CN103820475B - The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application - Google Patents
The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application Download PDFInfo
- Publication number
- CN103820475B CN103820475B CN201310555823.6A CN201310555823A CN103820475B CN 103820475 B CN103820475 B CN 103820475B CN 201310555823 A CN201310555823 A CN 201310555823A CN 103820475 B CN103820475 B CN 103820475B
- Authority
- CN
- China
- Prior art keywords
- lmggps2
- fructus lycii
- synthase gene
- gene
- geranylpyrophosphate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the protein of a kind of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application, be specially Fructus Lycii (<i>lycium</i><i>chinense Miller</i>) in yak base geranylpyrophosphate synthase gene<i>lmGGPS</i><i>2</i>clone。By extracting the total serum IgE in fresh Fructus Lycii blade, clone the yak base geranylpyrophosphate synthase gene in Fructus Lycii<i>lmGGPS2</i>, obtaining the complete sequence of gene is 1246bp；Construct coli expression carrier pET28a-LmGGPS2, by escherichia coli heterologous expression system, obtain LmGGPS2 expressing protein；And construct binary plant expression vector pCAMBIA2300-LmGGPS2, carrier is proceeded to Agrobacterium C58 cell by electric shocking method, with this cell transformation Nicotiana tabacum L., obtain transgene tobacco, by testing, finding that transgene tobacco substantially increases the content of plant lycopene, the content of carotenoid also increases。
Description
Technical field
The present invention relates to the protein of a kind of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application, the clone being specially in Fructus Lycii (LyciumchinenseMiller) yak base geranylpyrophosphate synthase gene LmGGPS2。
Background technology
Yak base geranylpyrophosphate (GGPP) is the ubiquitous important mesostate of biosphere. in plant, GGPP participates in the synthesis of the products such as chlorophyll, carotenoid, gibberellins, plastoquinone, vitamin E, monoterpene and benzoquinone, and photosynthesis of plant, growth promoter and product quality etc. are had material impact。This product is directly catalyzed and synthesized by GGPS。GGPP is not only the precursor substances such as the most direct precursor substance of herxheimer-liked reaction, or plant inner gibberellin, chlorophyll and plastoquinone。The synthesis of GGPP is the speed limit process in carotenogenesis。By a series of enzymatic reaction, the lycopene of generation not only gives the color and luster that Fructus Lycopersici esculenti is bright-coloured, and has important healthy nutritive value。Medical research shows, in serum, the lycopene of high-load reduces the sickness rate of various cancer with can dramatically, the occurrence probability of the kinds cancers such as the lycopene content in blood and carcinoma of prostate, digestive tract cancer, breast carcinoma, pulmonary carcinoma, bladder cancer, skin carcinoma is negative correlation, and research shows the occurrence probability of the reduction carcinoma of prostate that high lycopene content can be significant in human body。The effect of lycopene protection cardiovascular and cerebrovascular vessel is mainly by its antioxidation; reduce the peroxidation of serum lipids and low density lipoprotein, LDL; thus reducing the sickness rate of arteriosclerosis and coronary heart disease, the incidence probability taking in reduction cardiovascular and cerebrovascular disease that can be significant of high lycopene。Lycopene also has the raising effect such as immunity, slow down aging。
Lycopene can quenching singlet oxygen, scavenging free radicals, it is prevented that protein and DNA are subject to the effects such as the destruction of oxygen。It is 10 times that commonly use antioxidant vitamin E at present that lycopene removes the ability of singlet oxygen, 2 times of beta-carotene。The quantity of the conjugated double bond that lycopene molecule contains in all carotenoid is maximum, and its singlet-oxygen quenching speed constant is 100 times of vitamin E, is the carotenoid that oxidation resistance is the strongest。The chemical constitution of lycopene determines it and has the very strong ability removing reactive oxygen species and free radicals, is a kind of effective antioxidant。And carotenoid, especially beta-carotene can suppress, remove interior free yl, it is possible to the diseases such as slow down aging and prophylaxis of tumours, thrombosis, atherosclerosis。Carotenoid can increase the vigor of B cell in immune system, eliminate the pathogen of external source invasion, can improve the vigor of lymph helper T cell, assists B cell to produce antibody, and improves the activity of other immune component；The number of natural killer cell can also be increased, to eliminate infected cell or cancerous cell in body。
In plant, under GGPS gene and other enzyme combined effect, generate diterpene, tetraterpene and polyterpene compound。GGPS is the key enzyme of synthesis diterpene, tetraterpene and polyterpene。Nicotiana tabacum L. terpenoid is closely related with tabacco fragrance, and they serve not only as important tobacco aroma precursor and are present in Nicotiana tabacum L., and have also discovered the most of terpenoid compound having in Nicotiana tabacum L. in flue gas。As diterpene be blade face body of gland colloid secretions mainly comprise composition, its main component is western cypress three enediol, and its catabolite solanone and derivant thereof are important fragrance matters；Tetraterpene compounds carotene is important in Nicotiana tabacum L. to cause perfumery precursor, and its catabolite such as damascenone, ionoionone, Megastigmatrienone etc. are important aroma components in Nicotiana tabacum L.。In China's leaf tobacco production, increase Nicotiana tabacum L. terpenoid content, particularly with the accumulation in Nicotiana tabacum L. of flavouring essence quality closely-related Aroma precursor material such as diterpene, carotenoid etc., tobacco incense tolerance can be increased, improve quality of tabacco fragrance。Therefore, research transgenic GGPS Nicotiana tabacum L. is significant。
The step of Carotenoid in Plants synthesis is as follows: 3-methyl-3, 5-dihydroxy-acid (MVA) synthesizes isopentenylpyrophosphate (IPP) under the catalytic action of enzyme, isopentenylpyrophosphate (IPP) first generates isomers dimethyl allene pyrophosphoric acid (DMAPP) with acrylic structure under the effect of isopentenylpyrophosphate isomerase (IPI), it is precursor substance required in isopentene route of synthesis, DMAPP and IPP sequentially generates yak base pyrophosphoric acid (GPS) through continuous print condensation, farnesyl pyrophosphate (FPP), yak base yak base pyrophosphoric acid (GGPP)。Bimolecular GGPP is become octahydro lycopene by octahydro lycopene synzyme (PSY) catalytic polymerization。Octahydro lycopene generates the former lycopene (prolycopene) of cis-structure through continuous print dehydrogenation reaction, and former lycopene isomery under the effect of carotene isomerase (CRTISO) becomes transconfiguration lycopene。Under the catalysis of lycopene corresponding cyclase subsequently, generate a, beta-carotene, and generate other type of pigment (Tanakaetal., 2008) further。
Along with the mankind's continuous discovery to lycopene and carotenoid medical value and medical care effect, to the kind of lycopene and carotenoid and the demand of yield also by increasing, but, lycopene carotenoid is difficult to chemically synthesize。The development of modern molecular biology research means, make the gene of a series of key enzymes in lycopene and Carotenoid biosynthetic pathway by isolation identification successively, for opening road by DNA recombinant technique and genetic engineering regulation and control production lycopene and carotenoid, obtain " golden Oryza sativa L. " and " polishes dish " especially by carotenoid genetic engineering, significantly enhance people and carry out the engineered confidence of Carotenoid in Plants。
Terpenoid is the compounds that in plant metabolites, quantity is maximum, isoprene be that construction unit forms。At the Repiration of plant, photosynthesis, and growth, growth, breeding, signal transduction and defence play an important role。Some terpenoid has important economic worth, and also some is used as natural perfume material and perfume compound or anti-tumor chemotherapeutic medicine。In plant, the biosynthesis of terpenoid occurs in Cytoplasm and plastid, its precursor substance is the isopentenyl pyrophosphate (Isopentenylpyrophosphate of C5 structure, and isomers dimethylallylpyrophosphate ester (Dimethylallylpyrophosphate, DMAPP) IPP)。Via the precursor that the IPP of mevalonic acid (Mevalonicacid, MVA) approach synthesis is synthesis farnesyl pyrophosphate (Farnesylpyrophosphate, FPP, C15), FPP finally synthesizes sesquiterpene, triterpene and sterol in Cytoplasm。In plastid, IPP and the DMAPP of methylerythritol phosphoric acid (methyl-erythritol-phosphate, MEP) approach synthesis is the precursor generating cattle base pyrophosphoric acid (Geranylpyrophosphate, GPP, C10)。GPP generates monoterpene under the effect of monoterpene synzyme；At cattle base geranylpyrophosphate synzyme (GeranylgeranylpyrophosphateSynthase, GGPPS) effect is lower generates cattle base geranylpyrophosphate (Geranylgeranylpyrophosphate, GGPP, C20), diterpene, tetraterpene and polyterpene compound are generated and then under the effect of enzyme。
Summary of the invention
It is an object of the invention to provide a kind of Fructus Lycii yak base geranylpyrophosphate synthase gene。
Second purpose of the present invention is to provide the protein of this gene code。
The present invention also aims to provide the recombinant vector containing this gene and host cell。
Further object is that the purposes that this gene is provided。
The invention provides a kind of Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2, the nucleotide sequence as shown in SEQ ID NO.1 is constituted。
The invention provides the protein of a kind of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 coding, the protein of the aminoacid sequence as shown in SEQ ID NO.2。
The invention provides a kind of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 recombinant cloning vector pMD18-T-LmGGPS2。
Containing the recombinant vector of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2, these recombinant vectors include plasmid。
Described plasmid expression vector coli expression carrier pET28a-LmGGPS2。
Containing the recombinant vector of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2, these recombinant vectors include plasmid。
Described plasmid expression vector coli expression carrier pET28a-LmGGPS2。
Described plasmid expression vector binary plant expression vector pCAMBIA2300-LmGGPS2。
Containing the complete host cell encoding reading frame sequence of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2, as the host cell containing above-mentioned recombinant vector falls within protection scope of the present invention。
Described host cell is selected from Bacillus coli cells, agrobatcerium cell or tobacco cell。
The invention provides a kind of engineering bacteria containing LmGGPS2 gene。
The application of above-mentioned Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 includes the application in plant of the albumen of this gene code；With described recombinant vector, such as plant expression vector maize transformation cell；Or by the described Agrobacterium containing this gene and corn and soybean, Helianthi, Rhizoma Solani tuber osi, Cotton Gossypii, millet, Fructus Hordei Vulgaris and the co-culture of cells such as flowers and vegetable, obtain the regeneration plant of transgenic；Or obtain above-mentioned species transfer-gen plant with described LmGGPS2 genetic transformation。
Technical scheme is specifically summarized as follows:
The cloning process of the present invention comprises the steps:
Total serum IgE is extracted from the fresh blade of Fructus Lycii, according to nucleotide sequence design forward primer LmGGPS2-F1:5 '-GTCATGTCTATGCTAATAGGTGT-3 ', the LmGGPS-R1:5 of Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 in transcript profile Unigene sequence '-GGTCA
GTTTCTGATGGAGAAATT-3 ', pcr amplification obtains this full length gene sequence 1246bp。
The present invention builds coli expression carrier pET28a-LmGGPS2 and plant expression vector pCAMBIA2300-LmGGPS2 containing yak base geranylpyrophosphate synthase gene LmGGPS2, is made up of following step:
1) the intermediate carrier pMD18-T-LmGGPS2 containing yak base geranylpyrophosphate synthase gene is built。
With LmGGPS-F1/LmGGPS-R1 for primer, with Fructus Lycii cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD18-T carrier, it is thus achieved that containing the intermediate carrier pMD18-T-LmGGPS2 of the LmGGPS2 gene shown in SEQ ID NO.1。
2) coli expression carrier pET28a-LmGGPS2 is built
With LmGGPS-F1/LmGGPS-R1 for primer, with Fructus Lycii cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD18-T carrier, and is transformed in competence escherichia coli TOP10, after bacterium colony PCR checking, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pET28a empty carrier BamHI and SalI double digestion, it is attached after purification respectively, obtains coli expression carrier pET28a-LmGGPS2。
3) plant expression vector pCAMBIA2300-LmGGPS2 is built
With LmGGPS-F1/LmGGPS-R1 for primer, with Fructus Lycii cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD18-T carrier, and is transformed in competence escherichia coli TOP10, after bacterium colony PCR checking, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pCAMBIA2300-35S-OCS empty carrier BamHI and SalI double digestion, it is attached after purification respectively, obtains plant expression vector pCAMBIA2300-LmGGPS2。
The invention provides the protein of a kind of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application。From Fructus Lycii, isolate the global cDNA of coding yak base geranylpyrophosphate synthase gene first, be connected on coli expression carrier, utilize the expressing protein of heterogenous expression system verification Fructus Lycii LmGGPS2 gene；It is then attached on plant expression vector, utilize Agrobacterium infestation method transformation of tobacco, obtaining transfer-gen plant, show that the carotenoid content of transfer-gen plant increases by studying, namely the present invention is widely applied in strengthening Carotenoid in Plants content etc.。
Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 of the present invention is expected for preparing transgenic corns, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Cotton Gossypii, millet, Fructus Hordei Vulgaris and flowers and vegetable plant strain。
Accompanying drawing explanation
Fig. 1. for LmGGPS2 total length pcr amplification electrophoretogram。
Fig. 2. for pMD18-T-LmGGPS2 carrier schematic diagram。
Fig. 3. for pET-28a-LmGGPS2 carrier schematic diagram。
Fig. 4. for pCAMBIA2300-LmGGPS2 carrier schematic diagram。
Fig. 5. for transgene tobacco Genomic PCR。
Fig. 6. for transgenic corns, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, millet, Semen Tritici aestivi, cotton gene group PCR。
Fig. 7. for transgenic Chinese rose, Lisianthus, An Zuhua, iris Genomic PCR。
Fig. 8. for transgenic poplar Genomic PCR。
Detailed description of the invention
Embodiment 1
The clone of yak base geranylpyrophosphate synthase gene LmGGPS2 in Fructus Lycii
Extracting total serum IgE from the fresh blade of Fructus Lycii, utilize 3 ' FULLRACECoreSetVer.2.0 (TaKaRa, Japan) test kit that RNA reverse transcription is synthesized cDNA, concrete steps are with reference to description, and reaction system is as follows:
| RNA | 2μL. |
| OligdT | 1μL |
| 5×M-MLV Buffer | 2μL |
| dNTP Mixture | 1μL |
| Rnase Inhibitor | 0.25μL |
| Reverse Transcriptase M- MLV | 0.25μL |
| Rnase Free ddH2O | 3.5μL |
Reaction condition: 42 DEG C, 60min；70 DEG C, 15min。
According to nucleotide sequence design forward primer the LmGGPS-F1:5 '-GTCATGTCTATGCTAATAGGTGT-3 ' of Fructus Lycii yak base geranylpyrophosphate synthase gene LmGGPS2 in transcript profile Unigene sequence, LmGGPS-R1:5 '-GGTCAGTTTCTGATGGAGAAATT-3 ', with the cDNA of synthesis for template, PCR reaction system is as follows:
| 1 st Strand cDNA | 1μL |
| LmGGPS2-F1 | 0.5μL |
| LmGGPS2-R1 | 0.5μL 4 --> |
| 2.5mM dNTP Mixture | 2μL |
| 10×LA Taq PCR buffer | 2.5μL |
| TaKaRa LA Taq archaeal dna polymerase | 0.25μL |
| ddH2O | 18.25μL |
| Total volume | 25μL |
Configuration 4 tube reaction liquid altogether, reaction condition is as follows: 94 DEG C, 4min；94 DEG C, 30Sec；56 DEG C, 30Sec；72 DEG C, lmin20Sec；72 DEG C, 10min；30 circulations。Utilizing Tian Gen company common DNA product purification kit that PCR product is purified after reaction, obtain the LmGGPSPCR fragment of purification, such as Fig. 1, test kit description operates。
Embodiment 2
The building process of cloning vehicle pMD18-T-LmGGPS2
Being connected with pMD19-T carrier by LmGGPS2 gene shown in sequence table, reaction system is as follows:
| LmGGPS2 total length reclaims product | 4μL |
| PMD18-T carrier | 1μL |
| SolutionI | 5μL |
LmGGPS2PCR fragment is the GGPS full length product of the recovery in embodiment 1。
Reaction condition: 16 DEG C, 30min。Connect product transformed competence colibacillus E-Coli.TOP10, be coated on X-Gal, 16ml50mg/ml containing 40ml25mg/ml IPTG, 100mg/LAmp LB Agar Plating on cultivate, form single bacterium colony。Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, such as Fig. 2, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, and we obtain this gene base sequence of 1074bp, carry out blast at NCBI, high with Solanaceae homology, it was shown that for this gene clone success。
Embodiment 3
The building process of coli expression carrier pET28a-LmGGPS2
The escherichia coli containing pMD19-T-LmGGPS2 plasmid obtained in amplification culture experimental example 2, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pET28a empty carrier BamHI and SalI double digestion, it is attached after purification respectively, obtain coli expression carrier pET28a-LmGGPS2, the digestion products of the two is connected。
Linked system is as follows:
| PET28a empty carrier fragment | 2μL |
| PMD19-T-LmGGPS2 endonuclease bamhi | 5μL |
| 5×T4 DNA ligase buffer | 2μL |
| T4 DNA ligase | 1μL |
Connect product transformed competence colibacillus e. coli bl21。Coat on the LB flat board containing 100mg/Lkana resistance, 37 DEG C of cultivations。After 12h, picking list bacterium colony carries out bacterium colony PCR checking, such as Fig. 3, by bacterium positive for bacterium colony PCR checking, shakes bacterium and extracts plasmid, and enzyme action is identified and obtained purpose band, finally send the order-checking of Hua Da gene sequencing company, and it is correct that result shows that carrier pET28a-LmGGPS2 builds。
Embodiment 4
The structure of binary plant expression vector pCAMBIA2300-LmGGPS2
The escherichia coli containing pMD19-T-LmGGPS2 plasmid obtained in amplification culture experimental example 2, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pCAMBIA2300 empty carrier plasmid also with BamHI and SalI double digestion, being connected by the digestion products of the two, linked system is as follows:
| PCAMBIA2300 empty carrier fragment | 2μL |
| PMD19-T-LmGGPS2 endonuclease bamhi | 5μL |
| 5×T4 DNA ligase buffer | 2μL |
| T4 DNA ligase | 1μL |
Connect product Transformed E-Coli.DH5 α, coat on the LB flat board containing 100mg/L concentration kana resistance。37 DEG C of cultivations, after 12h, picking list bacterium colony carries out bacterium colony PCR checking, by bacterium positive for bacterium colony PCR checking, shakes bacterium and extracts plasmid, and enzyme action is identified and obtained purpose band, such as Fig. 4。
Embodiment 5
Structure for the Agrobacterium engineering strain C58:pCAMBIA2300-LmGGPS2 of plant transgene。
Prepared by Agrobacterium competent cell
1. by mono-for Agrobacterium C58 colony inoculation in 5mLYEP fluid medium, 28 DEG C, 180r/min shaken cultivation。
2. proceeding in l00mLYEP fluid medium by above-mentioned bacterium solution, 28 DEG C, 180r/min, shaken cultivation is to (OD600Value is about 0.5)。
3., after ice bath 30min, 4 DEG C, 4000r/min is centrifuged l0min, collects thalline, is resuspended in the H of 20mL pre-cooling2In O。
4.4 DEG C, 4000r/min is centrifuged 10min, collects thalline, is resuspended in 10% glycerol of pre-cooling, often pipe 200 μ L quick-freezing, be stored in-80 DEG C standby。
Plant expression vector electroporated
1. the C58 competent cell that-80 DEG C are taken out is placed on ice so that it is slowly melt;
2. add 4 μ L plasmids, mixing, ice bath 5min;
3. it is transferred in electric shock cup;
4. electroporated instrument parameter is set: 1500V, 0.2s, electroporated;
5. room temperature adds 500 μ LYEB fluid mediums after standing 2min, 28 DEG C, 180r/min shaken cultivation 3h;
6. the centrifugal 10min of room temperature 4000r/min, sucking-off 400 μ L of supernatant liquid, mix remaining bacterium solution, coat on the YEB flat board containing 100mg/L kanamycin and 100mg/L rifampicin resistance, is inverted flat board, 28 DEG C of cultivations, 48h, until seeing single bacterium colony clearly。
7. picking list bacterium colony, bacterium colony PCR verifies。
Embodiment 6
Agriculture bacillus mediated Nicotiana tabacum L. genetic transformation
The aseptic culture of tobacco seedling: select full, healthy tobacco seed, with 75% soak with ethanol lmin, peace tiformin (effective chlorine 2.5%) the aqueous solution sterilizing 8min of 25%, rinsed with sterile water three times, being placed on by seed in MS culture medium, 25 DEG C of light are cultivated, the 16h/8h photoperiod。
The culture medium that this experiment is used is as shown in the table
The Agrobacterium-mediated Transformation of Nicotiana tabacum L.
Infect the preparation of bacterium solution
1. picking positive Agrobacterium list bacterium colony, is inoculated in the 5ml YEP fluid medium containing 100mg/L kanamycin, and the shaker overnight in 28 DEG C, 200r/min is cultivated。
2. next day, take 3ml bacterium solution, be inoculated in the 50mlYEP fluid medium containing 100mg/L kanamycin, when bacterium solution is in vigorous period (OD600=0.6-0.9) time, bacterium solution is poured into 50ml centrifuge tube, at 3500r/min, at 4 DEG C, centrifugal 10min, abandons supernatant, collects thalline。Resuspended with the MS fluid medium of equivalent, make OD600=0.9-1。
Outer implant is contaminated
1. tobacco leaf is removed master pulse and limb edge, then blade is cut into 0.5cm × 0.5cm size, immerse the Agrobacterium bacterium solution prepared, soaking 15-20min, shake 2-3 time, makes blade be fully contacted bacterium solution therebetween, take out blade, by the unnecessary bacterium solution of aseptic filter paper exhaustion, blade face down, blade back be inoculated in common training culture medium upward, about 25 DEG C light culture 2 days。
2. being transferred in screening culture medium by blade, within about 20 days, change a subculture, induction of resistance bud produces, and when resistant buds grows to about 1cm from callus, cuts resistant buds wound healing, is inoculated in resistance seedling rooting culture medium。
Transgenic seedling is transplanted
Root growth is good, vitality is vigorous Nicotiana tabacum L. tissue cultured seedling takes out from tissue culture bottle, with tap water culture medium (reducing root system damage) as far as possible, it is planted in frog stone and compost humous, cover film heat and moisture preserving 15 days, then thin film is opened, regularly water, apply fertilizer, so as in greenhouse normal growth。
Embodiment 7
The mensuration of transgene tobacco Molecular Detection and carotene carotene content
The PCR detection of transgene tobacco genomic DNA: 1.CTAB method extracts Nicotiana tabacum L. STb gene;2. detecting with genomic DNA for template performing PCR, primer is GGPS-F3 and GGPS-R-FULL, reaction condition:: 94 DEG C, 4min；94 DEG C, 30Sec；54 DEG C, 30Sec；72 DEG C, lmin10Sec；72 DEG C, 10min；30 circulations。Take above-mentioned PCR primer 5 μ l and carry out electrophoresis detection, such as Fig. 5, illustrate that LmGGPS2 gene successfully proceeds to Nicotiana tabacum L.。
Extract the carotenoid of transgene tobacco, measure transgene tobacco carotenoid content apparently higher than wild-type tobacco by HPLC, illustrate that this gene has important function at raising carotenoid content。
Embodiment 8
This laboratory passes through growing point infestation method to crop maturity embryo transgenic (LmGGPS2) such as corn and soybean, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, millet, Fructus Hordei Vulgaris, Semen Tritici aestivi, Cotton Gossypiis, it is successfully obtained transgenic corns, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, millet, Fructus Hordei Vulgaris, Semen Tritici aestivi, cotton plants, Genomic PCR electrophoretogram, such as Fig. 6, B: negative control, 1-8 respectively corn and soybean, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, millet, Fructus Hordei Vulgaris, Semen Tritici aestivi, Cotton Gossypii Genomic PCR。
At greenhouse normal growth, transgenic seedlings and wild type control Seedling, extracting lycopene and carotenoid respectively, HPLC measures transgenic group seedling lycopene and carotenoid content apparently higher than wild type group。Moreover, transgenic group growth of seedling is thick and strong, and wild type growth is relatively slow, and Biomass is relatively fewer。
Embodiment 9
This laboratory utilizes Agrobacterium infestation method that the flowers such as Chinese rose, Lisianthus, An Zuhua, iris are carried out transgenic (LmGGPS1), obtain transgenic Chinese rose, Lisianthus, An Zuhua, Phalaenopsis plants, Genomic PCR electrophoretogram, such as Fig. 7, B: negative control, 1-4 respectively Chinese rose, Lisianthus, An Zuhua, iris Genomic PCR。More thick and strong than wild type growth at the Transgenic flower Seedling of greenhouse normal growth, pattern is bright-coloured, and petal carotenoid content increases。
Embodiment 10
This laboratory utilizes Agrobacterium infestation method that the arbor trees such as willow are carried out transgenic (LmGGPS2), it is thus achieved that transgenic poplar plant, Genomic PCR electrophoretogram, for willow Genomic PCR, such as Fig. 8。
At transgenic seedling and the wild type control Seedling of greenhouse normal growth, it is good that transfer-gen plant grows than WT lines, transfer-gen plant lycopene and carotenoid content is more obvious than WT lines increases。
Sequence table
<110>University Of Tianjin
<120>protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application
<130>20131025
<160>2
<170>PatentInversion3.3
<210>1
<211>1246
<212>DNA
<213>manually serial
<220>
<221>gene
<222>(1)..(1246)
<400>1
gtcatgtctatgctaataggtgtaatccacaatcttgcaagaggtactataaatagatcc60
agatctgcaggaacaaagttgcttctttcttcagaggaaacaccagaagctctattgttc120
ctcccaaaagcaagaaccttttgtaatagcaaagatgtttccaagaatgaggctgaagtt180
atcaaacatgaaaacacattcagacaagctggtgtatttgatttcaaaagttacatgctt240
caaaagatcaagtctgtcaatacagccttagatgctgctgtcccaatcagagaaccaatc300
aagttccatgaagcaatgagatattcgctcctttctgaaggtaagcgggtttgtcctgta360
ctctgcatagccacctgtgagcttgttggtggccaagaatcaacagcaatgcctgctgct420
tgcggaatggagatgatacatgctatgtgtatgatgcacgacgaccttccgtgcatggac480
aatgatgatctccgtcgaggaaagttgtcacatcacaaggtttatggcgaaaatgtcact540
gttctagctggttattcccttgttgccttagcatttgagcatatcgcaatagccactaaa600
ggggtccacccgaaaacaatggttcgtgctgttggagaactagcaagattgataggacca660
gagggggcgacagctggccaggtggttgacttgctgtgtggaggtaaatcgggtaccaga720
ttagaagagctcgagtatattcatcgtcacaagacagcggactttgcagaggcagcgtcc780
attgtaggagcaattcttggtggtgcttccgaggatgagattaatagacttaggaaattc840
tcccagtgtattgggctgctgtttcaggttgtggatgacattcttgatgtgactaaatcc900
tctgagcaattaggaaagacagcagggaaggatttgttggctaacaagttgacgtacccg960
aagatgattggcattgacaagtctaaaaaatatgctcaaaaacttagcaaggaggctaag1020
gagcagcttgtcggttttgatccagaaaaggcagctccactactttctatggcggatttc1080
gttcttcatcggcaaaaatgatctccttaggatgataatacctgtactatttaacattag1140
ttgtgcgcatttatgtaaggacataggagggagtgaagctattccagttccttgagatat1200
atcaggaaatatggttgctgcttaatttctccatcagaaactgacc1246
<210>2
<211>365
<212>PRT
<213>MUTAGEN
<220>
<221>MUTAGEN
<222>(1)..(365)
<400>2
MetSerMetLeuIleGlyValIleHisAsnLeuAlaArgGlyThrIle
151015
AsnArgSerArgSerAlaGlyThrLysLeuLeuLeuSerSerGluGlu
202530
ThrProGluAlaLeuLeuPheLeuProLysAlaArgThrPheCysAsn
354045
SerLysAspValSerLysAsnGluAlaGluValIleLysHisGluAsn
505560
ThrPheArgGlnAlaGlyValPheAspPheLysSerTyrMetLeuGln
65707580
LysIleLysSerValAsnThrAlaLeuAspAlaAlaValProIleArg
859095
GluProIleLysPheHisGluAlaMetArgTyrSerLeuLeuSerGlu
100105110
GlyLysArgValCysProValLeuCysIleAlaThrCysGluLeuVal
115120125
GlyGlyGlnGluSerThrAlaMetProAlaAlaCysGlyMetGluMet
130135140
IleHisAlaMetCysMetMetHisAspAspLeuProCysMetAspAsn
145150155160
AspAspLeuArgArgGlyLysLeuSerHisHisLysValTyrGlyGlu
165170175
AsnValThrValLeuAlaGlyTyrSerLeuValAlaLeuAlaPheGlu
180185190
HisIleAlaIleAlaThrLysGlyValHisProLysThrMetValArg
195200205
AlaValGlyGluLeuAlaArgLeuIleGlyProGluGlyAlaThrAla
21021520
GlyGlnValValAspLeuLeuCysGlyGlyLysSerGlyThrArgLeu
225230235240
GluGluLeuGluTyrIleHisArgHisLysThrAlaAspPheAlaGlu
245250255
AlaAlaSerIleValGlyAlaIleLeuGlyGlyAlaSerGluAspGlu
260265270
IleAsnArgLeuArgLysPheSerGlnCysIleGlyLeuLeuPheGln
275280285
ValValAspAspIleLeuAspValThrLysSerSerGluGlnLeuGly
290295300
LysThrAlaGlyLysAspLeuLeuAlaAsnLysLeuThrTyrProLys
305310315320
MetIleGlyIleAspLysSerLysLysTyrAlaGlnLysLeuSerLys
325330335
GluAlaLysGluGlnLeuValGlyPheAspProGluLysAlaAlaPro
340345350
LeuLeuSerMetAlaAspPheValLeuHisArgGlnLys
355360365
Claims (4)
1. a Fructus Lycii cattle base geranylpyrophosphate synthase gene, it is characterised in that this gene is the nucleotide sequence shown in SEQIDNO.1。
2. the protein of the Fructus Lycii cattle base geranylpyrophosphate synthase gene coding described in claim 1, it is characterised in that described protein is the aminoacid sequence shown in SEQIDNO.2。
3. a recombinant vector, it is characterised in that containing the complete sequence of the Fructus Lycii cattle base geranylpyrophosphate synthase gene described in claim 1。
4. the Fructus Lycii cattle base geranylpyrophosphate synthase gene described in a claim 1 is applied to prepare transgenic corns, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Cotton Gossypii, millet, Fructus Hordei Vulgaris and flowers and vegetable plant strain。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310555823.6A CN103820475B (en) | 2013-11-11 | 2013-11-11 | The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310555823.6A CN103820475B (en) | 2013-11-11 | 2013-11-11 | The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103820475A CN103820475A (en) | 2014-05-28 |
| CN103820475B true CN103820475B (en) | 2016-06-22 |
Family
ID=50755764
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310555823.6A Expired - Fee Related CN103820475B (en) | 2013-11-11 | 2013-11-11 | The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103820475B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112391327B (en) * | 2019-08-14 | 2022-08-05 | 中国农业科学院烟草研究所 | Engineering bacterium for co-production of geraniol and nerol and construction method and application thereof |
| CN111235044B (en) * | 2019-12-31 | 2022-01-04 | 天津大学 | Recombinant saccharomyces cerevisiae strain for synthesizing delta-tocotrienol, construction method and application |
| CN114574507B (en) * | 2022-03-09 | 2023-10-03 | 中国科学院西北高原生物研究所 | Key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103153043A (en) * | 2010-10-08 | 2013-06-12 | 韩国生命工学研究院 | Ggps gene for promotimg higher growth or biomass of plant and use thereof |
-
2013
- 2013-11-11 CN CN201310555823.6A patent/CN103820475B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103153043A (en) * | 2010-10-08 | 2013-06-12 | 韩国生命工学研究院 | Ggps gene for promotimg higher growth or biomass of plant and use thereof |
Non-Patent Citations (3)
| Title |
|---|
| GenBank Accession:AFC88470;Li F et al.;《GenBank》;20130117;第1-2页 * |
| Nucleotide sequence of an arabidopsis cDNA for geranylgeranyl pyrophosphate synthase.;P A Scolnik et al.;《Plant Physiol》;19940430;第104卷(第4期);第1469-1470页 * |
| 类胡萝卜素生物合成相关基因的克隆及其遗传工程的研究进展;郑阳霞等;《细胞生物学杂志》;20060630;第28卷(第3期);第442-446页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103820475A (en) | 2014-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20060225154A1 (en) | Method for increasing expression of stress defense genes | |
| EP0952224A2 (en) | Method for producing transgenic cucumber that produces high levels of superoxide dismutase | |
| US20240309393A1 (en) | Use of slbin2 gene in regulating fruit ripening and carotenoid synthesis in tomato | |
| CN105368850A (en) | Lycium carotenoid cleavage dioxygenase enzyme gene with function of generating beta-ionone aroma substances and application of lycium carotenoid cleavage dioxygenase enzyme gene with function of generating beta-ionone aroma substances | |
| JP2001000192A (en) | Plant vector having sunflower farnesyl pyrophosphate synthase gene and method for producing the same | |
| CN103820475B (en) | The protein of Fructus Lycii yak base geranylpyrophosphate synthase gene and coding thereof and application | |
| ES2376868T3 (en) | Transgenic pineapple plants that have modified concentrations of carotenoids and manufacturing process | |
| CN114525284B (en) | Red skin longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof | |
| CN108715852B (en) | Tomato fruit mature gene Sl0658 and application thereof | |
| CN115948456B (en) | Fusion gene and method capable of improving patchouli alcohol synthesis amount | |
| CN103911386A (en) | Artificial fusion gene for improving stress tolerance of plants | |
| CN103757034B (en) | For the recombinant vectors of the matrimony vine GGPS1 gene and this gene that improve stress resistance of plant | |
| CN111411113B (en) | Pear guard cell potassium ion absorption channel gene PbrKAT1 and application thereof | |
| KR20020067303A (en) | Efficient method for the development of transgenic plants by gene manipulation | |
| CN114085854A (en) | Rice drought-resistant and salt-tolerant gene OsSKL2 and application thereof | |
| CN105695506A (en) | Method for improving cottonseed nutritional quality and application thereof | |
| KR100813284B1 (en) | Transgenic rape plants transformed phytoene synthase gene of a tangerine | |
| CN115807010B (en) | Honeysuckle leaf glandular hair-growing gene and application thereof | |
| CN116144694B (en) | Method for creating material with high anthocyanin content, application and prepared material | |
| CN116254291B (en) | Method for inhibiting potato solanine and application | |
| CN115820669B (en) | Application of SlGA2ox gene in regulating tomato toxic alkaloid content | |
| CN116891859B (en) | CaRAP2-12 gene and application thereof in regulating carotenoid synthesis in capsicum fruits | |
| CN112126651B (en) | Arabidopsis AtGLK1 gene sequence for increasing plant anthocyanin content and application thereof | |
| Gültekin | Genetic modification of glycoalkaloid content in eggplant by agrobacterium-mediated transformation technique | |
| KR101424123B1 (en) | Transgenic colored rice producing capsanthin and the method for producing the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160622 Termination date: 20201111 |