CN105695506A - Method for improving cottonseed nutritional quality and application thereof - Google Patents

Method for improving cottonseed nutritional quality and application thereof Download PDF

Info

Publication number
CN105695506A
CN105695506A CN201610255002.4A CN201610255002A CN105695506A CN 105695506 A CN105695506 A CN 105695506A CN 201610255002 A CN201610255002 A CN 201610255002A CN 105695506 A CN105695506 A CN 105695506A
Authority
CN
China
Prior art keywords
gene
cotton
promoter
ghpsy2
gossypii
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610255002.4A
Other languages
Chinese (zh)
Inventor
肖月华
王毅
姚丹
李倩
罗明
侯磊
裴炎
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southwest University
Original Assignee
Southwest University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southwest University filed Critical Southwest University
Priority to CN201610255002.4A priority Critical patent/CN105695506A/en
Publication of CN105695506A publication Critical patent/CN105695506A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for improving cottonseed nutritional quality and application thereof. The technical purpose that a new choice is provided for improving the cottonseed carotenoid content and improving cottonseed nutritional quality is achieved. According to the technical scheme, a seed-specific expression promoter is built to drive the plant expression vector of a phytoene synthetase gene PSY, cotton is transformed, the carotenoid content in cottonseeds is improved, and the PSY gene is the cotton GhPSY2 gene. After the target gene is regulated through the method, the carotenoid content in mature cottonseeds is significantly improved. The method is easy and convenient to implement and remarkable in effect, and has the application prospect of producing huge economic benefits.

Description

A kind of method improveing Semen Gossypii nutritional quality and application thereof
Technical field
The invention belongs to field of plant genetic, be specifically related to a kind of method improveing Semen Gossypii nutritional quality and application thereof。
Background technology
Carotenoid belongs to isoprenoid compounds, is the important natural plant pigment of a class。Carotenoid is a class fat-soluble pigment, and its color is beautiful, mainly presents yellow, orange red and red。For animal and human's body, carotenoid is important healthy Protective substances。As vitamin a source unique in humans and animals body, it is human body and the indispensable nutrient substance of animal that carotenoid converts the vitamin A formed, it is possible to effectively act as the health-care effect of vision and integumentary system。Additionally, carotenoid has antioxidation, its existence can slow down aging, reduce the sickness rate of cardiovascular disease and cancer。But animal body self can not be directly synthesized carotenoid, required carotenoid is both needed to be absorbed from plant or microorganism by food chain。A few carotenoid such as beta-carotene, astaxanthin can only be obtained, far from meeting demand by fermentable。In plant, the carotenoid of extracting directly is safe and reliable, and physiological and pharmacological activity is substantially。But carotenoid content is limited in plant, the crops cultivating carotenoid content abundant have significant application value。
Cotton Gossypii is one of most important crops in the world, is mankind's main sources of obtaining natural fiber。As by-product maximum in Cotton Production process, Semen Gossypii has huge use value。Containing the nutrient substance such as rich in protein and oils and fats in Semen Gossypii, it is oil expression and the important source material producing feedstuff。Carotenoid content about 15 μ g/g in Semen Gossypii。Cultivate the cotton variety of high carotenoid in Semen Gossypii, strengthen the comprehensive utilization of Semen Gossypii, it would be beneficial in the economic benefit promoting cotton planting。
In recent years, the main target of carotenoid in plants metabolic engineering is the expression of structural gene in regulation and control route of synthesis。On many plants, more successful report is had to regulate and control carotenogenesis currently, with respect to the expression utilizing carotenoid synthase gene。Such as, " gold rice ", Lcyb, Psy, CrtI (Pds) gene corotation is dissolved a japonica rice variety, obtains flavous endosperm。Analysis shows, comprises multiple types carotene and rich content in this endosperm。The Chinese patent application that patent publication No. is CN101979601A discloses a kind of method improving carotenoid content of tomato, it is utilize genetic engineering means to build cryptochrome gene 1, the Overexpression vector of the c-terminus of cryptochrome gene 1 and the c-terminus of cryptochrome gene 2, convert Fructus Lycopersici esculenti, obtain transgenic Fructus Lycopersici esculenti, it is achieved that the raising of lycopene and total carotinoid content larger amplitude in Transgenic tomato fruit。
Phytoene synthetase (PSY) is important rate-limiting enzyme involved in Carotenoid biosynthetic pathway, and cattle geranylpyrophosphate (GGPP) condensation of its catalysis 2 molecule forms first carotenoids phytoene。Overexpression phytoene synthetase in Fructus Lycopersici esculenti, Brassica campestris L, arabidopsis and Rhizoma Solani tuber osi, the level accumulating carotenoid in respective organization significantly improves。Visible, change phytoene synthetase expression by carotenoid content in profound influence plant。But up to the present, there is not yet the report about the improvement of Semen Gossypii carotenoid content。
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of the newly selected for Semen Gossypii nutrition improvement。
The technical scheme is that a kind of method improveing Semen Gossypii nutritional quality, build seed-specific expression promoter and drive the plant expression vector of phytoene synthase gene PSY, and converting cotton, improving carotenoid content in Semen Gossypii, described PSY gene is Cotton Gossypii GhPSY2 gene。
Concrete, described GhPSY2 gene has the nucleotide sequence as shown in SEQIDNo.1。
Concrete, the promoter of regulation and control PSY gene expression is phaseolus vulgaris seeds specific promoter。
Preferably, described seed-specific expression promoter is the promoter pV of Kidney bean storage protein β-Phaseolin β-phaseolin gene, has the nucleotide sequence as shown in SEQIDNo.2。
Concrete, described plant expression vector is the nucleotide sequence shown in SEQIDNo.3 such as。
Concrete, described is converted into Agrobacterium tumefaciens mediated genetic transformation。
Present invention also offers described method purposes in improving Semen Gossypii carotenoid content。
Beneficial effects of the present invention: the present invention passes through research and analysis, adopts specific promoter at times during seed development specifically expressing Cotton Gossypii phytoene synthase gene GhPSY2, it is thus achieved that the transgene cotton that in Semen Gossypii, carotenoid content significantly improves。Experiment results proved, after target gene is regulated and controled by the present invention, in the Semen Gossypii of improvement, carotenoid content significantly improves, and Semen Gossypii nutrition is strengthened。The inventive method is simple and easy to do, and effect is notable, has the potentiality producing great economic benefit。
Accompanying drawing explanation
The gene structure figure in the expression vector T-DNA district of Fig. 1 pV:GhPSY2
CaMV35S-P, cauliflower mosaic virus 35 S promoter；2 × CaMV35S-P, two cauliflower mosaic virus 35 S promoters of connecting；CaMV35S-T, cauliflower mosaic virus 35S terminator；GhPSY2, Cotton Gossypii phytoene synthase gene；GUS:NPTII, β-glucose neuraminidase and neomycin phosphotransferase fusion gene；LB, T-DNA left margin；Nos-T, Agrobacterium Opines synthase gene terminator；PV, phaseolus vulgaris seeds specific promoter；RB, T-DNA right margin。
Fig. 2 pLGN-pV:GhPSY2 expression vector establishment flow process
Specific experiment method is shown in embodiment 2。CaMV35S-P, cauliflower mosaic virus 35 S promoter；2 × CaMV35S-P, two cauliflower mosaic virus 35 S promoters of connecting；CaMV35S-T, cauliflower mosaic virus 35S terminator；GhPSY2, Cotton Gossypii phytoene synthase gene；GUS:NPTII, β-glucose neuraminidase and neomycin phosphotransferase fusion gene；LB, T-DNA left margin；Nos-T, Agrobacterium Opines synthase gene terminator；PV, phaseolus vulgaris seeds specific promoter；RB, T-DNA right margin。Relevant restriction enzyme site and position mark on each carrier。
Fig. 3 wild type (WT) Cotton Gossypii and pV:GhPSY2 transgene cotton
A:GhPSY2 expression (Relativeexpression) detects；B: wild type or transgenic Cotton Gossypii mature seed；C: wild type or the mature seed after the pulverizing of transgenic Cotton Gossypii；D: dilute the Oleum Gossypii semen of 20 times with ether；E: carotenoid content in Oleum Gossypii semen。WT: wild-type samples；Two strains of #1, #2:pV:GhPSY2 transgene cotton；* and * * shows and between wild type control in notable antinion significant difference (t check, n=3)。
Detailed description of the invention
Normal experiment operation used in following embodiment:
The extraction of 1.DNA
Genomic DNA adopts plant genome DNA rapid extraction test kit (Aidlab) to extract, and detailed step is shown in description。
The extraction of 2.RNA
RNA adopts EASYspin plant RNA rapid extraction test kit (Aidlab) to extract, and detailed step is shown in description。
The pcr amplification of 3.DNA fragment
Amplification system is as follows: 10 × ExPCRbuffer (Mg2+Free) 2.5 μ L, 2.5mmol/LdNTPs2 μ L, 25mmol/LMgCl22 μ L, primer 1 (5 μm of ol/L) 1 μ L, primer 2 (5 μm of ol/L) 1 μ L, ExTaqDNA polymerase 1U, genomic DNA is about 60ng, adds ddH2O to 25 μ L。
Amplification program is: 94 DEG C, 5min；94 DEG C, 30sec, 56 DEG C, 30sec, 72 DEG C, 1.5min, 35 circulations；72 DEG C extend 10min。
The recovery of 4.DNA fragment, connection and clone
Use BioFlux glue to reclaim test kit and reclaim DNA fragmentation。T4DNAligase is used to carry out DNA fragmentation connection。The fragment reclaimed sets up following linked system with pUCm-T (the raw work in Shanghai) carrier: 10 × T4DNA is connected buffer 1 μ L, vector DNA fragment 1 μ L, and external source connects product DNA fragmentation 1 μ L, T4DNA ligase 1 μ L, uses ddH2O supplies volume to 10 μ L。It is 13,16 DEG C of connection 12h that vector DNA fragment is connected product DNA fragmentation mol ratio with external source。Product will be connected afterwards and convert bacillus coli DH 5 alpha。The resistance clone obtained through liquid culture overnight, extracts plasmid with BioFlux plasmid extraction kit, after digestion verification, checks order in Invitrogen company。
5.GUS histochemical stain
The expression vector adopted due to laboratory has gus reporter gene, general with GUS histochemical stain detecting and tracking transgenic。Concrete grammar: take a small amount of transgene cotton blade (having wound) and be placed in 96 orifice plates, adds GUS dye liquor [0.1mol/LK3Fe(CN)6, 0.1mol/LK4Fe(CN)6, 0.01mol/LNa2EDTA, 500mg/LX-Gluc, 1%TritonX-100 (v/v), 0.14mol/L sodium phosphate buffer (pH7.0)], under 37 DEG C of constant temperature, place about 2h, after abundant dye liquor, use 75% ethanol decolorization again。It is transgenic positive that plant leaf can be dyed the plant of special blueness by GUS dye liquor。
6. the extracting of Oleum Gossypii semen and carotenoid content thereof measure
Oleum Gossypii semen extracts and adopts soxhlet extraction methods:
1) filter paper packet folded being put into and dry 2h in glass dish in 105 DEG C of baking ovens, taking-up is put into exsiccator and is cooled to room temperature, correct amount note W1。
2) taking about 3g seed pulverizer to pulverize, cross 40 eye mesh screens, take about 1g sample and load in the above-mentioned filter paper packet weighed, put into dry 3h in 105 DEG C of baking ovens, taking-up is put into exsiccator and is cooled to room temperature, correct amount note W2。
3) above-mentioned put in fat extractor (BUCHIB-811 extraction system) equipped with sample the filter paper packet weighed, enough ether soaked overnight。
4) after overnight, 70～80 DEG C of extracting 8h, after extracting completes, collect bottom oils and fats (i.e. Oleum Gossypii semen), paper bag puts into dry 3h in 105 DEG C of baking ovens, and taking-up is put into exsiccator and is cooled to room temperature, correct amount note W3。
5) crude fat content (%)=(W in seed2-W3)/(W2-W1) × 100%
Further, Oleum Gossypii semen ether that above-mentioned extracting is obtained dilute n times to microplate reader can detection range, take 200 μ L in ELISA Plate, microplate reader detects the light absorption value at 445nm place, light absorption value is substituted into standard curve (with reference to beta-carotene standard curve), calculates carotenoid content。
7. the making of beta-carotene standard curve
1) accurately weighing 1mg beta-carotene standard substance, with ether constant volume in the brown volumetric flask of 10ml, beta-carotene concentration is 100 μ g/ml；
2) continue to be diluted to 7 Concentraton gradient: 0,0.1,1,3,6,9,12,15 μ g/mL；
3) 200 μ L are taken in ELISA Plate, the light absorption value at microplate reader detection 445nm place；
4) linear regression, makes standard curve。
Table 1 primer catalog
Primer Sequence 5 '-3 ' Describe
GhPSY2-U GGATCCATGGCTGGTGTTCTTCTTTGGGTG Gene amplification forward primer
GhPSY2-D GAATTCACTAGTGATCTTCAGAACAATTTG Gene amplification downstream primer
pV-F AAGCTTGAATTCATTGTACTCCCAGTATC Promoter amplification forward primer
pV-R GGATCCCTCGAGTCTAGAAGTAGTATTG Promoter amplification downstream primer
GhPSY2-F(RT) ATGAATTTTGATGAGCTCTAT RT-PCR forward primer
GhPSY2-R(RT) ATTAGCAATTCCGAGGGCTA RT-PCR downstream primer
GhACT4-F(RT) TTGCAGACCGTATGAGCAAG RT-PCR forward primer
GhACT4-R(RT) ATCCTCCGATCCAGACACTG RT-PCR downstream primer
Embodiment 1 Cotton Gossypii phytoene synthase gene GhPSY2 obtains
On Phytozome public database (https: //phytozome.jgi.doe.gov), with arabidopsis phytoene synthase gene AtPSY (At5g17230) base sequence for bait, search for the homologous genes in Lei Mengdeshi cotton by BlastN。The gene being numbered Gorai.006G009400 in result display Lei Mengdeshi cotton has high homology with At5g17230。With the CDS sequence of Gorai.006G009400 for Reference Design primer (table 1, GhPSY2-U&GhPSY2-D), with Gossypium hirsutum L. cDNA for template, amplification obtains fragment, and at fragment two ends plus BamH I and EcoR I site, sequencing result is SEQIDNO.1 such as。Cluster analysis shows, the known phytoene synthase gene of this sequence and other species (such as arabidopsis, Fructus Lycopersici esculenti, Semen sojae atricolor etc.) has high homology, and therefore this sequence is considered as Cotton Gossypii phytoene synthetase encoding gene (GhPSY2)。
The structure of the GhPSY2 expression vector that embodiment 2 times during seed development is special
GhPSY2 is built into the flow process of plant expression vector pLGN-Nos and sees Fig. 2。PLGN-Nos carrier is the binary plant expression vector come by traditional plant expression vector pBI121 transformation。Its T-DNA section (region between RB and LB, Fig. 2) replace the track fusion box of CaMV35S promoter (CaMV35S-P) the control report gene GUS and marker gene NPTII for composing type and another expression cassette controlled by CaMV35S-P。
From bean gene group, cloning promoter pV is expanded with primer (table 1, pV-F and pV-R), and at promoter two ends plus Hind III and BamH I site。With BamH I and EcoR I, GhPSY2 is cut from cloning vehicle, with Hind III and BamH I, promoter pV is cut from cloning vehicle。Above-mentioned two fragment is added simultaneously to containing, in the coupled reaction system of Hind III and the pLGN-Nos carrier segments of EcoR I enzyme action, connecting and obtain final expression vector pLGN-pV:GhPSY2。All restricted enzyme, purchased from Roche company, operate according to operation instructions。The recovery of DNA fragmentation, connection and escherichia coli convert and are undertaken by aforementioned conventional practices。With reference to Bio-RADMicroPulser instruction manual book, above-mentioned carrier is imported Agrobacterium LB4404 by Electroporation conversion。
The genetic transformation of embodiment 3 Cotton Gossypii
Carried out the Cotton Transformation of above-mentioned expression vector by Agrobacterium tumefaciens mediated method, used medium formula is in Table 2。Concrete grammar is as follows: chooses cotton No. 14 cotton seeds (shelling) in wild type Ji of full grains, is placed in aseptic triangular flask, 0.1%HgCl after 75% ethanol rinse 1 minute2Sterilizing about 10 minutes (shake triangular flask), sterilized water fully rinses 6-8 time, is placed in 30 DEG C of shaking tables (100-110rpm), treat that radicle grows about 1cm (about 24-36h, a water is changed every 8 hours), take out, radicle is inserted in seed germination medium。30 DEG C of darkrooms are cultured to hypocotyl elongation to 2-3cm (about 48h)。By carrying the Agrobacterium list colony inoculation of expression cassette carrier in the liquid YEB culture medium containing 50mg/LKm and 125mg/LSm, it is placed in 28 DEG C of shaking tables (200rpm)。Measured the OD value (OD of bacterium solution every one hour after about 20h600), OD600It is suitable at 0.8-1.0。Collect agrobacterium liquid, centrifugal, 8000rpm, 1min, abandons supernatant。With co-culturing fluid medium by after 1:1 (v/v) resuspended precipitation containing AS (acetosyringone, 100 μm of o1/L), collect re-suspension liquid in 100mL triangular flask, be placed in 30 DEG C of shaking tables (100-110rpm) and cultivate about 30min。Hypocotyl is cut into the segment being about 0.8-1cm, it is placed in re-suspension liquid, 30 DEG C of shaking tables infect 40min, abandon liquid, lower embryo section is layered on and co-cultures primary surface, cultivate about 48h in darkroom, proceed in screening culture medium, 30 DEG C of cultivations (16h illumination/8h is dark), every about 15 days subcultures once to wound healing formation。After wound healing increases, forward to and wound healing culture medium is cultivated。In the embryo callus subculture access suspension medium that picking is in good condition, it is placed in suspension culture about a week on 30 DEG C of (100-110rpm) shaking tables, filter through 30 eye mesh screens, the tiny embryo granule after filtering is laid in body embryo elongation medium, grow to green ripe body embryo。It is transferred in elongation medium and continues to cultivate body embryo to about 1cm, proceed to until seedling grows up to (about 10cm) in root media, transplant to nutritive cube, continue to cultivate。More than operation must aseptically complete。
The GUS that will filter out+And the regeneration Cotton Gossypii seedling replanting of robust growth is to culture pan, in greenhouse, Routine Management is to cotton fiber and seed maturity。T1 is for transgenic cotton flower seed for results, continue plantation T1 generation and gather in the crops T2 for seed, the T2 sprouted is carried out GUS tissue staining (see conventional practices) for seedling for after seed by sowing T2, filter out the transgenic T2 isozygotied for strain (being all the GUS positive or GUS feminine gender plant), transplant T2 for homozygous lines, and detect the expression of target gene GhPSY2 and investigate seed properties change。
The Cotton Transformation culture medium that table 2 is Agrobacterium tumefaciens mediated
MS:Murashige&Skoog, 1962；B5:Gamborg, 1986；Gelrite:Sigma, article No.: G1910；SH:Schenk&Hildebrandt, 1972。
The detection of embodiment 4GhPSY2 gene transcription level
Extract the RNA of comparison and 36 days embryos of transgene cotton Post flowering, reverse transcription synthesis cDNA mono-chain, carry out quantitative PCR detection as template。Concrete operation step is: synthesize a chain cDNA of various RNA with cDNA mono-chain synthetic agent box (TaKaRa company), operation is all undertaken by test kit description。Quantitative PCR carries out on CFX96 quantitative PCR detection system (Bio-Rad), and the reaction system of 25 μ L includes 12.5 μ L2 × SuperMix (Bio-Rad), each 0.2 μm of ol/L of upstream and downstream primer and 1 μ L mono-chain cDNA。Thermal cycler parameters is 95 DEG C of denaturation 2min；95 DEG C, 10sec, 57 DEG C, 20sec, amplification 40 circulation。Mark in making with Cotton Gossypii Actin4 gene。The software Bio-RadCFXManager2.0 that analyzes carried with quantitative PCR apparatus calculates the relative expression quantity of each gene。Quantification PCR primer sequence used is in Table 1。
Gene expression analysis finds: GhPSY2 is significantly higher than wild-type samples in transgenic sample transcription level, it was shown that pV promoter can start the expression (Fig. 3 A) of GhPSY2 in embryo。
The investigation of embodiment 5 transgene cotton seed properties
Carotenoid is an important terpenoid natural pigment of class, presents yellow, orange or red etc.。Observe Cotton Gossypii mature seed: wild-type mature seed is white, and pV:GhPSY2 transgenic cotton flower seed is orange (Fig. 3 B)。Being pulverized by mature seed further, wild-type samples is light yellow, and pV:GhPSY2 transgenic sample is orange (Fig. 3 C)。Using ether as solvent, the Oleum Gossypii semen in extracting seed, the Oleum Gossypii semen 20 that extracting obtains is diluted in ether again, and wild-type samples is close to colourless, and transgenic sample remains in that obvious yellow (Fig. 3 D)。Carotenoid content detection display (Fig. 3 E): in the Oleum Gossypii semen of wild-type samples, carotenoid content is 38.63 ± 4.02 μ g/mL, carotenoid content respectively 269.05 ± 4.47 μ g/mL and 245.22 ± 6.36 μ g/mL in the Oleum Gossypii semen of two transgenic sample, relatively wild-type samples is greatly improved。In sum, the expression of promoter pV startup phytoene synthase gene GhPSY2 can promote a large amount of synthesis and the accumulation of carotenoid in cotton seeds。
Examples detailed above shows, the present invention improves the method for Semen Gossypii nutrition, it is possible to realizes raising the expression of GhPSY2 in embryo, promotes carotenogenesis, reaches the purpose of strengthening Semen Gossypii nutrition。The present invention, by gene order homology comparison, it has been found that and clone one Cotton Gossypii phytoene synthase gene (GhPSY2) of acquisition。Utilize the phaseolus vulgaris seeds specific promoter pV specifically expressing instructing GhPSY2 in Semen Gossypii, improve phytoene synthetase level in Semen Gossypii, to reach to promote the purpose of carotenoid content in Semen Gossypii, be the method for a kind of simple possible of strengthening Semen Gossypii nutrition。
List of references:
Doyle,J.J.,Schuler,M.A.,Godette,W.D.,Zenger,V.,Beachy,R.N.,&Slightom,J.L.(1986).TheglycosylatedseedstorageproteinsofGlycinemaxandPhaseolusvulgaris.Structuralhomologiesofgenesandproteins.JournalofBiologicalChemistry,261(20),9228-9238。

Claims (7)

1. the method improveing Semen Gossypii nutritional quality, it is characterized in that: build seed-specific expression promoter and drive the plant expression vector of phytoene synthase gene PSY, and converting cotton, improving carotenoid content in Semen Gossypii, described PSY gene is Cotton Gossypii GhPSY2 gene。
2. the method for claim 1, it is characterised in that: described GhPSY2 gene has the nucleotide sequence as shown in SEQIDNo.1。
3. method as claimed in claim 1 or 2, it is characterised in that: the promoter of regulation and control PSY gene expression is phaseolus vulgaris seeds specific promoter。
4. method as claimed in claim 3, it is characterised in that: described seed-specific expression promoter is the promoter pV of Kidney bean storage protein β-Phaseolin β-phaseolin gene, has the nucleotide sequence as shown in SEQIDNo.2。
5. the method as described in any one of Claims 1 to 4, it is characterised in that: described plant expression vector is the nucleotide sequence shown in SEQIDNo.3 such as。
6. the method as described in any one of Claims 1 to 5, it is characterised in that: described is converted into Agrobacterium tumefaciens mediated genetic transformation。
7. the purposes in improving Semen Gossypii carotenoid content of the method described in any one of claim 1～6。
CN201610255002.4A 2016-04-20 2016-04-20 Method for improving cottonseed nutritional quality and application thereof Pending CN105695506A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610255002.4A CN105695506A (en) 2016-04-20 2016-04-20 Method for improving cottonseed nutritional quality and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610255002.4A CN105695506A (en) 2016-04-20 2016-04-20 Method for improving cottonseed nutritional quality and application thereof

Publications (1)

Publication Number Publication Date
CN105695506A true CN105695506A (en) 2016-06-22

Family

ID=56217521

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610255002.4A Pending CN105695506A (en) 2016-04-20 2016-04-20 Method for improving cottonseed nutritional quality and application thereof

Country Status (1)

Country Link
CN (1) CN105695506A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109811004A (en) * 2019-02-26 2019-05-28 西南大学 Expression vector produces the application in pale brown color fibre in the secondary wall puberty specifically expressing GhPSY2 gene of cotton
CN109852626A (en) * 2019-02-26 2019-06-07 西南大学 Albumen, expression vector, transformed plant and the application of a kind of GhOR gene and its coding

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1227609A (en) * 1996-08-09 1999-09-01 卡尔金公司 Method for producing carotenoid compounds and speciality oils in plant seeds
CN1275166A (en) * 1997-08-08 2000-11-29 卡尔金有限责任公司 Methods for producing carotenoid compounds and speciallty oils in plant seeds
CN1347454A (en) * 1999-03-05 2002-05-01 格林诺瓦森植物生物技术股份有限公司 Method for improving agronomic and nutritional value of plants
WO2008042338A2 (en) * 2006-09-28 2008-04-10 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1227609A (en) * 1996-08-09 1999-09-01 卡尔金公司 Method for producing carotenoid compounds and speciality oils in plant seeds
CN1275166A (en) * 1997-08-08 2000-11-29 卡尔金有限责任公司 Methods for producing carotenoid compounds and speciallty oils in plant seeds
CN1347454A (en) * 1999-03-05 2002-05-01 格林诺瓦森植物生物技术股份有限公司 Method for improving agronomic and nutritional value of plants
WO2008042338A2 (en) * 2006-09-28 2008-04-10 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHRISTINE K. SHEWMAKER等: "Seed‐specific overexpression of phytoene synthase: increase in carotenoids and other metabolic effects", 《THE PLANT J》 *
无: "Accession No.：XM_012628021.1，PREDICTED: Gossypium raimondii phytoene synthase 2, chloroplasticlike(LOC105798105),mRNA", 《GENBANK DATABASE》 *
龚学臣等: "八氢番茄红素合成酶基因(PSY)对大豆的遗传转化", 《大豆科学》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109811004A (en) * 2019-02-26 2019-05-28 西南大学 Expression vector produces the application in pale brown color fibre in the secondary wall puberty specifically expressing GhPSY2 gene of cotton
CN109852626A (en) * 2019-02-26 2019-06-07 西南大学 Albumen, expression vector, transformed plant and the application of a kind of GhOR gene and its coding
CN109852626B (en) * 2019-02-26 2020-08-04 西南大学 GhOR gene, protein coded by GhOR gene, expression vector, transformed plant and application of GhOR gene
CN109811004B (en) * 2019-02-26 2020-10-13 西南大学 Application of expression vector in producing brown yellow fiber by specifically expressing GhPSY2 gene in secondary wall development stage of cotton

Similar Documents

Publication Publication Date Title
Yang et al. Efficient embryogenic suspension culturing and rapid transformation of a range of elite genotypes of sweet potato (Ipomoea batatas [L.] Lam.)
CN102485897A (en) Method for changing petal colors by using cotton gene GbF3H
BRPI0922922A2 (en) methods for regenerating jatropha curcas plants for agrobacterium-mediated transformation of jatropha curcas plants
Rashid et al. Effect of bacterial culture density and acetosyringone concentration on Agrobacterium mediated transformation in wheat
Mekala et al. Optimization of Agrobacterium-mediated genetic transformation of shoot tip explants of green gram (Vigna radiata (L.) Wilczek)
CN104770294B (en) A kind of protocorm based on the sprouting of iris seed is the breeding method of acceptor
CN114525284B (en) Red skin longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof
CN103966235A (en) Eggplant anthocyanin synthesis-related gene SmMYB1 as well as recombinant expression vector thereof and application of gene SmMYB1 in purple tomato culture
PT1589807E (en) Transgenic pineapple plants with modified carotenoid levels and methods of their production
CN110184293A (en) A method of increasing phytomass or yield by improving photosynthetic efficiency
CN102250943A (en) In-vitro tissue culturing method for soybeans under mediation of agrobacterium tumefaciens
Tsai et al. Plant regeneration and stable transformation in the floricultural plant Cleome spinosa, a C 3 plant closely related to the C 4 plant C. gynandra
CN105695506A (en) Method for improving cottonseed nutritional quality and application thereof
CN103718957B (en) The haploid method of male sterile tobacco is cultivated by Unfertilized Ovules
CN101186910B (en) Transgene method for peanut
CN103250636A (en) Efficient leguminous plant somatic embryogenesis and plant building method
KR100402513B1 (en) Efficient method for the development of transgenic plants by gene manipulation
CN104878039A (en) Mulberry transgenic method based on agrobacterium tumefacien mediated hybernacle injection
CN107858370A (en) A kind of method for preparing fertility-lowered plant
CN102524064B (en) Rejuvenation and rooting culturing method for genetic transformation seedlings of Jatropha curcas
CN102051377B (en) Non-tissue culture corn genetic transformation method
CN108866080A (en) Tomato stress response gene, its recombinant expression carrier and its application in cultivation salt tolerant tomato
An et al. Research progress on tissue culture and genetic transformation of kenaf (Hibiscus cannabinus)
CN109852626A (en) Albumen, expression vector, transformed plant and the application of a kind of GhOR gene and its coding
JP2010227033A (en) Method for producing plant transformant and plant transformant

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160622

RJ01 Rejection of invention patent application after publication