CN103740716B - Constitutive promoter and uses thereof - Google Patents
Constitutive promoter and uses thereof Download PDFInfo
- Publication number
- CN103740716B CN103740716B CN201310725967.1A CN201310725967A CN103740716B CN 103740716 B CN103740716 B CN 103740716B CN 201310725967 A CN201310725967 A CN 201310725967A CN 103740716 B CN103740716 B CN 103740716B
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- plant
- sequence
- heterologous nucleotide
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of constitutive promoter and uses thereof, does the nucleotide sequence of constitutive promoter comprise the sequence of following (a) or (b): (a) has SEQ? ID? nucleotide sequence shown in NO:1; The nucleotide sequence of b nucleotide sequence hybridization that () limits with (a) under strict conditions.Constitutive promoter of the present invention almost in the great majority tissue and many cell types of plant ubiquity active and improve the expression amount of object heterologous nucleotide sequence in plant tissue significantly, particularly in blade and stem.
Description
Technical field
The present invention relates to a kind of constitutive promoter and uses thereof, paddy rice ubiquitin gene promotor particularly relating to a kind of composing type and uses thereof.
Background technology
The major progress of cytobiology and transgenic technology makes foreign gene be merged in many crops.Foreign gene is transferred in plant and is mainly expressing protein, and described plant is called as " transgenic plant ", and described albumen will give useful proterties, as opposing pathogenic micro-organism or insect, antiweed, drought-enduring or other hostile environment.Usually, the DNA encoding joint area of foreign gene in a powerful and DNA promoter region for composing type to guarantee foreign gene effective expression in transgenic cell.
Promotor common is in a large number used to the expression driving foreign gene in transgenic plant.Cauliflower mosaic virus (CaMV) 35S promoter is widely used in dicotyledonous and monocotyledons, but its efficiency in monocotyledons is significantly lower than its efficiency in dicotyledons.CaMV35S is non-activity, such as pollen in some cell type even.
Ubiquitin (Ubiquitin, being called for short UBQ or Ubi) gene promoter all demonstrates obvious higher gene expression dose as constitutive promoter in the great majority tissue and many cell types of plant, particularly there is in monocotyledons higher activity, as being separated the expression that more effectively can drive reporter gene CAT from the ubiquitin promoter Ubi1 of Maize polyubiquitin genes in Corn Protoplast than CaMV35S promotor; Meanwhile, ubiquitin gene promotor also demonstrates preferential activity in tender tissue, as vascular tissue and pollen granule.At present, the ubiquitin gene promotor of plant origin is mainly separated from corn, Sunflower Receptacle, tobacco, potato, sugarcane, Arabidopis thaliana and soybean, and the ubiquitin gene promotor in paddy rice rarely has report.In addition, in same transgenic plant, multiple genetically modified superposition needs promotors different in a large number, otherwise the gene silencing of homology dependence will occur, and this phenomenon is of common occurrence in the transgenic plant with the same promotor of multiple copied.Therefore need the ubiquitin gene promotor developing different sources, enable heterologous nucleotide sequence high expression in plant tissue.
Summary of the invention
The object of this invention is to provide a kind of constitutive promoter and uses thereof, namely new separation, from the Ubi gene promoter of paddy rice (Oryzasativa), enables heterologous nucleotide sequence high expression in plant tissue.
For achieving the above object, the invention provides a kind of constitutive promoter, its nucleotide sequence comprises the sequence of following (a) or (b):
A () has the nucleotide sequence shown in SEQIDNO:1; Or
The nucleotide sequence of b nucleotide sequence hybridization that () limits with (a) under strict conditions.
Above-mentioned stringent condition can be at 6 × SSC(Trisodium Citrate), 0.5%SDS(sodium lauryl sulphate) in solution, hybridize at temperature 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.
For achieving the above object, present invention also offers a kind of mosaic gene comprising the described constitutive promoter be operably connected with object heterologous nucleotide sequence.
Further, described object heterologous nucleotide sequence coding target protein matter.
For achieving the above object, present invention also offers a kind of expression cassette comprising described mosaic gene.
For achieving the above object, present invention also offers a kind of recombinant vectors comprising described expression cassette.
For achieving the above object, present invention also offers a kind of method expressing object heterologous nucleotide sequence in plant, comprising: by stable being integrated in vegetable cell of object heterologous nucleotide sequence be operably connected with described constitutive promoter.
Further, described plant is corn, soybean, cotton, paddy rice or wheat.
Preferably, the expression of described object heterologous nucleotide sequence composing type in plant tissue.
Further, described object heterologous nucleotide sequence coding target protein matter.
Preferably, described object heterologous nucleotide sequence encodes herbicide resistant protein matter.
Described object heterologous nucleotide sequence coding insect resistance proteins matter.
For achieving the above object, present invention also offers the purposes of a kind of described constitutive promoter for the expression object heterologous nucleotide sequence of composing type in plant tissue.
Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.
Further, described object heterologous nucleotide sequence coding target protein matter.
In the present invention, term " promotor " refers to DNA regulatory region, usually starts the TATA box of RNA synthesis containing the applicable transcription initiation site that rna plymerase ii can be guided in specific coding sequence.Promotor can in addition containing other recognition sequence, and be generally positioned at upstream or the 5 ' end of TATA box, be called upstream promoter element, they affect transcription initiation rate.Admittedly, because promoter region nucleotide sequence of the present invention is own through determining, in 5 ' non-translational region of the concrete promoter region upstream of the present invention, separation andpreconcentration regulatory element belongs to prior art further.Therefore, promoter region of the present invention comprises upstream regulatory elements further, its gives the expression of any heterologous nucleotide sequence composing type be operably connected with promoter sequence of the present invention, namely plant substantially can both express with all growth and development stages in a organized way.
In the present invention, term " gene " to refer under suitable regulation and control region (such as plant expressible promoter region) controls in cell containing any DNA fragmentation in region of DNA territory (" the region of DNA territory of transcribing ") being transcribed into RNA molecule (such as mRNA).Therefore, the DNA fragmentation that gene may connect containing several operability, such as promotor, 5 ' untranslated leader, coding region and 3 ' the untranslated region containing polyadenylation site.Endogenous plant gene is the gene of natural discovery in plant species.Mosaic gene is any gene usually do not found in plant species, or under its natural environment its promotor and the region of DNA territory of partly or entirely transcribing or with this gene at least another regulate and control any gene that region has nothing to do.
In the present invention, term " constitutive promoter " refers under the control of such promotor, and the expression somewhat constant of object heterologous nucleotide sequence, on certain level, does not have notable difference at the different tissues of plant and/or different growth and development stage expression level.It is described that to be organized as origin source in plant materials identical and perform the structure unit of one or more cell type set of same function; such as protective tissue, transfusion tissue, nutritive issue, mechanical tissue, meristematic tissue; severally different organize organic cooperation, be closely connected; form different organs (organ); work in coordination between different organs, more effectively complete organic whole vital movement process.Described growth and development stage can be divided into embryo stage, plantlet stage, stage of maturity and ageing phase according to the difference of phytomorph, function.In the present invention, term " expression of composing type " refers to that object heterologous nucleotide sequence is all expressed with level consistent substantially at the different tissues of plant and/or different growth and development stage.
Those skilled in the art easily can identify according to identical object and utilize promotor functionally of equal value.Have in essence to containing the nucleotide sequence shown in SEQIDNO:1 of the present invention or the DNA sequence dna with the similar promoter activity of the paddy rice Ubi gene promoter of nucleotide sequence of promoter activity part, be the function equivalent of these promotors.These function equivalence promotors can be hybridized with the paddy rice Ubi gene promoter region containing above-mentioned nucleotide sequence under strict conditions.
In hybridization technique, oneself knows that all or part of of nucleotide sequence is used as probe, optionally hybridizes with from other the corresponding nucleotide sequence existed in the cloned genomic DNA fragments of selected organism or cDNA fragment (as genomic library or cDNA library) colony.Hybridization probe can be genomic DNA fragment, cDNA fragment, RNA fragment or other oligonucleotide, can by detectable group as 32P or other any detectable marker substance markers.Therefore, such as, hybridization probe can be prepared by mark according to the synthetic oligonucleotide of sequence of the present invention.The method preparing hybridization probe and construction cDNA and genomic library be this area oneself know and be disclosed in the people such as Sambrook (1989) molecular cloning: the laboratory manual (second edition, ColdSpringHarborLaboratoryPress, Plainview, NewYork).
The hybridization of sequence can be carried out under strict conditions.Described " stringent condition " refers to that probe will be hybridized extremely detectable degree with its target sequence and be exceeded the condition with other sequence hybridization (as at least 2 times to background).Stringent condition has sequence dependent, and different because of the difference of environment.By controlling the severity of hybridization and/or wash conditions, can identify and the target sequence of probe 100% complementation (homology detects).Selectively, stringent condition can be regulated to allow some sequence mismatch, make to detect the similarity (allos detection) compared with low degree.Usually, probe length is shorter than about 1000 Nucleotide, is preferably shorter than 500 Nucleotide.
Typically, stringent condition is lower than about 1.5MNa ion pH7.0 to 8.3 time salt concn, typically about 0.01 to 1.0MNa ionic concn (or other salt), temperature at least about 30 DEG C of short probe (as 10 to 50 Nucleotide), at least about 60 DEG C of long probe (as more than 50 Nucleotide).Also stringent condition can be obtained by adding destabilizing agent such as methane amide.Low stringency conditions, such as, is included in 30-35% methane amide, 1MNaCl, 1%SDS(sodium laurylsulfonate) buffered soln in 37 DEG C of hybridization, 1 × to 2 × SSC(20 × SSC=3.0MNaCl/0.3M trisodium citrate) in 50-55 DEG C of washing.Moderate stringency, such as, is included in 37 DEG C of hybridization in the buffered soln of 40-45% methane amide, 1.0MNaCl, 1%SDS, 0.5 × and to 55-60 in 1 × SSC DEG C of washing.High stringency, such as, is included in 37 DEG C of hybridization in the buffered soln of 50% methane amide, 1MNaCl, 1%SDS, 60-65 DEG C of washing in 0.1 × SSC.Optionally, lavation buffer solution can containing the SDS of about 0.1% to 1%.Hybridization time is generally less than about 24 hours, about 4 to 12 hours usually.
The function of special post-hybridization washing typically, key factor is ionic strength and the temperature of final washing soln.For DNA-DNA crossbred, T
mcan from Meinkoth and Wahl(1984) equation estimation of Anal.Biochem.138:267-284: T
m=81.5 DEG C of+16.6(logM)+0.41(%GC)-0.61(%form)-500/L; Wherein M is the volumetric molar concentration of univalent cation, and %GC is guanylic acid and the per-cent of cytidylic acid(CMP) in DNA, and %form is the per-cent of methane amide in hybridization solution, and L is the length of crossbred in base pair.T
m50% complementary target sequence and match the temperature (under the ionic strength specified and pH) of probe hybridization completely.The mispairing of every 1% needs T
mreduce about 1 DEG C; Therefore, T
mhybridization and/or wash conditions can be conditioned with the sequence hybridization with required identity.Such as, if the sequence sought has>=the identity of 90%, T
m10 DEG C can be reduced.Usually, the stringent condition of selection is the thermal melting point (T lower than particular sequence
m) about 5 DEG C, and it is complementary under the ionic strength specified and pH.But high stringency can be applied lower than thermal melting point (T
m) hybridization of 1,2,3 or 4 DEG C and/or washing; Moderate stringency can be applied lower than thermal melting point (T
m) hybridization of 6,7,8,9 or 10 DEG C and/or washing; Low stringency conditions can be applied lower than thermal melting point (T
m) hybridization of 11,12,13,14,15 or 20 DEG C and/or washing.Apply this equation, hybridization and cleaning composition and required T
m, the condition that those of ordinary skill in the art can understand hybridization and/or washing soln changes with the change of Stringency.If required extent of mismatch makes T
mlower than 45 DEG C (aqueous solution) or 32 DEG C (formamide soln), preferably increase SSC concentration so that higher temperature can be used.The guide of nucleic acid hybridization sees Tijssen(1993) biological chemistry and Molecular Biology Lab's technology-use nucleic acid probe hybridization, part i, the 2nd chapter (Elsevier, NewYork); (1995) Current Protocols method the 2nd chapter (GreenePublishingandWiley-Interscience, NewYork) is edited with people such as Ausubel.See the people such as Sambrook (1989) molecular cloning: laboratory manual (second edition, ColdSpringHarborLaboratoryPress, Plainview, NewYork).
Therefore, there is promoter activity and the separation sequence of hybridizing with promoter sequence of the present invention or its fragment under strict conditions comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology.Namely the scope of sequence iden is distributed at least approximately 40%-50%, about 60%, 65% or 70% homology, even at least about sequence iden of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger.
Other function equivalence promotor contains such nucleotide sequence, can with containing the nucleotide sequence shown in SEQIDNO:1 at least about 25, preferably at least about 50, particularly at least about the nucleotide sequence that the Oligonucleolide primers of 100 continuous nucleotides increases in polymerase chain reaction.
Can also build Artificial promoters, it comprises the internal sequence of the expression of the composing type of the decision promotor in 5 ' regulation and control region of the nucleotide sequence shown in SEQIDNO:1.Described Artificial promoters may comprise " core promoter " or " TATA box region " of another promotor can expressed in plant, such as, CaMV35S " TATA box region " described in WO93/19188.The suitability of the promoter region containing described Artificial promoters can be identified in the detection of appropriate tissue, the suitably expression of etap by the suitable fusion of they and object heterologous nucleotide sequence and object heterologous nucleotide sequence.
Promoter sequence of the present invention and fragment thereof, when being assembled into DNA structure and making promoter sequence be operably connected with object heterologous nucleotide sequence, manipulate any plant for heredity.Described " being operably connected " to refer between promoter sequence of the present invention with second sequence functional is connected, and wherein promoter sequence starts and regulates transcribing of the DNA sequence dna that corresponds to second sequence.Usually, be operably connected and refer to that the nucleotide sequence be connected is continuous print, be adjacent to if desired in conjunction with two protein-coding regions, and in same reading frame.In this way, promotor nucleotide sequence and object heterologous nucleotide sequence form described mosaic gene in expression cassette together with provide, to express in object plant.This expression cassette provides a large amount of restriction site to insert object heterologous nucleotide sequence, and described object heterologous nucleotide sequence will be subject to the transcriptional regulatory of the regulatory region comprising promoter sequence of the present invention.Cotransformation can be entered the episome of organism by expression cassette in addition containing at least one.Selectively, episome can be provided on multiple expression cassette.
Expression cassette can contain selectable marker gene in addition.Usually, expression cassette will comprise the selected marker for selecting transformant.Described selected marker is for selecting the cell or tissue transformed.Described selected marker includes but not limited to, the gene (as encoding neomycin phosphotransferase II(NPT) of encode antibiotic resistance) and the gene of hygromix phosphotransferase (HPT), and the gene of conferring herbicide resistance is as Glufosinate ammonium, bromoxynil, imidazolone type and 2,4-dichlorphenoxyacetic acid ester (2,4-D).
Expression cassette comprises along 5 '-3 ' direction transcribe promoter sequence of the present invention, Translation initiator, object heterologous nucleotide sequence and transcribing and translation termination district of working in plant.Object heterologous nucleotide sequence can be natural or to plant host external source or allos.Selectively, object heterologous nucleotide sequence can be native sequences or selectivity synthesis sequence." external source " refer to import transcription initiation region natural phant in there is not described importing transcription initiation region.Such as, mosaic gene comprises promoter sequence of the present invention, and promoter sequence of the present invention is operationally connected with the encoding sequence being different from promoter sequence of the present invention.
Terminator can derive from promoter sequence of the present invention, also can derive from the object heterologous nucleotide sequence be operatively connected, maybe can derive from other source.Traditional terminator can obtain from the Ti-plasmids of soil Agrobacterium, as carnitine synthetic enzyme and rouge alkali synthetase (NOS) terminator.
In expression cassette preparation, different DNA fragmentations can be manipulated to provide the DNA sequence dna in suitable direction, and provide suitable reading frame when being applicable to.So, can apply and accept son or connexon in conjunction with DNA fragmentation, maybe can carry out other manipulation with the restriction site of providing convenience, remove unnecessary DNA, remove restriction site etc.For this purpose, vitro mutagenesis, primer reparation, restriction, annealing may be related to, replace again, as changed and conversion.
Under appropriate circumstances, object heterologous nucleotide sequence can be optimized to the expression amount that is increased in conversion of plant.Namely the codon synthetic gene of available plant optimization is to improve expression.
Well known in the art, other sequence modification can improve the gene expression dose in cell host.These include but not limited to, remove the tumor-necrosis factor glycoproteins that encoding spurious gathers adenosine signal, exon: intron splice site signal, transposon, and other fully symbolize the sequence that may be unfavorable for genetic expression.The G-C content of sequence can be adjusted to the mean level (ML) of specifying host cell, quotes the gene expression dose that in host cell, oneself knows and calculates.Possibly, modification sequence is to avoid the hairpin-type mRNA secondary structure predicted.
In expression cassette or recombinant vectors, expression cassette can contain 5 ' leader sequence in addition.Described leader sequence can play a part to improve transcriptional efficiency.Described leader sequence is known in the art, and includes but not limited to, picornavirus leader sequence, such as EMCV leader sequence (encephalomyocarditis 5 ' non-coding region); Potato virus group leader sequence, such as tobacco etch virus (TEV) leader sequence, the short and small mosaic virus of corn (MDMV) leader sequence and human immunoglobulin heavy chain's associated proteins (BiP); From alfalfa mosaic virus coating protein mRNA(AMVRNA4) untranslated leader; Tobacco mosaic virus (TMV) (TMV) leader sequence; With corn yellows mottle virus (MCMV) leader sequence.Other oneself element of improvement transcriptional efficiency of knowing, such as intron etc. can also be used.
Promoter sequence of the present invention can be used to start transcribing of the antisense construct complementary at least partly with the messenger RNA(mRNA) (mRNA) of object heterologous nucleotide sequence.Build antisense base sequences to hybridize with corresponding mRNA.Can hybridize with corresponding mRNA as long as antisense sequences grows to and disturb it to express, just can carry out the modification of antisense sequences.In this way, can use and have 70% with corresponding antisense sequences, preferred 80%, the antisense construct of preferred 85% sequence iden.In addition, a part for antisense base sequences can be used to the expression destroying target gene.Generally, the sequence of at least 50 Nucleotide, 100 Nucleotide, 200 Nucleotide or more Nucleotide can be used.
Promoter sequence of the present invention also can be used for the expression transcribing to suppress endogenous gene in plant of the nucleotide sequence starting just direction.The method that the nucleotides sequence applying just direction is listed in inhibition of gene expression in plant be this area oneself know.The method is usually directed to the DNA structure conversion of plant containing promotor, and promotor may be operably coupled to the nucleotide sequence that a few part is equivalent to endogenous gene transcription, and drives it to express in plant.Typically, the sequence of described nucleotide sequence and endogenous gene transcription has essence Shangdi sequence iden, preferably more than about 65% sequence iden, more preferably beyond about 85% sequence iden, most preferably more than about 95% sequence iden.
Promoter sequence of the present invention is used to the expression of the composing type of object heterologous nucleotide sequence.The sequence that " heterologous nucleotide sequence " exists with referring to non-natural together with promoter sequence.Although described nucleotide sequence and promoter sequence are allos, may be homology or natural or allos or external source to plant host.The heterologous nucleotide sequence codified target protein matter be operationally connected with promotor of the present invention.The example of this heterologous nucleotide sequence includes but not limited to, coding gives the nucleotide sequence of following resistant polypeptides: abiotic stress is as arid, temperature, salinity, ozone and weedicide, or biology stress as pathogen invasion, comprise insect, virus, bacterium, fungi and threadworms, and prevent the disease that these organisms are adjoint.
In the present invention, herbicide tolerance protein matter can express resistance to weedicide and/or tolerance.These genes include but not limited to, acetolactate synthase (ALS) gene, 5-enolpyruvyl thick grass acyl-3-phosphate synthase (EPSPS) gene, Glufosinate ammonium Transacetylase (PAT) gene, glyphosate oxidoreductase (GOX) gene, GAT gene etc.
In the present invention " insect-resistant " refer to plant avoid plant-insect interact caused by symptom and infringement.Namely the plant damage stoping insect to cause, farm crop infringement, plant disfigurement and plant disease, or selectively, the plant damage caused by insect, farm crop infringement, plant disfigurement and plant disease are reduced to minimum or alleviate.Described insect can belong to lepidopteran (as Pyrausta nubilalis (Hubern).), Hemiptera (as stinkbug), Coleoptera (as beetle), Orthoptera (as migratory locusts), Homoptera (as aphid), Diptera (as fly) etc.Well known in the art, object insect resistance proteins matter includes but not limited to, genus bacillus toxic protein; Pleurotus Ostreatus, wherein lectin comprises GNA, pisum sativum agglutinin, ConA, tritin, potato lectin, peanut agglutinin etc.; Lipid oxidation enzyme, wherein lipoxidase comprises pea lipoxidase 1 or soybean lipoxygenase; Insect chitinase etc.
The mode that virus is passed to health plant from the plant infected by different insect is different.Described virus includes but not limited to, rice tungro bacilliform virus, tobacco mosaic virus (TMV), the sallow short and small virus of sweet potato and sweet potato pinniform mottle virus etc.Therefore, the expression of composing type in plant tissue can be selected to have anti-pathogenic substance activity or make the minimized heterologous nucleotide sequence of the impact of viral pathogen.
Promoter sequence of the present invention and method can be used for the Expression modulation of any object heterologous nucleotide sequence in plant host, to change the phenotype of plant.Various object phenotype change includes but not limited to, changes the fatty acid component of plant, changes the aminoacids content of plant, changes plant pathogen defence mechanism etc.Above-mentioned change can by providing the expression of heterologous product or increasing the expression of plant endo product and obtain.Selectively, above-mentioned change can obtain, particularly enzyme or cofactor by reducing the expression of one or more endogenous product in plant.Above-mentioned change changes causing the phenotype of conversion of plant.
Transformation Protocol and the scheme that nucleotide sequence imported plant are different according to the directed plant that transforms or plant cell type, i.e. monocotyledons or dicotyledons.Nucleotide sequence imported vegetable cell and the appropriate methodology inserted in Plant Genome includes but not limited to subsequently, Agrobacterium-medialed transformation, trace launch bombardment, directly DNA taken in the DNA of protoplastis, electroporation or silicon whisker mediation and import.
The cell transformed can grow into plant in a conventional manner.These plants are cultivated, with identical transformant or the pollination of different transformants, and the certified phenotype feature needed for the crossbred obtained expression.Can cultivate two generations or many for the expression to ensure phenotype feature needed for stably maintenance and heredity, then results can ensure the seed obtaining required phenotype feature representation.
The invention provides a kind of constitutive promoter and uses thereof, have the following advantages:
1, ubiquity is active.Constitutive promoter of the present invention almost all demonstrates activity in the great majority tissue of plant and many cell types, particularly monocotyledonous, stem, Ye Zhong.
2, active high.Compared with CaMV35S promotor, constitutive promoter of the present invention almost all demonstrates obviously higher gene expression dose in the great majority tissue of plant and many cell types, particularly there is powerful, ubiquitous activity in monocotyledons, such as root, stem, leaf.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 is that the recombinant cloning vector pT-prOsRUBQ1 of constitutive promoter of the present invention and uses thereof builds schema;
Fig. 2 is that the recombinant expression vector p100024 of constitutive promoter of the present invention and uses thereof builds schema;
Fig. 3 is the recombinant expression vector p100079 schematic diagram of constitutive promoter of the present invention and uses thereof;
Fig. 4 is the transgenic corn plant Herbicid resistant design sketch of constitutive promoter of the present invention and uses thereof.
Embodiment
The technical scheme of constitutive promoter of the present invention and uses thereof is further illustrated below by specific embodiment.
The synthesis of the first embodiment, prOsRUBQ1 promoter sequence
Obtain constitutive promoter prOsRUBQ1 of the present invention, as shown in SEQ ID NO:1; Described prOsRUBQ1 promoter sequence (as shown in SEQ ID NO:1) is synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described prOsRUBQ1 promoter sequence (SEQIDNO:1) of synthesis is also connected with KpnII restriction enzyme site, and 3 ' end of described prOsRUBQ1 promoter sequence (SEQIDNO:1) is also connected with HindIII restriction enzyme site.
The structure of the second embodiment, recombinant expression vector p100024 containing prOsRUBQ1 promoter sequence and recombinant expression vector transformation Agrobacterium
1, the recombinant cloning vector pT-prOsRUBQ1 containing prOsRUBQ1 promoter sequence is built
PrOsRUBQ1 promoter sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by Promega Products pGEM-T carrier specification sheets, obtain recombinant cloning vector pT-prOsRUBQ1, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; PrOsRUBQ1 is the Ubiqutin(ubiquitin that rice varieties is Japanese fine) 1 gene promoter (SEQIDNO:1); MCS is multiple clone site).
Then by recombinant cloning vector pT-prOsRUBQ1 heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector pT-prOsRUBQ1), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 200rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-β-D-galactoside on surface) and the chloro-3-indoles of the bromo-4-of X-gal(5--β-D-galactoside) LB flat board (the Tryptones 10g/L of penbritin (100mg/L), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, the precipitation thalline solution I (25mMTris-HCl, 10mMEDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2MNaOH, 1%SDS(sodium lauryl sulphate) that 200 μ l newly prepare), pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (3M Potassium ethanoate, 5M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume dehydrated alcohols in supernatant liquor, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant liquor, and precipitation concentration (V/V) is dry after the washing with alcohol of 70%; Add 30 μ l containing RNase(20 μ g/ml) TE(10mMTris-HCl, 1mMEDTA, PH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.
The plasmid extracted is after KpnI and HindIII enzyme cuts qualification, and carry out sequence verification to positive colony, result shows that the paddy rice prOsRUBQ1 promoter sequence inserted in recombinant cloning vector pT-prOsRUBQ1 is the nucleotide sequence shown in SEQ ID NO:1.
2, the recombinant expression vector p100024 containing prOsRUBQ1 promoter sequence is built
With restriction enzyme KpnII and HindIII respectively enzyme cut recombinant cloning vector pT-prOsRUBQ1 and expression vector p90000, between KpnI and the HindIII site prOsRUBQ1 promoter fragment cut being inserted into p90000, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector p100024, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; PrOsRUBQ1: the Ubiqutin(ubiquitin that rice varieties Japan is fine) 1 gene promoter (SEQIDNO:1); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:3); Nos: the terminator (SEQIDNO:4) of rouge alkali synthetase gene; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQIDNO:5); PMI: Phophomannose isomerase gene (SEQIDNO:6); LB: left margin).
By recombinant expression vector p100024 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector p100024), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 200rpm rotating speed shaking table shake); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme EcoRV of extraction and XhoI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector p100024 between KpnI and HindIII site is classified as nucleotide sequence shown in SEQ ID NO:1, the Ubiqutin(ubiquitin that namely rice varieties Japan is fine) 1 gene promoter sequence.
3, the recombinant expression vector p100079(positive control containing control sequence is built)
Contain the method for the recombinant cloning vector pT-prOsRUBQ1 of prOsRUBQ1 promoter sequence according to the structure in second embodiment of the invention described in 1, utilize control sequence to build the recombinant cloning vector pT-prCaMV35S containing control sequence.Carry out sequence verification to positive colony, result shows that the prCaMV35S promoter sequence inserted in recombinant cloning vector pT-prCaMV35S is the nucleotide sequence shown in SEQ ID NO:2, and namely control sequence is correctly inserted.
The method of the recombinant expression vector p100024 of prOsRUBQ1 promoter sequence is contained according to the structure in second embodiment of the invention described in 2, utilize control sequence to build the recombinant expression vector p100079 containing control sequence, it builds flow process (Kan: kanamycin gene as shown in Figure 3; RB: right margin; PrCaMV35S: control sequence (SEQIDNO:2); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:3); Nos: the terminator (SEQIDNO:4) of rouge alkali synthetase gene; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQIDNO:5); PMI: Phophomannose isomerase gene (SEQIDNO:6); LB: left margin).Carry out sequence verification to positive colony, result shows that the control sequence inserted in recombinant expression vector p100079 is the nucleotide sequence shown in SEQ ID NO:2, and namely control sequence is correctly inserted.
4, recombinant expression vector transformation Agrobacterium
To oneself through building correct recombinant expression vector p100024 and p100079 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes; Agrobacterium LBA4404 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, carry out digestion verification after cutting with restriction enzyme EcoRV and XhoI enzyme, result show recombinant expression vector p100024 and p100079 structure entirely true.
3rd embodiment, proceed to the acquisition of the milpa of prOsRUBQ1 promoter sequence
The Agrobacterium infestation method conveniently adopted, the corn variety of sterile culture is combined 31(Z31) rataria and the second embodiment in Agrobacterium Dual culture described in 4, with by the 2 and 3 recombinant expression vector p100024 built and p100079(control sequence in the second embodiment) in T-DNA(comprise the promoter sequence of corn Ubiquitin gene, prOsRUBQ1 promoter sequence, control sequence, pat gene, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa proceeding to prOsRUBQ1 promoter sequence and the milpa proceeding to control sequence (positive control), simultaneously using wild-type corn plant as negative contrast.
For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein prOsRUBQ1 promoter sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD
660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.
Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.
The determination of activity of the 4th embodiment, prOsRUBQ1 promoter sequence
The qualification of experiment one, pat gene copy number
The blade getting the milpa proceeding to prOsRUBQ1 promoter sequence and the milpa proceeding to control sequence is respectively about 100mg as sample, extract its genomic dna with the DNeasyPlantMaxiKit of Qiagen, detected the copy number of pat gene by Taqman fluorescence probe quantitative PCR method.Simultaneously using wild-type corn plant as negative contrast, carry out detection according to the method described above and analyze.3 repetitions are established in experiment, average.
The concrete grammar detecting pat gene copy number is as follows:
Step 11, get each 100mg of blade of the milpa proceeding to prOsRUBQ1 promoter sequence, the milpa proceeding to control sequence and wild-type corn plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;
The DNeasyPlantMiniKit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, with NanoDrop2000(ThermoScientific) measure the genomic dna concentration of above-mentioned sample;
Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;
The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, using the sample of wild-type corn plant as negative contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Primer 1(PF): CAGTTGAGATTAGGCCAGCTACAG is as shown in SEQ ID NO:7;
Primer 2 (PR): TTCACTGTAGACGTCTCAATGTAATGG is as shown in SEQ ID NO:8;
Probe 1(PP): CAGCTGATATGGCCGCGGTTTGTG is as shown in SEQ ID NO:9;
PCR reaction system is:
Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.
PCR reaction conditions is:
Utilize SDS2.3 software (AppliedBiosystems) analytical data.
Experimental result shows, in oneself genome through being incorporated into detected milpa of prOsRUBQ1 promoter sequence and control sequence, and the milpa proceeding to prOsRUBQ1 promoter sequence and the milpa that proceeds to control sequence all obtain the transgenic corn plant containing single copy pat gene.
The content detection of experiment two, PAT albumen
The solution related in this experiment is as follows:
Extraction damping fluid: 8g/LNaCl, 0.2g/LKH
2pO
4, 2.9g/LNa
2hPO
412H
2o, 0.2g/LKCl, 5.5ml/L polysorbas20 (Tween-20), pH7.4;
Lavation buffer solution PBST:8g/LNaCl, 0.2g/LKH
2pO
4, 2.9g/LNa
2hPO
412H
2o, 0.2g/LKCl, 0.5ml/L polysorbas20 (Tween-20), pH7.4;
Stop buffer: 1MHCl.
Get 3mg respectively proceed to the milpa of prOsRUBQ1 promoter sequence and proceed to the blade (V3-V5 phase) of milpa of control sequence, root (ripening stage), stem (ripening stage) as sample, add after liquid nitrogen grinding described in 800 μ l and extract damping fluid, centrifugal 10min under the rotating speed of 4000rpm, get the described extraction damping fluid of supernatant liquor and dilute 40 times, the supernatant liquor got after 80 μ l dilutions detects for ELISA.Use ELISA(enzyme-linked immunosorbent assay) test kit (ENVIRLOGIX company, PAT test kit) carries out detection to the ratio that the expression amount of PAT albumen in sample accounts for sample fresh weight and analyzes, and concrete grammar is with reference to its product description.
Be accredited as not genetically modified milpa (NGM) in contrast with wild-type corn plant (CK) with through Taqman simultaneously, carry out detection according to the method described above and analyze.Every class plant selects 3 strains, and select 3 strains to test from each strain, every strain repeats 6 times.
The experimental result of the PAT protein content of transgenic corn plant is as shown in table 1.In the blade recording the milpa proceeding to prOsRUBQ1 promoter sequence, the milpa proceeding to control sequence, wild-type corn plant (CK) respectively and be accredited as not genetically modified milpa (NGM) through Taqman, ELISA value (ng/g) is respectively 585.34,461.65,0.12 and 0.01; The milpa proceeding to prOsRUBQ1 promoter sequence, the milpa proceeding to control sequence, wild-type corn plant (CK) and be accredited as not genetically modified milpa (NGM) through Taqman root in ELISA value (ng/g) be respectively 384.21,432.54,0.11 and 0.23; The milpa proceeding to prOsRUBQ1 promoter sequence, the milpa proceeding to control sequence, wild-type corn plant (CK) and be accredited as not genetically modified milpa (NGM) through Taqman stem in ELISA value (ng/g) be respectively 376.57,317.64,0 and 0.13, this result shows that prOsRUBQ1 promotor ubiquity is active, in blade, root and stem, all have expression.
The experimental result of the PAT protein content of table 1, transgenic corn plant
The above results also shows, proceed to ELISA value (ng/g) in the blade of the milpa of prOsRUBQ1 promoter sequence and stem and be respectively 585.34 and 376.57, and proceed to ELISA value (ng/g) in the blade of the milpa of control sequence and stem and be respectively 461.65 and 317.64, the former is significantly higher than the latter, this result shows that prOsRUBQ1 promoter activity is high, significantly increase the expression amount of object heterologous nucleotide sequence in plant tissue, particularly in blade and stem.
The Herbicid resistant effect detection of experiment three, transgenic corn plant
Get the milpa proceeding to prOsRUBQ1 promoter sequence and the milpa proceeding to control sequence (V3-V5 phase) respectively, and spray with 4 × careless ammonium phosphine (1600gae/ha, 4 times of land for growing field crops concentration) and blank solvent (water).Spray the developmental state that 7 days observe plant afterwards.Be accredited as not genetically modified milpa (NGM) in contrast with wild-type corn plant (CK) with through Taqman simultaneously, carry out detection according to the method described above and analyze.Every class plant selects 3 strains, selects 3 strains to test from each strain, often selects good strains in the field for seed and gets 20 seeds.Result as shown in Figure 4.
The result of Fig. 4 shows: spraying blank solvent (water) after 7 days, the milpa proceeding to prOsRUBQ1 promoter sequence, the milpa proceeding to control sequence, wild-type corn plant (CK) and be accredited as no significant difference between not genetically modified milpa (NGM) through Taqman; Spraying 4 × careless ammonium phosphine after 7 days, be accredited as not genetically modified milpa (NGM) all except dead except wild-type corn plant (CK) with through Taqman, the milpa proceeding to prOsRUBQ1 promoter sequence and the milpa proceeding to control sequence all can normal growths; Compared with the milpa proceeding to control sequence, the growth fraction proceeding to the milpa of prOsRUBQ1 promoter sequence is more vigorous, blade is deep green, and this result shows that prOsRUBQ1 promoter activity is high, significantly increases the expression amount of object heterologous nucleotide sequence in plant tissue.
In sum, constitutive promoter of the present invention almost in the great majority tissue and many cell types of plant ubiquity active and improve the expression amount of object heterologous nucleotide sequence in plant tissue significantly, particularly in blade and stem.
It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.
Claims (12)
1. a constitutive promoter, is characterized in that, the nucleotide sequence of its nucleotide sequence as shown in SEQIDNO:1.
2. one kind comprises the mosaic gene of constitutive promoter described in the claim 1 that is operably connected with object heterologous nucleotide sequence.
3. mosaic gene according to claim 2, is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
4. one kind comprises the expression cassette of mosaic gene described in Claims 2 or 3.
5. one kind comprises the recombinant vectors of expression cassette described in claim 4.
6. in plant, express the method for object heterologous nucleotide sequence for one kind, it is characterized in that, comprise: be integrated in vegetable cell by stable for the object heterologous nucleotide sequence be operably connected with constitutive promoter described in claim 1, described plant is corn or paddy rice.
7. in plant, express the method for object heterologous nucleotide sequence according to claim 6, it is characterized in that, the expression of described object heterologous nucleotide sequence composing type in plant tissue.
8. in plant, express the method for object heterologous nucleotide sequence according to claim 6, it is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
9. in plant, express the method for object heterologous nucleotide sequence according to claim 8, it is characterized in that, described object heterologous nucleotide sequence encodes herbicide resistant protein matter.
10. in plant, express the method for object heterologous nucleotide sequence according to claim 8, it is characterized in that, described object heterologous nucleotide sequence coding insect resistance proteins matter.
Constitutive promoter described in 11. 1 kinds of claims 1 is used for the purposes of the expression object heterologous nucleotide sequence of composing type in plant tissue, and described plant is corn or paddy rice.
12. are used for the purposes of the expression object heterologous nucleotide sequence of composing type in plant tissue according to constitutive promoter described in claim 11, it is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310725967.1A CN103740716B (en) | 2013-12-25 | 2013-12-25 | Constitutive promoter and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310725967.1A CN103740716B (en) | 2013-12-25 | 2013-12-25 | Constitutive promoter and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740716A CN103740716A (en) | 2014-04-23 |
| CN103740716B true CN103740716B (en) | 2015-11-18 |
Family
ID=50497781
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310725967.1A Active CN103740716B (en) | 2013-12-25 | 2013-12-25 | Constitutive promoter and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740716B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146410A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP526 promoter, preparation method and application of BgIosP526 promoter |
-
2013
- 2013-12-25 CN CN201310725967.1A patent/CN103740716B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146410A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP526 promoter, preparation method and application of BgIosP526 promoter |
Non-Patent Citations (4)
| Title |
|---|
| AF184279.1;Wang et al.;《GenBank》;20001004;第1-3页 * |
| AY785814.1;Banerjee et al.;《GenBank》;20121226;第1-3页 * |
| Native polyubiquitin promoter of rice provides increased constitutive expression in stable transgenic rice plants;Jagannath et al.;《Plant Cell Rep》;20111014;摘要 * |
| 泛素启动子的研究进展;赵慧等;《广东医学》;20031231;第24卷(第12期);第1376页左栏第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740716A (en) | 2014-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103476934B (en) | The preferred promoter of root and using method | |
| US20090083877A1 (en) | Transcription Factors, DNA and Methods for Introduction of Value-Added Seed Traits and Stress Tolerance | |
| CN102712929B (en) | Identification and use of plant root-specific expression promoter | |
| CN103740715B (en) | Chimeric promoters and uses thereof | |
| CN102559677B (en) | Tissue-specific promoter and application thereof | |
| CN113913457A (en) | Method for inhibiting or killing dichocrocis punctiferalis and application thereof | |
| CN103725677B (en) | Tissue-specific promoter and purposes thereof | |
| CN103409460A (en) | Maize transformation method | |
| CN107058317B (en) | Pollen specific promoter and application thereof | |
| CN103290014B (en) | Adversity inducible expression gene promoter and application thereof | |
| CN102517285B (en) | Tissue-specific promoter and application thereof | |
| US8338662B2 (en) | Viral promoter, truncations thereof, and methods of use | |
| CN103739683B (en) | Insecticidal protein, and encoding gene and use thereof | |
| CN103725679B (en) | Constitutive promoter and uses thereof | |
| CN114805508B (en) | Rice heading stage gene DHD3 function and application | |
| CN105400814A (en) | Method for cultivating insect-resistant transgenic maize | |
| CN102533761A (en) | Pollen-specific promoter and expression vector and application thereof | |
| CN103740716B (en) | Constitutive promoter and uses thereof | |
| US8350121B2 (en) | Viral promoter, truncations thereof, and methods of use | |
| CN103725678B (en) | Constitutive promoter and application thereof | |
| CN103555716B (en) | Intron sequences of Enhanced expressing and uses thereof | |
| CN108473999A (en) | Plant regulating element and its application method | |
| CN116064644B (en) | SbAGO1b protein and application of coding gene thereof in regulation and control of plant insect resistance | |
| US8344206B2 (en) | Viral promoter, truncations thereof, and methods of use | |
| CN107513532B (en) | Pear constitutive expression promoter PbTMT4P and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee after: Beijing Dabeinong Technology Group Co., Ltd. Patentee after: BEIJING DBN BIOTECH CO., LTD. Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee before: Beijing Dabeinong Technology Group Co., Ltd. Patentee before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd. |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20200812 Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49 Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd. |
|
| TR01 | Transfer of patent right |