and kit for identifying gender of sturgeon based on fluorescent PCR | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| CN106701953A (en) | Primer composition, kit and use method thereof for detection on expression level of key gene for circadian rhythm regulation and control on drosophila melanogaster | |
| CN102534039A (en) | Quick identification method and application of transgenic fish homozygote | |
| CN112695105A (en) | Real-time fluorescence PCR identification method of chlamys farreri | |
| CN112195254A (en) | Method for interfering MSTN cattle skeletal muscle satellite cell real-time fluorescence quantitative PCR (polymerase chain reaction) reference gene screening | |
| CN102168132A (en) | Technology for detecting tiny RNA155 (ribonucleic acid 155) relative content of T cells to reflect individual immunity state | |
| CN102134592B (en) | Technology for detecting micro RNA-150 relative content of T cells and reflecting individual immune state | |
| CN107723380A (en) | A kind of stem rot of sweet potato bacterium LAMP detection primer and its application | |
| CN109055494A (en) | A kind of the RFLP method and kit of the mutation of detection yak horn character cause and effect | |
| CN104232747B (en) | PCR identification method for paralichthys olivaceus and germ plasm of affinis alien species of paralichthys olivaceus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200505 Termination date: 20210113 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |