CN103740715B - Chimeric promoters and uses thereof - Google Patents
Chimeric promoters and uses thereof Download PDFInfo
- Publication number
- CN103740715B CN103740715B CN201310724357.XA CN201310724357A CN103740715B CN 103740715 B CN103740715 B CN 103740715B CN 201310724357 A CN201310724357 A CN 201310724357A CN 103740715 B CN103740715 B CN 103740715B
- Authority
- CN
- China
- Prior art keywords
- sequence
- promoters
- mosaic virus
- plant
- cis element
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of chimeric promoters and uses thereof, described chimeric promoters comprises the cis element of at least one mosaic virus promoters, and the cis element of described mosaic virus promoters effectively connects the cis element of at least one Tsf1 promotor.Chimeric promoters of the present invention is conducive to the expression of herbicide tolerance protein matter, especially glyphosate tolerance protein matter, and significantly enhances the tolerance of transgenic soy bean plant to weedicide.
Description
Technical field
The present invention relates to a kind of chimeric promoters and uses thereof, the cis element particularly relating to a kind of mosaic virus promoters effectively connects chimeric promoters of the cis element of Tsf1 promotor and uses thereof.
Background technology
The latest developments of genetically engineered plant are that the engineering improving plant trait opens new gate, as disease resistance of plant, insect-resistant, herbicide tolerant, raising output, improve the nutritional quality of plant edible portion and strengthen quality guaranteed period or the stability of the terminal consumption product obtained from plant.Therefore, the goal gene with molecular function can by the suitable genome being integrated into plant to transmit difference or to improve proterties or quality.The encoding sequence of new integrator gene is expressed with the new proterties of display-object in vegetable cell.Importantly suitable adjustment signal must exist with suitable structure could obtain new expression of inserting the encoding sequence of gene in vegetable cell.These adjustment signals typically comprise promoter region, 5 ' untranslated homing sequence and 3 ' transcription terminator/polyadenylation se-quence.
For producing transgenic plant, will comprise the construct introduced plant cell of heterologous gene sequence, described heterologous gene sequence gives desired phenotype when expressing in plant.Described construct also comprises the plant promoter effectively connecting described heterologous gene sequence, and this plant promoter is not connected with described heterologous gene usually in the ordinary course of things.By described construct introduced plant cell, produce transformed plant cells, then described transformed plant cells is regenerated as transgenic plant.Described promotor control that this promotor effectively connects introduce the expression of DNA sequence dna, and therefore affect the desired characteristic that described DNA sequence dna gives.
It may be favourable for utilizing multiple promotor to customize genetic expression, so that a gene or multiple gene are in plant-growth and the proper time of growth, the best site in described plant and effectively transcribing with the amount produced needed for required effect.Such as, the constitutive expression of gene product may be favourable in a site of plant, but is not just so favourable at another part of this plant.In other cases, in certain etap of plant or at some environment of response or chemical stimulation it may be favourable for producing gene product time.The commercialized development of genetic improvement kind matter has also proceeded to the stage of multiple proterties being introduced crop, and the method is usually called as gene stacking method.In the method, the several genes introduced plant of different object proterties will can be given.When by several genes introduced plant, importantly adjust or control each gene to obtain optimum expression, and making controlling element variation, to reduce the possibility of gene silencing.Consider above-mentioned reason, the optimum control of genetic expression in plant biotechnology and controlling element variation are obviously important.
Summary of the invention
The object of this invention is to provide a kind of chimeric promoters and uses thereof, namely the cis element of mosaic virus promoters effectively connects the chimeric promoters of the cis element of Tsf1 promotor, be conducive to the expression of herbicide tolerance protein matter, especially glyphosate tolerance protein matter, enhances the tolerance of transgenic soy bean plant to weedicide significantly.
For achieving the above object, the invention provides a kind of chimeric promoters, comprise the cis element of at least one mosaic virus promoters, the cis element of described mosaic virus promoters effectively connects the cis element of at least one Tsf1 promotor.
Further, described mosaic virus promoters is cauliflower mosaic virus promoter, figwort mosaic virus promotor, peanut yellows stripe mosaic viral promotors, cassava vein mosaic virus promoters or Mirabilis jalapa mosaic virus promoters.。
Further, the cis element of described mosaic virus promoters is the cis enhancer element of mosaic virus promoters.
On the basis of technique scheme, described Tsf1 promotor is Arabidopis thaliana Tsf1 promotor or rape Tsf1 promotor.
Preferably, the sequence of described Arabidopis thaliana Tsf1 promotor is as shown in SEQIDNO:1, and the sequence of described rape Tsf1 promotor is as shown in SEQIDNO:2.
Described chimeric promoters is FMV:BrTsf1, MMV:AtTsf1, PCISV:AtTsf1, CsVMV:AtTsf1 or CaMV:BrTsf1.
Preferably, the sequence of described chimeric promoters is as shown in SEQIDNO:3, SEQIDNO:4, SEQIDNO:5 or SEQIDNO:6.
For achieving the above object, present invention also offers a kind of expression cassette, comprise described chimeric promoters and structural DNA sequence, described structural DNA sequence effectively connects described chimeric promoters.
Further, described structural DNA sequence encodes herbicide tolerance protein matter or insect resistance proteins matter.
Further, described structural DNA sequence encodes glyphosate tolerance protein matter.
Preferably, described glyphosate tolerance protein matter is 5-enolpyruvylshikimate-3-phosphate synthase.
Described structural DNA sequence encodes gives plant herbicide resistant protein matter, described herbicide tolerance protein matter includes but not limited to glyphosate tolerance protein matter, as independent 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), or the combination of itself and one or more glyphosate degradation protein.
On the basis of technique scheme, described glyphosate tolerance protein matter is effectively connected with chloroplast transit peptides.
Described glyphosate tolerance protein matter is effectively connected with transcription terminator.
Preferably, described expression cassette comprises the FMV:BrTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
Described expression cassette comprises the MMV:AtTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
Described expression cassette comprises the PCISV:AtTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
Described expression cassette comprises the CsVMV:AtTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
For achieving the above object, present invention also offers a kind of DNA construct, comprise expression cassette described at least one.
For achieving the above object, present invention also offers a kind of method of expression structure DNA sequence dna in plant, comprise described DNA construct introduced plant cell.
For achieving the above object, present invention also offers a kind of method controlling weeds, comprise and described DNA construct is imported plant, use enough glyphosates and do not damage described plant to control weeds.
Further, described enough glyphosates are not higher than the glyphosate of per hectare 10080 grams.
For achieving the above object, present invention also offers a kind of described chimeric promoters or the purposes of described DNA construct in structure transgenic plant.
In the present invention, term " nucleic acid (sequence) " or " polynucleotide (sequence) " refer to genomic source or synthesize the strand or double-stranded DNA or RNA of originating, and are namely the polymkeric substance reading deoxyribonucleotide bases or the ribonucleotide bases held in 3 ' (downstream) from 5 ' (upstream) end respectively.Nucleic acid can represent sense strand or complementation (antisense) chain.
" natural " refers to (" wild-type ") nucleotide sequence of natural appearance.
" allos " sequence refers to the sequence being derived from foreign source or species, or when referring to the sequence of being modified by its primitive form from during same source.
" separation " nucleotide sequence is that isolated or purified is out substantially with its other nucleotide sequence (i.e. other chromosomal DNA or exchromosomal DNA) usually combined in the biomass cells of the natural appearance of described nucleic acid.This term comprises through biochemical purification so that the basic nucleic acid removing nucleic acid and other Cell Component polluted.This term also comprises the nucleic acid of recombinant nucleic acid and chemosynthesis.
" basic purifying " refers to the molecule that other molecular separation be usually combined with its native state comes.More preferably the molecule of basic purifying is the main kind existed in prepared product.The molecule of basic purifying can not containing exist in natural mixture 60%, other molecule of preferably 75%, more preferably 90% (not comprising solvent).Term " basic purifying " does not comprise the molecule existed with native state.
If the layout of two kinds of nucleotide sequences makes the first nucleotide sequence affect the function of the second nucleotide sequence, the first nucleotide sequence so described just " is effectively connected " with described the second nucleotide sequence.Preferably these two kinds of sequences are integral parts of single continuous kernel acid molecule, or are more preferably and close on.Such as, if a kind of promotor regulates or mediates a kind of gene transcribing in cell, so described promotor is just effectively connected with described gene.
" restructuring " nucleic acid is that the sequence section be separated in other cases by artificial combination two kinds is obtained, such as, by chemosynthesis or the nucleic acid segment by gene engineering operation separation.The technology of carrying out nucleic-acid manipulation is well-known.
" transgenosis " refers to introduce the cell of exogenous nucleic acid (as recombinant precursor), tissue, organ or biology.The nucleic acid introduced preferably is integrated into the genomic dna of recipient cell, tissue, organ or biology, and the nucleic acid introduced with toilet is by descendant inheritting subsequently." transgenosis " cell or biology also comprise the offspring of described cell or biology, and are produced by the procedure of breeding using described " transgenosis " plant as hybrid strain and the existence showed due to recombinant precursor or construct and the offspring of phenotypic alternation that causes.
In the present invention, term " gene " refers to chromosomal DNA, plasmid DNA, cDNA, synthetic DNA or the DNA of other encoded peptide, polypeptide, albumen or RNA molecule and the district at encoding sequence both sides participation Expression modulation.Some genes can transcribe to become mRNA and translate becomes polypeptide (structure gene); And other gene can transcribe become mRNA(as rRNA, tRNA); Other type gene works (regulatory gene) as Expression modulation thing.
Gene " expression " refers to that genetic transcription produces corresponding mRNA and this mRNA translates generation corresponding gene product, i.e. peptide, polypeptide or albumen.Regulatory element controls or adjustment genetic expression, and described regulatory element comprises 5 ' regulatory element as promotor.
In the present invention, term " recombinant dna construct ", " DNA construct ", " recombinant precursor ", " expression construct " or " expression cassette " refer to from any source, can be integrated into any factor of genome or self-replicating as plasmid, clay, virus, BAC(bacterial artificial chromosome), self-replicating type sequence, phage or linear or cyclic single strand or double-stranded DNA or RNA nucleotide sequence, comprise wherein one or more DNA sequence dnas use well-known recombinant DNA technology with functional can the DNA molecular that connects of operating method.
" homology " refers to nucleotide sequence or aminoacid sequence respectively according to the similarity level (i.e. sequence similarity or identity) of Nucleotide or amino acid positional identity percentage.Homology also refers to the concept of similar functional properties between different nucleic acid or albumen.
In the present invention, term " promotor " refers to DNA regulatory region, usually starts the TATA box of RNA synthesis containing the applicable transcription initiation site that rna plymerase ii can be guided in specific coding sequence.Promotor can in addition containing other recognition sequence, and be generally positioned at upstream or the 5 ' end of TATA box, be called upstream promoter element, they affect transcription initiation rate." plant promoter " is in vegetable cell, have the natural of function or nonnative promoter.When described promotor and allogeneic dna sequence merge, described promotor causes merged sequence to transcribe with the Transcript patterns of the gene order being similar to described promotor and normally connecting usually.Can add comprise regulate the promoter fragment of sequence (be such as fused to there is himself partially or completely regulate 5 ' of the promoter active of sequence hold, or insertion wherein).
Promotor usually comprises multiple independently " cis-acting transcriptional regulatory element " or is called for short " cis element ", and each cis element gives the different aspect to genetic expression overall control." cis element " combines the trans-acting protein factor regulating and transcribe.Some cis elements are in conjunction with more than a kind of factor, and the trans-acting transcriptional factor can interact with different affinity from a more than cis element.Promoter sequence of the present invention can comprise " cis element " of imparting or regulatory gene expression.
Plant promoter also can comprise by operating known promotor to obtain synthesis, chimeric or hybrid promotor and the promotor that produces.Such promotor also can in conjunction with the cis element from one or more promotor, such as, by adding heterologous regulatory sequence having himself partially or completely to regulate on the promoter active of sequence; Also can add heterologous regulatory sequence by 5 ' upstream of the brachymemma promotor at non-activity, develop chimeric promoters, namely the brachymemma promotor of described non-activity only comprises core TATA and optionally comprises the promotor of CCAAT element.
The known cis element of at least one can be comprised according to chimeric or hybrid promotor of the present invention, as by various environmental factor as light, heat or the element of coercing adjustment; The element being regulated by pathogenic agent or pharmaceutical chemicals etc. or induced.According to described condition, this class component can or just regulate or the expression of negative regulator gene.The example of cis element includes but not limited to oxygen effect element, light regulatory element, the cis element responding methyl jasmonate process, Whitfield's ointment response element, heat shock response element, response wound and the element of abiotic stress, cold response element and drought effect element.In the present invention, the cis element of disclosed sequence can give specific specificity, such as, give the Enhanced expressing of the DNA sequence dna effectively connected in some tissue.
Promoter element can additivity effect or synergy affect promoter activity.Can arranged in series from the promoter element of different 5 ' regulatory region, obtain the promotor with different activities scope or different expression and distribution type.Therefore, the higher level expression of the transcribable sequence effectively connected may be given from the promoter element combination of foreign sources or the repetition of similar components or similar elements.Such as, a kind of polymer of promoter element can be formed, to increase by the specific expressed level of this promoter element institute implementation pattern.
For many agronomy characters, need at the one or more goal gene of Various Tissues transcription to give required feature.Need to obtain and regulate the gene that effectively connects at the suitable promoter of selected target tissue transcription because may not wish in a organized way in expressing gene, but only expressing gene in some tissue.Such as, if people wish that selective expression's target gene is to express herbicide tolerance gene, people may wish to express described herbicide tolerance gene in vegetative and germinal tissue.Promoter sequence of the present invention to may be used in Various Tissues regulatory gene expresses, and described tissue includes but not limited to the meristematic tissue of growth fast, male reproductive tissue (as pollen, flower pesticide and filigree), female reproductive tissue (as column cap, style and ovary), leaf, sepal and petal.Therefore, promotor of the present invention can be used for expressing herbicide tolerance gene, such as, when needing to express during patience at the Various Tissues of development of plants and stage.Promoter sequence of the present invention can be used for regulating transcribing of any target gene, described target gene includes but not limited to the gene controlling following proterties: fertility, output, insect-resistance, fungal tolerance, herbicide tolerance or any required proterties, especially preferred gene comprises herbicide tolerance gene or insect-resistance gene.
When herbicide tolerance gene expressed by needs in Various Tissues, promotor of the present invention especially can be used for the expression regulating herbicide tolerance gene.Such as described herbicide tolerance gene can give the patience to herbicide glyphosate.The example of suitable glyphosate tolerance gene includes but not limited to that the gene product of glyphosate resistance EPSPS gene or degradation of glyphosate is as glyphosate oxidoreductase and phosphonate N-acetyl transferring enzyme.For any plant biotechnology strategy, the extensive selection obtaining 5 ' regulatory element is important, to obtain for the most effective appropriate regulatory elements of required expression and distribution type.
In hybridization technique, oneself knows that all or part of of nucleotide sequence is used as probe, optionally hybridizes with from other the corresponding nucleotide sequence existed in the cloned genomic DNA fragments of selected organism or cDNA fragment (as genomic library or cDNA library) colony.Hybridization probe can be genomic DNA fragment, cDNA fragment, RNA fragment or other oligonucleotide, can by detectable group as
32p or other any detectable marker substance markers.Therefore, such as, hybridization probe can be prepared by mark according to the synthetic oligonucleotide of sequence of the present invention.
The hybridization of sequence can be carried out under strict conditions.Described " stringent condition " refers to that probe will be hybridized extremely detectable degree with its target sequence and be exceeded the condition with other sequence hybridization (as at least 2 times to background).Stringent condition has sequence dependent, and different because of the difference of environment.By controlling the severity of hybridization and/or wash conditions, can identify and the target sequence of probe 100% complementation (homology detects).Selectively, stringent condition can be regulated to allow some sequence mismatch, make to detect the similarity (allos detection) compared with low degree.Usually, probe length is shorter than about 1000 Nucleotide, is preferably shorter than 500 Nucleotide.
Typically, stringent condition is lower than about 1.5MNa ion pH7.0 to 8.3 time salt concn, typically about 0.01 to 1.0MNa ionic concn (or other salt), temperature at least about 30 DEG C of short probe (as 10 to 50 Nucleotide), at least about 60 DEG C of long probe (as more than 50 Nucleotide).Also stringent condition can be obtained by adding destabilizing agent such as methane amide.Low stringency conditions, such as, is included in 30-35% methane amide, 1MNaCl, 1%SDS(sodium laurylsulfonate) buffered soln in 37 DEG C of hybridization, 1 × to 2 × SSC(20 × SSC=3.0MNaCl/0.3M trisodium citrate) in 50-55 DEG C of washing.Moderate stringency, such as, is included in 37 DEG C of hybridization in the buffered soln of 40-45% methane amide, 1.0MNaCl, 1%SDS, 0.5 × and to 55-60 in 1 × SSC DEG C of washing.High stringency, such as, is included in 37 DEG C of hybridization in the buffered soln of 50% methane amide, 1MNaCl, 1%SDS, 60-65 DEG C of washing in 0.1 × SSC.Optionally, lavation buffer solution can containing the SDS of about 0.1% to 1%.Hybridization time is generally less than about 24 hours, about 4 to 12 hours usually.
The function of special post-hybridization washing typically, key factor is ionic strength and the temperature of final washing soln.For DNA-DNA crossbred, T
mcan from Meinkoth and Wahl(1984) equation estimation of Anal.Biochem.138:267-284: T
m=81.5 DEG C of+16.6(logM)+0.41(%GC)-0.61(%form)-500/L; Wherein M is the volumetric molar concentration of univalent cation, and %GC is guanylic acid and the per-cent of cytidylic acid(CMP) in DNA, and %form is the per-cent of methane amide in hybridization solution, and L is the length of crossbred in base pair.T
m50% complementary target sequence and match the temperature (under the ionic strength specified and pH) of probe hybridization completely.The mispairing of every 1% needs T
mreduce about 1 DEG C; Therefore, T
mhybridization and/or wash conditions can be conditioned with the sequence hybridization with required identity.Such as, if the sequence sought has>=the identity of 90%, T
m10 DEG C can be reduced.Usually, the stringent condition of selection is the thermal melting point (T lower than particular sequence
m) about 5 DEG C, and it is complementary under the ionic strength specified and pH.But high stringency can be applied lower than thermal melting point (T
m) hybridization of 1,2,3 or 4 DEG C and/or washing; Moderate stringency can be applied lower than thermal melting point (T
m) hybridization of 6,7,8,9 or 10 DEG C and/or washing; Low stringency conditions can be applied lower than thermal melting point (T
m) hybridization of 11,12,13,14,15 or 20 DEG C and/or washing.Apply this equation, hybridization and cleaning composition and required T
m, the condition that those of ordinary skill in the art can understand hybridization and/or washing soln changes with the change of Stringency.If required extent of mismatch makes T
mlower than 45 DEG C (aqueous solution) or 32 DEG C (formamide soln), preferably increase SSC concentration so that higher temperature can be used.The guide of nucleic acid hybridization sees Tijssen(1993) biological chemistry and Molecular Biology Lab's technology-use nucleic acid probe hybridization, part i, the 2nd chapter (Elsevier, NewYork); (1995) Current Protocols method the 2nd chapter (GreenePublishingandWiley-Interscience, NewYork) is edited with people such as Ausubel.See the people such as Sambrook (1989) molecular cloning: laboratory manual (second edition, ColdSpringHarborLaboratoryPress, Plainview, NewYork).
Expression cassette can contain selectable marker gene in addition.Usually, expression cassette will comprise the selected marker for selecting transformant.Described selected marker is for selecting the cell or tissue transformed.Described selected marker includes but not limited to, the gene (as encoding neomycin phosphotransferase II(NPT) of encode antibiotic resistance) and the gene of hygromix phosphotransferase (HPT), and the gene of conferring herbicide resistance is as Glufosinate ammonium, bromoxynil, imidazolone type and 2,4-dichlorphenoxyacetic acid ester (2,4-D).
In expression cassette preparation, different DNA fragmentations can be manipulated to provide the DNA sequence dna in suitable direction, and provide suitable reading frame when being applicable to.So, can apply and accept son or connexon in conjunction with DNA fragmentation, maybe can carry out other manipulation with the restriction site of providing convenience, remove unnecessary DNA, remove restriction site etc.For this purpose, vitro mutagenesis, primer reparation, restriction, annealing may be related to, replace again, as changed and conversion.
Well known in the art, other sequence modification can improve the gene expression dose in cell host.These include but not limited to, remove the tumor-necrosis factor glycoproteins that encoding spurious gathers adenosine signal, exon: intron splice site signal, transposon, and other fully symbolize the sequence that may be unfavorable for genetic expression.The G-C content of sequence can be adjusted to the mean level (ML) of specifying host cell, quotes the gene expression dose that in host cell, oneself knows and calculates.Possibly, modification sequence is to avoid the hairpin-type mRNA secondary structure predicted.
In expression cassette or DNA construct, expression cassette can contain 5 ' leader sequence in addition.Described leader sequence can play a part to improve transcriptional efficiency.Described leader sequence is known in the art, and includes but not limited to, picornavirus leader sequence, such as EMCV leader sequence (encephalomyocarditis 5 ' non-coding region); Potato virus group leader sequence, such as tobacco etch virus (TEV) leader sequence, the short and small mosaic virus of corn (MDMV) leader sequence and human immunoglobulin heavy chain's associated proteins (BiP); From alfalfa mosaic virus coating protein mRNA(AMVRNA4) untranslated leader; Tobacco mosaic virus (TMV) (TMV) leader sequence; With corn yellows mottle virus (MCMV) leader sequence.Other oneself element of improvement transcriptional efficiency of knowing, such as intron etc. can also be used.
Transformation Protocol and the scheme that nucleotide sequence imported plant are different according to the directed plant that transforms or plant cell type, i.e. monocotyledons or dicotyledons.Nucleotide sequence imported vegetable cell and the appropriate methodology inserted in Plant Genome includes but not limited to subsequently, Agrobacterium-medialed transformation, trace launch bombardment, directly DNA taken in the DNA of protoplastis, electroporation or silicon whisker mediation and import.
The cell transformed can grow into plant in a conventional manner.These plants are cultivated, with identical transformant or the pollination of different transformants, and the certified phenotype feature needed for the crossbred obtained expression.Can cultivate two generations or many for the expression to ensure phenotype feature needed for stably maintenance and heredity, then results can ensure the seed obtaining required phenotype feature representation.
Analyze expression level and/or profile that the existence of goal gene in conversion of plant and promoter sequence of the present invention give.Those skilled in the art know the multiple method that can be used for analyzing conversion of plant.Use multiple method evaluation genetic expression, and determine whether introduced gene is integrated, whether proper function and whether as prospectively heredity.For the present invention, described promotor can be evaluated by the expression level measuring the gene that promotor effectively connects.Operation report gene, more deterministic promotor evaluation can be obtained by transient assay method.Plant Analysis Methods includes but not limited to that southern blotting technique analysis or rna blot analysis, the method for PCR-based, biochemical analysis, phenotypic screening methods, field evaluation and immunodiagnostics measure.
Method of the present invention includes but not limited to round pcr, isolation of genomic DNA, construction expression construct, instantaneous measurement and methods for plant transformation, and these methods are that those skilled in that art are well-known, and uses standard technique or its modification to perform.
The invention provides a kind of chimeric promoters and uses thereof, chimeric promoters of the present invention adopts eFMV:prBrTsf1, eMMV:prAtTsf1, ePCISV:prAtTsf1 and eCsVMV:prAtTsf1, be conducive to the expression of herbicide tolerance protein matter, especially glyphosate tolerance protein matter; And have and affect structural DNA sequence (EPSPS gene) effect of expression level in plant, particularly enhance the tolerance of transgenic soy bean plant to weedicide significantly.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 is the recombinant expression vector DBN100040 schematic diagram of chimeric promoters of the present invention and uses thereof;
Fig. 2 is the recombinant expression vector DBN100052 schematic diagram of chimeric promoters of the present invention and uses thereof;
Fig. 3 is the recombinant expression vector DBN100051 schematic diagram of chimeric promoters of the present invention and uses thereof;
Fig. 4 is the recombinant expression vector DBN100039 schematic diagram of chimeric promoters of the present invention and uses thereof;
Fig. 5 is the recombinant expression vector DBN100036 schematic diagram of chimeric promoters of the present invention and uses thereof;
Fig. 6 is the transgenic corn plant Herbicid resistant design sketch of chimeric promoters of the present invention and uses thereof.
Embodiment
The technical scheme of chimeric promoters of the present invention and uses thereof is further illustrated below by specific embodiment.
The structure of the first embodiment, recombinant expression vector and recombinant expression vector transformation Agrobacterium
1, the recombinant expression vector containing chimeric promoters is built
Conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, recombinant expression vector DBN100040(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)) (Kan: kanamycin gene as shown in Figure 1; RB: right margin; EFMV: the 34S enhanser of figwort mosaic virus; PrBrTsf1: rape eucaryon elongation factor gene 1 α (Tsf1) promotor (SEQIDNO:2; EFMV:prBrTsf1(SEQIDNO:3)); The chloroplast transit peptides (SEQIDNO:8) of CTP2: Arabidopsis EPSPS; EPSPS:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQIDNO:9); The terminator (SEQIDNO:10) of E9: pea RbcS gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQIDNO:11); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:12); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQIDNO:13); LB: left margin).
According to the method for above-mentioned structure recombinant expression vector DBN100040, build recombinant expression vector DBN100052(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)) (Kan: kanamycin gene as shown in Figure 2; RB: right margin; EMMV: the enhanser of Mirabilis jalapa mosaic virus; PrAtTsf1: Arabidopis thaliana eucaryon elongation factor gene 1 α (Tsf1) promotor (SEQIDNO:1; EMMV:prAtTsf1(SEQIDNO:4)); The chloroplast transit peptides (SEQIDNO:8) of CTP2: Arabidopsis EPSPS; EPSPS:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQIDNO:9); The terminator (SEQIDNO:10) of E9: pea RbcS gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQIDNO:11); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:12); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQIDNO:13); LB: left margin).
According to the method for above-mentioned structure recombinant expression vector DBN100040, build recombinant expression vector DBN100051(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)) (Kan: kanamycin gene as shown in Figure 3; RB: right margin; EPCISV: the enhanser of peanut yellows stripe mosaic virus; PrBrTsf1: rape eucaryon elongation factor gene 1 α (Tsf1) promotor (SEQIDNO:2; EPCISV:prAtTsf1(SEQIDNO:5)); The chloroplast transit peptides (SEQIDNO:8) of CTP2: Arabidopsis EPSPS; EPSPS:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQIDNO:9); The terminator (SEQIDNO:10) of E9: pea RbcS gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQIDNO:11); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:12); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQIDNO:13); LB: left margin).
According to the method for above-mentioned structure recombinant expression vector DBN100040, build recombinant expression vector DBN100039(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)) (Kan: kanamycin gene as shown in Figure 4; RB: right margin; ECsVMV: the enhanser of cassava vein mosaic virus; PrAtTsf1: Arabidopis thaliana eucaryon elongation factor gene 1 α (Tsf1) promotor (SEQIDNO:1; ECsVMV:prAtTsf1(SEQIDNO:6)); The chloroplast transit peptides (SEQIDNO:8) of CTP2: Arabidopsis EPSPS; EPSPS:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQIDNO:9); The terminator (SEQIDNO:10) of E9: pea RbcS gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQIDNO:11); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:12); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQIDNO:13); LB: left margin).
2, recombinant expression vector DBN100036(positive control is built)
According to the method for above-mentioned structure recombinant expression vector DBN100040, build recombinant expression vector DBN100036(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)) (Kan: kanamycin gene as shown in Figure 5; RB: right margin; EFMV: the 34S enhanser of figwort mosaic virus; PrAtTsf1: Arabidopis thaliana eucaryon elongation factor gene 1 α (Tsf1) promotor (SEQIDNO:1; EFMV:prAtTsf1(SEQIDNO:7)); The chloroplast transit peptides (SEQIDNO:8) of CTP2: Arabidopsis EPSPS; EPSPS:5-enolpyruvylshikimate-3-phosphate synthase gene (SEQIDNO:9); The terminator (SEQIDNO:10) of E9: pea RbcS gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQIDNO:11); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQIDNO:12); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQIDNO:13); LB: left margin).
3, recombinant expression vector transformation Agrobacterium
Be transformed in Agrobacterium EHA101 to oneself through building correct recombinant expression vector DBN100040, DBN100052, DBN100051, DBN100039 and DBN100036 liquid nitrogen method, its conversion condition is: 100 μ L Agrobacterium EHA101,3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes; Agrobacterium EHA101 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, and digestion verification result shows that recombinant expression vector DBN100040, DBN100052, DBN100051, DBN100039 and DBN100036 structure is entirely true.
The acquisition of the second embodiment, Transgenic soybean plants and checking
1, Transgenic soybean plants is obtained
The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile culture and the first embodiment described in 3, with the recombinant expression vector DBN100040 by 1 and 2 structures in the first embodiment, DBN100052, DBN100051, T-DNA(in DBN100039 and DBN100036 comprises eFMV:prBrTsf1 nucleotide sequence, eMMV:prAtTsf1 nucleotide sequence, ePCISV:prAtTsf1 nucleotide sequence, eCsVMV:prAtTsf1 nucleotide sequence, eFMV:prAtTsf1 nucleotide sequence, CTP2 nucleotide sequence, EPSPS gene, E9 terminator sequence, prCaMV35S promoter sequence, pat gene and tCaMV35S terminator sequence) be transferred in soybean genome, obtain the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence and proceed to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, in contrast with Wild-type soy plant simultaneously.
For agriculture bacillus mediated transformation of soybean, briefly, by the soybean seeds of maturation at soybean germination substratum (B5 salt 3.1g/L, B5 vitamin b6 usp, sucrose 20g/L, agar 8g/L, pH5.6) sprout in, seed is inoculated on germination medium, by following CMC model: temperature 25 ± 1 DEG C; Photoperiod (light/dark) is 16/8h.Sprout and get the soybean aseptic seedling of expanding at bud green cotyledonary node place after 4-6 days, under cotyledonary node, 3-4 millimeter place cuts hypocotyl, longitudinally cuts cotyledon, removes terminal bud, lateral bud and seminal root.Wound is carried out at cotyledonary node place with the knife back of scalper, with the cotyledonary node tissue that agrobacterium suspension contact wound is crossed, wherein described chimeric promoter sequences can be passed to cotyledonary node tissue (step 1: infect step) that wound crosses in this step by Agrobacterium, and cotyledonary node is organized and preferably immersed agrobacterium suspension (OD
660=0.5-0.8, infects in substratum (MS salt 2.15g/L, B5 vitamin b6 usp, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, MES (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) to start inoculation.Cotyledonary node tissue and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, cotyledonary node is above cultivated at solid medium (MS salt 4.3g/L, B5 vitamin b6 usp, sucrose 20g/L, glucose 10g/L, MES (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6) after being organized in and infecting step.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephamycin 150mg/L, L-glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least exist in a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, the tissue block of cotyledon node regeneration is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the tissue block of cotyledon node regeneration cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (careless fourth phosphine).Preferably, the tissue block of cotyledon node regeneration is having screening solid medium (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, the agar 8g/L of selective agent, cephamycin 150mg/L, L-glutamic acid 100mg/L, aspartic acid 100mg/L, grass fourth phosphine 6mg/L, pH5.6) upper cultivation, cause the cell selective growth transformed.Then, the cell regeneration of conversion becomes plant (step 5: regeneration step), preferably, above cultivates with aftergrowth at solid medium (B5 division culture medium and B5 root media) in the tissue block containing the cotyledon node regeneration that the substratum of selective agent grows.
Screen the resistant tissues block obtained and transfer to described B5 division culture medium (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephamycin 150mg/L, L-glutamic acid 50mg/L, aspartic acid 50mg/L, Plant hormones regulators,gibberellins 1mg/L, growth hormone 1mg/L, careless fourth phosphine 6mg/L, pH5.6), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described B5 root media (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L, indole-3-butyric acid (IBA) 1mg/L), in root culture, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 26 DEG C, then cultivates 8 hours at 20 DEG C.
2, Transgenic soybean plants is verified with TaqMan
The blade getting the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence, the soybean plant strain proceeding to eMMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence and the soybean plant strain that proceeds to eFMV:prAtTsf1 nucleotide sequence is respectively about 100mg as sample, extract its genomic dna with the DNeasyPlantMaxiKit of Qiagen, detected the copy number of EPSPS gene by Taqman fluorescence probe quantitative PCR method.In contrast with Wild-type soy plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.
The concrete grammar detecting EPSPS gene copy number is as follows:
Step 11, get each 100mg of blade of the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence, the soybean plant strain proceeding to eMMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence and Wild-type soy plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;
The DNeasyPlantMiniKit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, with NanoDrop2000(ThermoScientific) measure the genomic dna concentration of above-mentioned sample;
Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;
The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of Wild-type soy plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Following primer and probe are used for detecting EPSPS gene:
Primer 1:TTGGTGCTAACCTTACCGTTGAG is as shown in SEQ ID NO:14;
Primer 2: GCTTACCACGACCTTCAAGACG is as shown in SEQ ID NO:15;
Probe 1:CTGATGCTGACGGTGTGCGTACCATC is as shown in SEQ ID NO:16;
PCR reaction system is:
Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.
PCR reaction conditions is:
Utilize SDS2.3 software (AppliedBiosystems) analytical data.
Experimental result shows, all oneself is incorporated in the genome of detected soybean plant strain EPSPS gene, and proceeds to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, the soybean plant strain proceeding to eMMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence and the soybean plant strain that proceeds to eFMV:prAtTsf1 nucleotide sequence and all obtain Transgenic soybean plants containing single copy EPSPS gene.
The herbicide tolerance effect detection of the 3rd embodiment, Transgenic soybean plants
1, the content detection of EPSPS albumen
The solution related in this experiment is as follows:
Extraction damping fluid: 8g/LNaCl, 0.2g/LKH
2pO
4, 2.9g/LNa
2hPO
412H
2o, 0.2g/LKCl, 5.5ml/L polysorbas20 (Tween-20), pH7.4;
Lavation buffer solution PBST:8g/LNaCl, 0.2g/LKH
2pO
4, 2.9g/LNa
2hPO
412H
2o, 0.2g/LKCl, 0.5ml/L polysorbas20 (Tween-20), pH7.4;
Stop buffer: 1MHCl.
Get the soybean plant strain that 3mg proceeds to eFMV:prBrTsf1 nucleotide sequence respectively, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, the blade (Seedling Stage) of the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence and the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence, root (flowering period), stem (flowering period) and flower (flowering period) are as sample, add after liquid nitrogen grinding described in 800 μ l and extract damping fluid, centrifugal 10min under the rotating speed of 4000rpm, get the described extraction damping fluid of supernatant liquor and dilute 40 times, the supernatant liquor got after 80 μ l dilutions detects for ELISA.Use ELISA(enzyme-linked immunosorbent assay) test kit (ENVIRLOGIX company, EPSPS test kit) carries out detection to the ratio that the expression amount of EPSPS albumen in sample accounts for sample fresh weight and analyzes, and concrete grammar is with reference to its product description.
Be accredited as not genetically modified soybean plant strain (NGM) in contrast with Wild-type soy plant (CK) with through Taqman simultaneously, carry out detection according to the method described above and analyze.Every class plant selects 3 strains, and select 3 strains to test from each strain, every strain repeats 6 times.
The experimental result of the EPSPS protein content of Transgenic soybean plants is as shown in table 1.Record the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence respectively, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, Wild-type soy plant (CK) and be accredited as not genetically modified soybean plant strain (NGM) through Taqman blade in ELISA mean value (ng/g) be respectively 216.9, 151.6, 110.3, 129.2, 96.7, 0.10 and 0.08, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, Wild-type soy plant (CK) and be accredited as not genetically modified soybean plant strain (NGM) through Taqman root in ELISA mean value (ng/g) be respectively 202.3, 171.4, 123.5, 100.3, 93.2, 0.15 and 0.13, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, Wild-type soy plant (CK) and be accredited as not genetically modified soybean plant strain (NGM) through Taqman stem in ELISA mean value (ng/g) be respectively 177.4, 164.8, 88.8, 66.4, 74.3, 0 and 0.11, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, Wild-type soy plant (CK) and be respectively 153.9 through the middle ELISA mean value (ng/g) of spending that Taqman is accredited as not genetically modified soybean plant strain (NGM), 141.2, 80.7, 94.0, 79.4, 0 and 0.04.
The experimental result of the EPSPS protein content of table 1, Transgenic soybean plants
The above results also shows, blade, root, the stem of the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence and the soybean plant strain that proceeds to eMMV:prAtTsf1 nucleotide sequence and spend middle ELISA mean value (ng/g) to be significantly higher than the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence; The blade of the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence and the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence, root, stem and spend middle ELISA mean value (ng/g) with proceed to eFMV:prAtTsf1 nucleotide sequence soybean plant strain blade, root, stem and spend middle ELISA mean value (ng/g) suitable, still higher than the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence in blade and root.This result shows that the equal general advantageous of chimeric promoters is in the expression of herbicide tolerance protein matter, as blade, root, stem and in spending; Wherein herbicide tolerance protein matter especially glyphosate tolerance protein matter, as EPSPS.
2, the Herbicid resistant effect detection of Transgenic soybean plants
Get respectively the soybean plant strain proceeding to eFMV:prBrTsf1 nucleotide sequence, the soybean plant strain proceeding to eMMV:prAtTsf1 nucleotide sequence, proceed to ePCISV:prAtTsf1 nucleotide sequence soybean plant strain, proceed to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence and proceed to the soybean plant strain (Seedling Stage) of eFMV:prAtTsf1 nucleotide sequence, and spray with 4 × glyphosate (3360gae/ha, 4 times of land for growing field crops concentration) and blank solvent (water).Spray the developmental state that 7 days observe plant afterwards.Be accredited as not genetically modified soybean plant strain (NGM) in contrast with Wild-type soy plant (CK) with through Taqman simultaneously, carry out detection according to the method described above and analyze.Every class plant selects 3 strains, selects 3 strains to test from each strain, often selects good strains in the field for seed and gets 40 seeds.Result as shown in Figure 6.
The result of Fig. 6 shows: spraying blank solvent (water) after 7 days, proceeding to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, proceeding to the soybean plant strain of eCsVMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence, Wild-type soy plant (CK) and be accredited as no significant difference between not genetically modified soybean plant strain (NGM) through Taqman, spraying 4 × glyphosate after 7 days, not genetically modified soybean plant strain (NGM) is accredited as all except dead except Wild-type soy plant (CK) with through Taqman, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of ePCISV:prAtTsf1 nucleotide sequence, all there is the plant of normal growth in the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence and the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence, and proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, the quantity of the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence and the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence is wanted significantly more than the soybean plant strain proceeding to eFMV:prAtTsf1 nucleotide sequence, compared with proceeding to the soybean plant strain of eFMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence is more vigorous with the growth fraction of the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence, proceed to the soybean plant strain of eFMV:prBrTsf1 nucleotide sequence, proceed to the soybean plant strain of eMMV:prAtTsf1 nucleotide sequence, the blade of the soybean plant strain proceeding to ePCISV:prAtTsf1 nucleotide sequence and the soybean plant strain proceeding to eCsVMV:prAtTsf1 nucleotide sequence is substantially all in green.This result shows that chimeric promoters has affects structural DNA sequence (EPSPS gene) effect of expression level in plant, particularly enhances the transgenic soy bean plant tolerance to weedicide, particularly glyphosate significantly; Chimeric promoters ePCISV:prAtTsf1 and eCsVMV:prAtTsf1 of the present invention can be used for replacing prior art chimeric promoters eFMV:prAtTsf1 for production simultaneously.
In sum, chimeric promoters of the present invention is conducive to the expression of herbicide tolerance protein matter, especially glyphosate tolerance protein matter; And have and affect structural DNA sequence (EPSPS gene) effect of expression level in plant, particularly enhance the tolerance of transgenic soy bean plant to weedicide significantly.
It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.
Claims (24)
1. a chimeric promoters, is characterized in that, comprises the cis element of at least one mosaic virus promoters, and the cis element of described mosaic virus promoters effectively connects the cis element of at least one Tsf1 promotor; The cis element of described Tsf1 promotor is the cis element of rape Tsf1 promotor, and the cis element of described mosaic virus promoters is the cis element of cauliflower mosaic virus promoter, the cis element of figwort mosaic virus promotor, the cis element of peanut yellows stripe mosaic viral promotors, the cis element of cassava vein mosaic virus promoters or the cis element of Mirabilis jalapa mosaic virus promoters.
2. chimeric promoters according to claim 1, it is characterized in that, the cis element of described mosaic virus promoters is the cis enhancer element of mosaic virus promoters.
3. chimeric promoters according to claim 1 or 2, is characterized in that, the sequence of described rape Tsf1 promotor is as shown in SEQIDNO:2.
4. chimeric promoters according to claim 1, it is characterized in that, described chimeric promoters is FMV:BrTsf1 or CaMV:BrTsf1.
5. chimeric promoters according to claim 4, it is characterized in that, the sequence of described chimeric promoters is as shown in SEQIDNO:3.
6. an expression cassette, is characterized in that, comprise chimeric promoters and structural DNA sequence described in any one of claim 1-5, described structural DNA sequence effectively connects described chimeric promoters.
7. expression cassette according to claim 6, is characterized in that, described structural DNA sequence encodes herbicide tolerance protein matter or insect resistance proteins matter.
8. expression cassette according to claim 7, is characterized in that, described structural DNA sequence encodes glyphosate tolerance protein matter.
9. expression cassette according to claim 8, it is characterized in that, described glyphosate tolerance protein matter is 5-enolpyruvylshikimate-3-phosphate synthase.
10. expression cassette according to claim 8, it is characterized in that, described glyphosate tolerance protein matter is effectively connected with chloroplast transit peptides.
11. expression cassettes according to claim 8, it is characterized in that, described glyphosate tolerance protein matter is effectively connected with transcription terminator.
12. expression cassettes according to claim 6, it is characterized in that, described expression cassette comprises the FMV:BrTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
13. according to any one of claim 7-11 expression cassette, it is characterized in that, described expression cassette comprises the FMV:BrTsf1 be effectively connected with the structural DNA sequence of EPSPS, and the structural DNA sequence of described EPSPS is effectively connected with Arabidopsis chloroplast transit peptides CTP2 and E9 terminator.
14. 1 kinds of DNA construct, is characterized in that, comprise expression cassette described at least one any one of claim 8-12.
15. 1 kinds of DNA construct, is characterized in that, comprise expression cassette described at least one claim 13.
The method of 16. 1 kinds of expression structure DNA sequence dnas in plant, is characterized in that, comprises DNA construct introduced plant cell described in claim 14.
The method of 17. 1 kinds of expression structure DNA sequence dnas in plant, is characterized in that, comprises DNA construct introduced plant cell described in claim 15.
18. 1 kinds of methods controlling weeds, is characterized in that, comprise and DNA construct described in claim 14 is imported plant, use enough glyphosates and do not damage described plant to control weeds.
19., according to the method controlling weeds described in claim 18, is characterized in that, described enough glyphosates are not higher than the glyphosate of per hectare 10080 grams.
20. 1 kinds of methods controlling weeds, is characterized in that, comprise and DNA construct described in claim 15 is imported plant, use enough glyphosates and do not damage described plant to control weeds.
21., according to the method controlling weeds described in claim 20, is characterized in that, described enough glyphosates are not higher than the glyphosate of per hectare 10080 grams.
Chimeric promoters described in 22. 1 kinds of claims 1 is building the purposes in transgenic plant.
DNA construct described in 23. 1 kinds of claims 14 is building the purposes in transgenic plant.
DNA construct described in 24. 1 kinds of claims 15 is building the purposes in transgenic plant.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310724357.XA CN103740715B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and uses thereof |
| CN201510587552.1A CN105219773B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310724357.XA CN103740715B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and uses thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510587552.1A Division CN105219773B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740715A CN103740715A (en) | 2014-04-23 |
| CN103740715B true CN103740715B (en) | 2016-03-23 |
Family
ID=50497780
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310724357.XA Active CN103740715B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and uses thereof |
| CN201510587552.1A Active CN105219773B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510587552.1A Active CN105219773B (en) | 2013-12-25 | 2013-12-25 | Chimeric promoters and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN103740715B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10995339B2 (en) * | 2015-11-30 | 2021-05-04 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
| CN106086011B (en) * | 2016-06-18 | 2019-10-18 | 北京大北农科技集团股份有限公司 | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004 |
| EP3546582A1 (en) * | 2018-03-26 | 2019-10-02 | KWS SAAT SE & Co. KGaA | Promoter activating elements |
| CN109486815B (en) * | 2018-11-02 | 2021-12-31 | 成都大学 | Artificial chimeric promoter and construction method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155597A (en) * | 2005-02-01 | 2008-04-02 | 宝德杰克特疫苗有限公司 | Nucleic acid constructs |
| CN103096712A (en) * | 2010-06-04 | 2013-05-08 | 孟山都技术公司 | Transgenic brassica event MON 88302 and methods of use thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7632982B2 (en) * | 2006-06-23 | 2009-12-15 | Monsanto Technology Llc | Drought responsive promoters HVA22e and PLDδ identified from Arabidopsis thaliana |
-
2013
- 2013-12-25 CN CN201310724357.XA patent/CN103740715B/en active Active
- 2013-12-25 CN CN201510587552.1A patent/CN105219773B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155597A (en) * | 2005-02-01 | 2008-04-02 | 宝德杰克特疫苗有限公司 | Nucleic acid constructs |
| CN103096712A (en) * | 2010-06-04 | 2013-05-08 | 孟山都技术公司 | Transgenic brassica event MON 88302 and methods of use thereof |
Non-Patent Citations (1)
| Title |
|---|
| Jerry M. Green.Evolution of Glyphosate-Resistant Crop Technology.《Weed Science》.2009,第57卷第111页左栏倒数第一段，右栏地1-3段. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740715A (en) | 2014-04-23 |
| CN105219773A (en) | 2016-01-06 |
| CN105219773B (en) | 2017-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103476934B (en) | The preferred promoter of root and using method | |
| KR102296563B1 (en) | Nucleic acid sequences for detecting the presence of transgenic soybean event DBN9004 in a biological sample, kits comprising same, and methods for detecting same | |
| CN102191262B (en) | RNA (Ribonucleic Acid) interference vector and application thereof | |
| US20080235823A1 (en) | Root active promoters and uses thereof | |
| CN103740715B (en) | Chimeric promoters and uses thereof | |
| Liu et al. | A Pd1–Ps–P1 feedback loop controls pubescence density in soybean | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN117106820A (en) | Method for creating few lateral branches of tomatoes through genome editing and application of method | |
| US20160017357A1 (en) | Polynucleotides and methods for improving plants | |
| CN114805508B (en) | Rice heading stage gene DHD3 function and application | |
| US7560612B2 (en) | Early-inflorescence-preferred regulatory elements and uses thereof | |
| CN103555716B (en) | Intron sequences of Enhanced expressing and uses thereof | |
| CN103725679B (en) | Constitutive promoter and uses thereof | |
| US11319548B2 (en) | Cold- and water-inducible promoter from rice | |
| WO2009003429A2 (en) | Method of regulation of biomass production in plants, dna sequences and method of preparation thereof | |
| JP2010142156A (en) | Ospip1;3 gene-introduced cold-resistant rice | |
| CN105175519A (en) | Application of protein SRL2 in cultivation of leaf rolling rice | |
| CN114644698B (en) | Application of rice gene OsREM20 in regulation of spike number and yield | |
| CN104120134A (en) | Application of GsHSFB2b protein in cultivating stress tolerant transgenic plants | |
| CN102245769A (en) | Transgenic plant of which seed has enlarged size | |
| KR102081963B1 (en) | Promoter specific for plant seed embryo and uses thereof | |
| CN103740716B (en) | Constitutive promoter and uses thereof | |
| EP1268829B1 (en) | Atrsp gene promoters | |
| CN103725678B (en) | Constitutive promoter and application thereof | |
| CN118127030A (en) | Application of heat stress resistance related protein OsALKBHL1 or substance for regulating expression thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Applicant after: Beijing Dabeinong Technology Group Co., Ltd. Applicant after: BEIJING DBN BIOTECH CO., LTD. Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Applicant before: Beijing Dabeinong Technology Group Co., Ltd. Applicant before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd. |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200810 Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49 Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd. |