CN103757034B - For the recombinant vectors of the matrimony vine GGPS1 gene and this gene that improve stress resistance of plant - Google Patents

Abstract

The present invention relates to a kind of matrimony vine yak base geranylpyrophosphate synthase gene and comprise the recombinant vectors of this gene, be specially the clone of yak base geranylpyrophosphate synthase gene <i>Lm</iGreatT.G reaT.GT<i>GGPS1</i> in matrimony vine.By extracting the total serum IgE in fresh matrimony vine blade, the yak base geranylpyrophosphate synthase gene LmGGPS1 in clone matrimony vine, obtaining the complete sequence of gene is 1134bp; Construct coli expression carrier pET28a-LmGGPS1 and construct binary plant expression vector pCAMBIA2300-LmGGPS1, carrier is proceeded to Agrobacterium C58 cell by electric shocking method, with this cell transformation tobacco, obtain transgene tobacco, by test, find that transgene tobacco substantially increases the content of plant Lyeopene, the content of carotenoid also increases.The present invention can be used for preparing transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and flowers and vegetable plant strain.

Description

For the recombinant vectors of the matrimony vine GGPS1 gene and this gene that improve stress resistance of plant

Technical field

The present invention relates to a kind of matrimony vine ( lyciumchinenseMiller) yak base geranylpyrophosphate synthase gene (Geranylgeranylpyrophosphatesynthase, gGPS) and comprise the recombinant vectors of this gene, be specially yak base geranylpyrophosphate synthase gene in matrimony vine lmGGPS1clone.

Background technology

Yak base geranylpyrophosphate (GGPP) is the ubiquitous important mesostate of organic sphere. in plant, GGPP participates in the synthesis of the products such as chlorophyll, carotenoid, Plant hormones regulators,gibberellins, plastoquinone, vitamin-E, monoterpene and benzoquinones, to photosynthesis of plant, to grow and product quality etc. has material impact.This product is is directly catalyzed and synthesized by GGPS.GGPP is not only the most direct precursor substance of herxheimer-liked reaction, or the precursor substance such as plant materials inner gibberellin, chlorophyll and plastoquinone.The synthesis of GGPP is the speed limit process in carotenogenesis.By a series of enzymatic reaction, the Lyeopene of generation not only gives tomato bright-coloured color and luster, and has important healthy nutritive value.Medical research shows, in serum, the Lyeopene of high-content can reduce the sickness rate of various cancer significantly, the occurrence probability of the kinds cancers such as the content of lycopene in blood and prostate cancer, digestive tract cancer, mammary cancer, lung cancer, bladder cancer, skin carcinoma is negative correlation, and research shows that in human body, high lycopene content can reduce the occurrence probability of prostate cancer significantly.The effect of Lyeopene protection cardiovascular and cerebrovascular is mainly by its antioxygenation; reduce the peroxidation of serum lipid and low-density lipoprotein; thus reducing the sickness rate of arteriosclerosis and coronary heart disease, the absorption of high hycopene can reduce the incidence probability of cardiovascular and cerebrovascular diseases significantly.Lyeopene also has effects such as improving immunizing power, delay senility.

Lyeopene can quenching singlet oxygen, scavenging free radicals, prevents protein and DNA to be subject to the effects such as the destruction of oxygen.It is 10 times that commonly use antioxidant vitamin E at present that Lyeopene removes the ability of singlet oxygen, 2 times of β-carotene.The quantity of the conjugated double bond that lycopene molecule contains in all carotenoid is maximum, and its singlet-oxygen quenching rate constant is 100 times of vitamin-E, is the carotenoid that resistance of oxidation is the strongest.The chemical structure of Lyeopene determines the ability that it has very strong removal reactive oxygen species and free radicals, is a kind of good antioxidant.And carotenoid, especially β-carotene can suppress, remove interior free yl, can delay senility and the disease such as prophylaxis of tumours, thrombus, atherosclerosis.Carotenoid can increase the vigor of B cell in immunity system, eliminate the pathogenic bacteria of external source invasion, can improve the vigor of lymph helper cell, assists B cell to produce antibody, and improves the activity of other immune component; The number of natural killer cell can also be increased, to eliminate infected cell or cancer cells in body.

In plant, under GGPS gene and other enzyme acting in conjunction, generate diterpene, tetraterpene and polyterpene compound.GGPS is the key enzyme of synthesis diterpene, tetraterpene and polyterpene.Tobacco terpenoid and tabacco fragrance closely related, they are not only present in tobacco leaf as important tobacco aroma precursor, and in flue gas, have also discovered the most of terpenoid compound had in tobacco leaf.As the main moiety that diterpene is blade face body of gland colloid secretory product, its main component is western cypress three enediol, and its degraded product solanone and derivative thereof are important fragrance matters; Tetraterpene compounds carotene importantly in tobacco leaf causes perfumery precursor, and its degraded product such as trans-Damascenone, jononeionone, Megastigmatrienone etc. are important aroma components in tobacco leaf.In China's leaf tobacco production, increase tobacco leaf terpenoid content, particularly closely-related Aroma precursor material, as the accumulation in tobacco leaf such as diterpene, carotenoid, can increase tobacco incense tolerance, improve quality of tabacco fragrance with flavouring essence quality.Therefore, transgenosis GGPS tobacco is studied significant.

The step of Carotenoid in Plants synthesis is as follows: 3-methyl-3, 5-dihydroxy-acid (MVA) synthesizes isopentenylpyrophosphate (IPP) under the katalysis of enzyme, isopentenylpyrophosphate (IPP) first generates the isomers dimethyl allene tetra-sodium (DMAPP) with propenyl structure under the effect of isopentenylpyrophosphate isomerase (IPI), it is precursor substance required in isopentene route of synthesis, DMAPP and IPP generates yak base tetra-sodium (GPS) successively through continuous print condensation, farnesyl pyrophosphate (FPP), yak base yak base tetra-sodium (GGPP).Bimolecular GGPP becomes phytoene by phytoene synthetase (PSY) catalyzed polymerization.Phytoene generates the former Lyeopene (prolycopene) of cis-structure through continuous print dehydrogenation reaction, and former Lyeopene isomery under the effect of carotene isomerase (CRTISO) becomes transconfiguration Lyeopene.Under the catalysis of Lyeopene corresponding cyclase subsequently, generate a, β-carotene, and generate the pigment (Tanakaetal., 2008) of other type further.

Along with the mankind are to the continuous discovery of Lyeopene and carotenoid pharmaceutical use and medical care effect, to Lyeopene and the kind of carotenoid and the demand of output also by increasing, but Lyeopene carotenoid is difficult to chemically synthesize.The development of modern molecular biology research means, make the gene of a series of key enzymes in Lyeopene and Carotenoid biosynthetic pathway by isolation identification successively, road is opened for producing Lyeopene and carotenoid by DNA recombinant technology and genetic engineering regulation and control, particularly obtain " golden paddy rice " and " polishes dish " by carotenoid genetically engineered, significantly enhance people and carry out the engineered confidence of Carotenoid in Plants.

Terpenoid is the compounds that in plant metabolites, quantity is maximum, is that structural unit forms by isoprene.At respiration, the photosynthesis of plant materials, and play an important role in growth, growth, breeding, signal transduction and defence.Some terpenoid has important economic worth, and also some can be used as natural perfume and perfume compound or anti-tumor chemotherapeutic medicine.In plant, the biosynthesizing of terpenoid occurs in tenuigenin and plastid, its precursor substance is the isopentenyl pyrophosphate (Isopentenylpyrophosphate of C5 structure, and isomers---dimethylallylpyrophosphate ester (Dimethylallylpyrophosphate, DMAPP) IPP).IPP via the synthesis of mevalonic acid (Mevalonicacid, MVA) approach is the precursor of synthesis farnesyl pyrophosphate (Farnesylpyrophosphate, FPP, C15), and FPP finally synthesizes sesquiterpene, triterpene and sterol in tenuigenin.In plastid, IPP and DMAPP of methylerythritol phosphoric acid (methyl-erythritol-phosphate, MEP) approach synthesis is the precursor generating geranyl tetra-sodium (Geranylpyrophosphate, GPP, C10).GPP generates monoterpene under the effect of monoterpene synthetic enzyme; At geranyl geranylpyrophosphate synthetic enzyme (GeranylgeranylpyrophosphateSynthase, GGPPS) effect is lower generates geranyl geranylpyrophosphate (Geranylgeranylpyrophosphate, GGPP, and then under the effect of enzyme, generate diterpene, tetraterpene and polyterpene compound C20).

Summary of the invention

The object of the present invention is to provide a kind of matrimony vine yak base geranylpyrophosphate synthase gene.

Second object of the present invention is to provide the protein of this genes encoding.

The present invention also aims to provide the recombinant vectors containing this gene and host cell.

Another object of the present invention is the purposes providing this gene.

The invention provides a kind of matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1, the nucleotide sequence as shown in SEQ ID NO.1 is formed.

The invention provides a kind of above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1the protein of coding, the protein of the aminoacid sequence as shown in SEQ ID NO.2.

The invention provides a kind of above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1recombinant cloning vector pMD19-T- lmGGPS1.

Containing above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1recombinant vectors, these recombinant vectorss comprise plasmid.

Described plasmid expression vector coli expression carrier pET28a- lmGGPS1.

Containing above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1recombinant vectors, these recombinant vectorss comprise plasmid.

Described plasmid expression vector coli expression carrier pET28a-LmGGPS1.

Described plasmid expression vector binary plant expression vector pCAMBIA2300-LmGGPS1.

Containing above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1the host cell of complete coding reading frame sequence, as the host cell containing above-mentioned recombinant vectors also belongs to protection scope of the present invention.

Described host cell is selected from Bacillus coli cells, agrobatcerium cell or tobacco cell.

The invention provides a kind of engineering bacteria containing LmGGPS1 gene.

Above-mentioned matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1application comprise the application of albumen in plant of this genes encoding; With described recombinant vectors, as plant expression vector maize transformation cell; Or by the described Agrobacterium and corn, soybean, Sunflower Receptacle, potato, cotton, millet, barley and the co-culture of cells such as flowers and vegetables that contain this gene, obtain genetically modified regeneration plant; Or obtain above-mentioned species transfer-gen plant with described LmGGPS1 genetic transformation.

Technical scheme of the present invention is specifically summarized as follows:

Cloning process of the present invention is made up of following step:

Total serum IgE is extracted, according to matrimony vine yak base geranylpyrophosphate synthase gene in transcript profile Unigene sequence from the fresh blade of matrimony vine lmGGPS1nucleotide sequence design upstream primer LmGGPS1-F1:5 ' TAGGTGGCGGGAACGAAGAT-3 ', then 3 ' RACE method is utilized to expand acquisition 3 ' end sequence, design degenerate primer LmGGPS1-F2:5 ' ATGAGATCTATGAAYSTTGTYGATTCATGGG and GGPS1-R:5 '-TCCCATAAGTTTCGGATACG-3 ', pcr amplification obtains 5 ' end sequence of this gene, splices above-mentioned obtained three sections lmGGPS1gene order, the full length sequence of splicing is 1224bp.Design primer GGPS1-F3:5 '-ATGAGATCTATGAATGTTGTTGATTC-3 '; GGPS1-R-FULL:5 '-CAAGATTCAAATCACAAGCCTG-3 '; Pcr amplification obtains gGPS1full length sequence.

The present invention builds the coli expression carrier pET28a-LmGGPS1 and plant expression vector pCAMBIA2300-LmGGPS1 that contain yak base geranylpyrophosphate synthase gene LmGGPS1, is made up of following step:

1) the intermediate carrier pMD19-T-LmGGPS1 containing yak base geranylpyrophosphate synthase gene is built.

Take GGPS1-F3/GGPS1-R-FULL as primer, with matrimony vine cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD19-T carrier, obtain the intermediate carrier pMD19-T-LmGGPS1 containing the LmGGPS1 gene shown in SEQ ID NO.1.

2) coli expression carrier pET28a-LmGGPS1 is built

Take GGPS1-F3/GGPS1-R-FULL as primer, with matrimony vine cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD19-T carrier, and be transformed in competence intestinal bacteria TOP10, after bacterium colony PCR verifies, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pET28a empty carrier BamHI and SalI double digestion, connect after purifying respectively, obtain coli expression carrier pET28a-LmGGPS1.

3) plant expression vector pCAMBIA2300-LmGGPS1 is built

Take GGPS1-F3/GGPS1-R-FULL as primer, with matrimony vine cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD19-T carrier, and be transformed in competence intestinal bacteria TOP10, after bacterium colony PCR verifies, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pCAMBIA2300-35S-OCS empty carrier BamHI and SalI double digestion, connect after purifying respectively, obtain plant expression vector pCAMBIA2300-LmGGPS1.

The invention provides a kind of matrimony vine for improving stress resistance of plant gGPS1the recombinant vectors of gene and this gene, isolates the global cDNA of coding yak base geranylpyrophosphate synthase gene first, is connected on coli expression carrier, utilizes the expressing protein of heterogenous expression system verification matrimony vine LmGGPS1 gene from matrimony vine; Then be connected on plant expression vector, utilize Agrobacterium infestation method transformation of tobacco, obtain transfer-gen plant, show that the carotenoid content of transfer-gen plant increases by research, namely the present invention has widespread use in enhancing Carotenoid in Plants content etc.

Matrimony vine yak base geranylpyrophosphate synthase gene of the present invention lmgGPS1 is expected for the preparation of transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and flowers and vegetable plant strain.

Accompanying drawing explanation

Fig. 1. be 3 ' RACEPCR electrophorogram.

Fig. 2. be the electrophorogram of 5 ' end PCR primer.

Fig. 3. be LmGGPS1 total length pcr amplification electrophorogram.

Fig. 4. be pMD19-T-LmGGPS1 carrier schematic diagram.

Fig. 5. be pET-28a-LmGGPS1 carrier schematic diagram.

Fig. 6. be pCAMBIA2300-LmGGPS1 carrier schematic diagram.

Fig. 7. be transgene tobacco Genomic PCR.

Fig. 8. be transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, millet, wheat, barley, cotton gene group PCR.

Fig. 9. be transgenosis Chinese rose, Lisianthus, An Zuhua, butterfly orchid Genomic PCR.

Figure 10. be transgenic poplar, fragrant flower Chinese scholar tree Genomic PCR.

Embodiment

The experimental technique of unreceipted actual conditions in embodiment, usually conveniently condition and the condition described in handbook, or according to the condition that manufacturer advises.

Embodiment 1

The clone of yak base geranylpyrophosphate synthase gene LmGGPS1 in matrimony vine

gGPS13 ' end clone:

Utilize Trizol reagent, totalRNA is extracted from the fresh matrimony vine blade of 100mg, according to the Unigene sequences Design upstream primer of transcript profile, in matrimony vine, the upstream primer of yak base geranylpyrophosphate synthase gene LmGGPS1 is LmGGPS1-F1:5 ' TAGGTGGCGGGAACGAAGAT-3 ', 3 ' FULLRACECoreSetVer.2.0 (TaKaRa, Japan) test kit amplification is utilized to obtain complete gene order.Concrete steps: be 1. template with totalRNA, utilize 3 ' RACEAdaptor primer to carry out reverse transcription reaction, synthesis 1stStrandcDNA, reaction system is as follows:

RNA	2μL.
		3‘ RACE Adaptor	1μL
5×M-MLV Buffer	2μL
		dNTP Mixture	1μL
Rnase Inhibitor	0.25μL
		Reverse Transcriptase M- MLV	0.25μL
Rnase Free ddH 2O	3.5μL

Reaction conditions: 42 DEG C, 60min; 70 DEG C, 15min.

According to downstream primer 3 ' the RACEoutprimer:5 '-TACCGTCGTTCCACTAGTGATTT-3 ' that upstream primer and the test kit of gene provide, be template with 1stStrandcDNA, carry out PCR reaction, reaction system is as follows:

1 st Strand cDNA	1μL
		LmGGPS1 upstream primer	1μL
3’RACE out primer	1μL
		2.5mM dNTP Mixture	2μL
10×LA Taq PCR buffer	2.5μL
		TaKaRa LA Taq archaeal dna polymerase	0.25μL
ddH 2O	17.25μL
		Total volume	25μL

Configuration 4 tube reaction liquid altogether, reaction conditions is as follows: 94 DEG C, 4min; 94 DEG C, 30Sec; 52 DEG C, 30Sec; 72 DEG C, lmin10Sec; 72 DEG C, 10min; 34 circulations.Reaction product, by 1% agarose gel electrophoresis detection validation, as Fig. 1, utilizes Tian Gen company sepharose DNA to reclaim test kit and reclaims the object fragment in PCR reaction product, operate according to test kit specification sheets after checking.

gGPS15 ' end clone

Design degenerate primer LmGGPS1-F2:5 ' ATGAGATCTATGAAYSTTGTYGATTCATGGG and GGPS1-R:5 '-TCCCATAAGTTTCGGATACG-3 ', take 1stStrandcDNA as template, pcr amplification obtains 5 ' end sequence of this gene, and reaction system is as follows:

1 st Strand cDNA	1μL
		LmGGPS1-F2	1μL
GGPS1-R	1μL
		2.5mM dNTP Mixture	2μL
10×LA Taq PCR buffer	2.5μL
		TaKaRa LA Taq archaeal dna polymerase	0.25μL
ddH 2O	17.25μL
		Total volume	25μL

Configuration 4 tube reaction liquid altogether, reaction conditions is as follows: 94 DEG C, 4min; 94 DEG C, 30Sec; 55 DEG C, 30Sec; 72 DEG C, lmin; 72 DEG C, 10min; 34 circulations.As Fig. 2, as aforesaid method reclaims object fragment.

gGPS1full length sequence increases

According to gGPS1gene 3 ' end sequence, 5 ' end sequence design primer GGPS1-F3:5 '-ATGAGATCTATGAATGTTGTTGATTC-3 '; GGPS1-R-FULL:5 '-CAAGATTCAAATCACAAGCCTG-3 '; Pcr amplification obtains gGPS1full length sequence is 1224bp, as Fig. 3.

Embodiment 2

The building process of cloning vector pMD19-T-LmGGPS1

Be connected with pMD19-T carrier by LmGGPS1 gene shown in sequence table, reaction system is as follows:

LmGGPS1 total length reclaims product	4μL
		PMD19-T carrier	1μL
SolutionI	5μL

LmGGPS1PCR fragment is recovery in embodiment 1 gGPS1full length product.

Reaction conditions: 16 DEG C, 30min.Connect product conversion competence E-Coli.TOP10, the LB Agar Plating being coated on IPTG, the 100mg/LAmp of X-Gal, the 16ml50mg/ml containing 40ml25mg/ml is cultivated, forms single bacterium colony.Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, we obtain this gene base sequence of 1074bp, carry out blast at NCBI, high with Solanaceae homology, be indicated as this gene clone success.

Embodiment 3

The building process of coli expression carrier pET28a-LmGGPS1

The intestinal bacteria containing pMD19-T-LmGGPS1 plasmid obtained in enlarged culturing experimental example 2, extract plasmid, with this plasmid of BamHI and SalI double digestion, by pET28a empty carrier BamHI and SalI double digestion, connect after purifying respectively, obtain coli expression carrier pET28a-LmGGPS1, the digestion products of the two is connected.

Linked system is as follows:

PET28a empty carrier fragment	2μL
		PMD19-T-LmGGPS1 endonuclease bamhi	5μL
5×T4 DNA ligase buffer	2μL
		T4 DNA ligase	1μL

Connect product conversion competence e. coli bl21.Coat on the LB flat board containing 100mg/Lkana resistance, 37 DEG C of cultivations.After 12h, picking list bacterium colony carries out bacterium colony PCR checking, and bacterium colony PCR is verified positive bacterium, and shake bacterium and extract plasmid, enzyme is cut qualification and obtained object band, finally send Hua Da gene sequencing company to check order, and it is correct that result shows that carrier pET28a-LmGGPS1 builds.

Embodiment 4

The structure of binary plant expression vector pCAMBIA2300-LmGGPS1

The intestinal bacteria containing pMD19-T-LmGGPS1 plasmid obtained in enlarged culturing experimental example 2, extract plasmid, with this plasmid of BamHI and SalI double digestion, pCAMBIA2300 empty carrier plasmid is also used BamHI and SalI double digestion, connected by the digestion products of the two, linked system is as follows:

PCAMBIA2300 empty carrier fragment	2μL
		PMD19-T-LmGGPS1 endonuclease bamhi	5μL
5×T4 DNA ligase buffer	2μL
		T4 DNA ligase	1μL

Connect product conversion E-Coli.DH5 α, coat on the LB flat board containing 100mg/L concentration kana resistance.37 DEG C of cultivations, after 12h, picking list bacterium colony carries out bacterium colony PCR checking, and bacterium colony PCR is verified positive bacterium, and shake bacterium and extract plasmid, enzyme is cut qualification and obtained object band.

Embodiment 5

For the structure of the Agrobacterium engineering strain C58:pCAMBIA2300-LmGGPS1 of plant transgene.

Prepared by Agrobacterium competent cell

1. by mono-for Agrobacterium C58 colony inoculation in 5mLYEP liquid nutrient medium, 28 DEG C, 180r/min shaking culture.

2. proceed in l00mLYEP liquid nutrient medium by above-mentioned bacterium liquid, 28 DEG C, 180r/min, shaking culture is to (OD ₆₀₀value is about 0.5).

3., after ice bath 30min, 4 DEG C, the centrifugal l0min of 4000r/min, collects thalline, is resuspended in the H of 20mL precooling ₂in O.

4.4 DEG C, the centrifugal 10min of 4000r/min, collect thalline, be resuspended in 10% glycerine of precooling, often pipe 200 μ L quick-frozen, be stored in-80 DEG C for subsequent use.

Plant expression vector electroporated

1. the C58 competent cell that-80 DEG C are taken out is placed on ice, makes it slowly melt;

2. add 4 μ L plasmids, mixing, ice bath 5min;

3. be transferred in electric shock cup;

4. electroporated instrument parameter is set: 1500V, 0.2s, electroporated;

5. room temperature adds 500 μ LYEB liquid nutrient mediums after leaving standstill 2min, 28 DEG C, 180r/min shaking culture 3h;

6. the centrifugal 10min of room temperature 4000r/min, sucking-off 400 μ L supernatant liquor, by the mixing of remaining bacterium liquid, coat on the YEB flat board containing 100mg/L kantlex and 100mg/L rifampicin resistance, be inverted dull and stereotyped, 28 DEG C of cultivations, 48h, until see single bacterium colony clearly.

7. picking list bacterium colony, bacterium colony PCR verifies.

Embodiment 6

Agriculture bacillus mediated tobacco genetic transformation

The sterile culture of tobacco seedling: select full, healthy tobacco seed, with 75% alcohol immersion lmin, peace tiformin (available chlorine 2.5%) aqueous solution sterilizing 8min of 25%, rinsed with sterile water three times, be placed on by seed in MS substratum, 25 DEG C of light are cultivated, the 16h/8h photoperiod.

The substratum that this experiment is used is as shown in the table

The Agrobacterium-mediated Transformation of tobacco

Infect the preparation of bacterium liquid

1. the single bacterium colony of the positive Agrobacterium of picking, is inoculated into 5ml containing in the YEP liquid nutrient medium of 100mg/L kantlex, in 28 DEG C, the shaker overnight of 200r/min cultivates.

2. next day, get 3ml bacterium liquid, be inoculated in the 50mlYEP liquid nutrient medium containing 100mg/L kantlex, when bacterium liquid is in vigorous period (OD ₆₀₀=0.6-0.9) time, pour bacterium liquid into 50ml centrifuge tube, at 3500r/min, at 4 DEG C, centrifugal 10min, abandons supernatant liquor, collects thalline.Resuspended with the MS liquid nutrient medium of equivalent, make OD ₆₀₀=0.9-1.

Explant is contaminated

1. tobacco leaf is removed master pulse and limb edge, then blade is cut into 0.5cm × 0.5cm size, immerse the Agrobacterium bacterium liquid prepared, soak 15-20min, shake 2-3 time therebetween, make blade fully contact bacterium liquid, take out blade, the bacterium liquid exhausting unnecessary with aseptic filter paper, blade face down, blade back is inoculated in common training substratum upward, about 25 DEG C light culture 2 days.

2. be transferred in screening culture medium by blade, within about 20 days, change a subculture, induction of resistance bud produces, and when resistant buds grows to about 1cm from callus, cuts resistant buds from callus, is inoculated in resistance seedling rooting substratum.

Transgenic seedling is transplanted

The tobacco tissue cultured seedling that root growth is good, vitality is vigorous takes out from tissue culture bottle, with tap water substratum (reducing root system damage) as far as possible, be planted in frog stone and compost humous, coating film heat and moisture preserving 15 days, then film is opened, regularly water, apply fertilizer, make it normal growth in greenhouse.

Embodiment 7

The mensuration of transgene tobacco Molecular Detection and carotene carotene content

The PCR of transgene tobacco genomic dna detects: 1.CTAB method extracts tobacco STb gene; 2. be that template performing PCR detects with genomic dna, primer is GGPS1-F3 and GGPS1-R-FULL, reaction conditions:: 94 DEG C, 4min; 94 DEG C, 30Sec; 54 DEG C, 30Sec; 72 DEG C, lmin10Sec; 72 DEG C, 10min; 30 circulations.Get above-mentioned PCR primer 5 μ l and carry out electrophoresis detection, as Fig. 7, explanation lmGGPS1gene successfully proceeds to tobacco.

Extract the carotenoid of transgene tobacco, measure transgene tobacco carotenoid content apparently higher than wild-type tobacco by HPLC, illustrate that this gene has vital role at raising carotenoid content.For transgene tobacco Genomic PCR.

Same experiment is carried out with reference to above-mentioned condition:

Embodiment 8

This laboratory by vegetative point infestation method to the crop maturity embryo transgenosiss such as corn, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton ( lmGGPS1) obtain transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton plants, Genomic PCR electrophorogram, as Fig. 8, B: negative control, 1-9 are followed successively by the Genomic PCR of corn, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton.

At greenhouse normal growth, transgenic seedlings and wild type control seedling, extract Lyeopene and carotenoid respectively, and HPLC measures transgenosis group seedling Lyeopene and carotenoid content apparently higher than wild-type group.Moreover, transgenosis group growth of seedling is thick and strong, and wild type growth is relatively slow, and biomass is relatively less.

Embodiment 9

This laboratory utilizes Agrobacterium infestation method to carry out transgenosis (LmGGPS) to flowers such as Chinese rose, Lisianthus, An Zuhua, butterfly orchides, obtain transgenosis Chinese rose, Lisianthus, An Zuhua, Phalaenopsis plants, Genomic PCR electrophorogram, as Fig. 9, the Genomic PCR that B: negative control, 1-6 are followed successively by Chinese rose from left to right, Lisianthus, peace ancestral spend a, peace ancestral spends b, butterfly orchid a and butterfly orchid b.More thick and strong than wild type growth at the Transgenic flower seedling of greenhouse normal growth, pattern is bright-coloured, and petal carotenoid content increases.

Embodiment 10

This laboratory utilizes Agrobacterium infestation method to carry out transgenosis (LmGGPS) to arbor trees such as willows, and obtain transgenic poplar plant, Genomic PCR electrophorogram, as Figure 10., B: negative control, 1-2 are willow Genomic PCR.

At transgenosis sapling and the wild type control seedling of greenhouse normal growth, it is good that transfer-gen plant grows than WT lines, transfer-gen plant Lyeopene and carotenoid content is more obvious than WT lines increases.

Experimental example 11

At transgene tobacco seedling and the wild type control seedling of greenhouse normal growth, water the water of the NaCI containing 300mmol/L and 500mmol/L concentration respectively, in greenhouse, keep the humidity of 85%.Detect and find, under the growth conditions of 300mmol/LNaCI, WT lines growth phase is to slowly.And transgenosis sapling can normal growth.Under the condition of the NaCI of 500mmol/L concentration, after growing one week, wild-type seedling leaf turns to be yellow, and wilt, tissue necrosis, can not normal growth.Although the growth of transgene tobacco seedling is also by suppression to a certain extent, obvious unlike wild type seedlings, substantially can normal growth.

Sequence table

<110> University Of Tianjin

<120> is for improving the matrimony vine of stress resistance of plant gGPS1the recombinant vectors of gene and this gene

<130>20131024

<160>2

<170>PatentInversion3.3

<210>1

<211>1224

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(1224)

<400>1

atgagatctatgaatgttgttgattcatgggctcaagcttgtttagttttcaatcaaacc60

ttaccttataaatccttcaataatggattcatgaaaatccctctcagaaatcccaaaatc120

aaaccccaaacaagacccataagcatttcagctatagctaccaaagaagatgaaaaagtt180

gttaccgagcagttcaatttcaaactgtacgtagcagaaaaggctattcttgtaaacaaa240

gcattagatgaggctattataataaaagacccacctgttatccacgaatcaatgcgttac300

tcccttctcgccggcggtaaacgtgtccggccaatgctttgcctcgccgccgccgaactc360

gtcggcggcgaccagcgcgccgccgtgccggcagcttgcgccgtcgagatgatacatacg420

atgtcgttaattcatgatgatttgccttgtatggataatgatgatctccgtcgtggaaaa480

ccgacgaatcataaagtgtacggtgaggatgtggcggtgcttgctggagattcgttactt540

gcgtttgcgtttgagtatcttgctacggcgacgacgggagtttcgccggcgaggatagtt600

gctgccgttgctgaattggcgaaatctattggaattgaagggttagtagctggacaagtg660

gcggatatagcttgtacaggtaatccgaatgtgggattagacacgcttgaattcatccac720

acacacaaaacagcagcattactagaagcttcagtagtactaggagcaatcctaggtggc780

gggaacgaagatgacgtggacaagttaaggagatttgctagatgtattggactattattt840

caagtagttgatgatatacttgacgttacaaagtcatctgaagagctaggaaaaactgct900

ggaaaagatttggcagtggataaaacgacgtatccgaaacttatgggattagaaaaggct960

aaggaatttgcggcagagcttaacagggaagctaaagaacagttggttgaatttgatcca1020

cataaagctgctcctttgattgctttggctgattacattgctcatcgtgaaaattaggtg1080

ggggggaagattatttgtaatactttatttttcaggcttgtgatttgaatcttgatttaa1140

caagtgaaaatgaaaggtgatttgttacttaaccaatttctattgttagaaattggatgt1200

taaaaaaaaaaaaaaaaaaaaaaa1224

<210>2

<211>358

<212>PRT

<213>MUTAGEN

<220>

<221>MUTAGEN

<222>(1)..(358)

<400>2

MetArgSerMetAsnValValAspSerTrpAlaGlnAlaCysLeuVal

151015

PheAsnGlnThrLeuProTyrLysSerPheAsnAsnGlyPheMetLys

202530

IleProLeuArgAsnProLysIleLysProGlnThrArgProIleSer

354045

IleSerAlaIleAlaThrLysGluAspGluLysValValThrGluGln

505560

PheAsnPheLysLeuTyrValAlaGluLysAlaIleLeuValAsnLys

65707580

AlaLeuAspGluAlaIleIleIleLysAspProProValIleHisGlu

859095

SerMetArgTyrSerLeuLeuAlaGlyGlyLysArgValArgProMet

100105110

LeuCysLeuAlaAlaAlaGluLeuValGlyGlyAspGlnArgAlaAla

115120125

ValProAlaAlaCysAlaValGluMetIleHisThrMetSerLeuIle

130135140

HisAspAspLeuProCysMetAspAsnAspAspLeuArgArgGlyLys

145150155160

ProThrAsnHisLysValTyrGlyGluAspValAlaValLeuAlaGly

165170175

AspSerLeuLeuAlaPheAlaPheGluTyrLeuAlaThrAlaThrThr

180185190

GlyValSerProAlaArgIleValAlaAlaValAlaGluLeuAlaLys

195200205

SerIleGlyIleGluGlyLeuValAlaGlyGlnValAlaAspIleAla

210215220

CysThrGlyAsnProAsnValGlyLeuAspThrLeuGluPheIleHis

225230235240

ThrHisLysThrAlaAlaLeuLeuGluAlaSerValValLeuGlyAla

245250255

IleLeuGlyGlyGlyAsnGluAspAspValAspLysLeuArgArgPhe

260265270

AlaArgCysIleGlyLeuLeuPheGlnValValAspAspIleLeuAsp

275280285

ValThrLysSerSerGluGluLeuGlyLysThrAlaGlyLysAspLeu

290295300

AlaValAspLysThrThrTyrProLysLeuMetGlyLeuGluLysAla

305310315320

LysGluPheAlaAlaGluLeuAsnArgGluAlaLysGluGlnLeuVal

325330335

GluPheAspProHisLysAlaAlaProLeuIleAlaLeuAlaAspTyr

340345350

IleAlaHisArgGluAsn

355

Claims (6)

1. a matrimony vine yak base geranylpyrophosphate synthase gene lmGGPS1, it is characterized in that this gene is for the nucleotide sequence shown in SEQIDNO.1.

2. the protein of matrimony vine yak base geranylpyrophosphate synthase gene coding according to claim 1, is characterized in that described protein is for the aminoacid sequence shown in SEQIDNO.2.

3. a recombinant vectors, is characterized in that the complete sequence containing matrimony vine yak base geranylpyrophosphate synthase gene according to claim 1.

4. a recombinant vectors according to claim 3, is characterized in that it is coli expression carrier pET28a-LmGGPS1.

5. a recombinant vectors according to claim 3, is characterized in that it is recombinant plant expression vector pCAMBIA2300-LmGGPS1.

6. a yak base geranylpyrophosphate synthase gene according to claim 1 is applied to and prepares transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and flowers and vegetable plant strain.