CN102517285B - Tissue-specific promoter and application thereof - Google Patents
Tissue-specific promoter and application thereof Download PDFInfo
- Publication number
- CN102517285B CN102517285B CN201110435725.XA CN201110435725A CN102517285B CN 102517285 B CN102517285 B CN 102517285B CN 201110435725 A CN201110435725 A CN 201110435725A CN 102517285 B CN102517285 B CN 102517285B
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- tissue
- sequence
- heterologous nucleotide
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a tissue-specific promoter and its application. The nucleotide sequence of the tissue-specific promoter contains a sequence of (a) or (b) as follows: (a) a nucleotide sequence which is shown from the 16th nucleotide to the 2310th nucleotide of SEQ ID NO:1, and also comprises the promoter function; and (b) a nucleotide sequence which hybridizes with the limited nucleotide sequence from (a). The tissue-specific promoter provided by the invention is firstly isolated from PEPC gene of Chinese maize variety Z31. In the meanwhile, the promoter obviously increases the expression level of target heterologous nucleotide sequences in plant photosynthetic tissues, but obviously reduces the expression level of target heterologous nucleotide sequences in plant non-photosynthetic tissues, and obviously enhances the expression tissue specificity of target heterologous nucleotide sequences in plant photosynthetic tissues.
Description
Technical field
The present invention relates to a kind of tissue-specific promoter and uses thereof, particularly relate to a kind of photosynthetic tissue specific corn phosphoric acid enol pyruvic acid carboxylase gene promotor and uses thereof.
Background technology
The expression of allogeneic dna sequence in plant host depends on has the promotor being operably connected working in plant host.The selection of promoter sequence is by the time and the position that determine that allogeneic dna sequence is expressed in plant host.Therefore, while expression in need to the tissue at plant optimization, using-system specificity promoter.On the contrary, in the time that needs are expressed in whole vegetable cells, use constitutive promoter.For example, by the genetic manipulation to Plant Genome, make it to contain the tissue-specific promoter being operatively connected with allos anti insect gene, anti-insect material is expressed specifically in susceptible plants tissue, can realize plant increases the resistance of insect infestations.The preferential expression of heterologous nucleotide sequence in destination organization reduced constitutive promoter and in whole vegetable cells, started heterologous nucleotide sequence and transcribe occurred plant resources consumption.
Photosynthetic tissue for carrying out photosynthesis or potential photosynthetic part in plant materials, such as green blade, leaf sheath, shell etc., photosynthetic tissue utilizes inorganics to produce organism (starch) and storing energy by photosynthesis, so that plant materials obtains the essential nutrient that grows.In some cases, people wish only specifically expressing in photosynthetic tissue of some important functional gene.For example, photosynthetic tissue becomes the target of various insects as the supplier of organism (starch) and energy, comprise Pyrausta nubilalis (Hubern)., striped rice borer, aphid, bollworm etc., these insects cause damage to plant by number of mechanisms, comprise that being robbed nutrition and moisture, insect by insect introduces in invasion and attack tissue by virion and make tissue to fungal attack susceptible etc.; Therefore need to have and the photosynthetic tissue's specificity promoter that helps the heterologous nucleotide sequence of the plant outside invasion and attack of opposing (as insect, virus, fungi, nematode and analogue thereof) to be operatively connected.
Corn phosphoric acid enol pyruvic acid carboxylase (phosphoenolpyruvate carboxylase, be called for short PEPC) gene promoter as photosynthetic tissue's specificity promoter by (Hudspeth R.L.and Grula J.W. such as Hudspeth, Plant Molecular Biology 12:579-589, 1989) since separating and identify from american corn selfing kind B73, so far its correlative study is very few, and B73 is the early stage kind of the U.S., the corn variety sibship current with China is far away, therefore need to derive from the pepc gene promotor of Chinese maize kind, make can be in the photosynthetic tissue efficient specifically expressing of heterologous nucleotide sequence.
Summary of the invention
The object of this invention is to provide a kind of tissue-specific promoter and uses thereof, i.e. new separation is combined the pepc gene promotor of 31 (Z31) from Chinese maize kind, make object heterologous nucleotide sequence can be in photosynthetic tissue efficient specifically expressing.
For achieving the above object, the invention provides a kind of tissue-specific promoter, its nucleotide sequence following (a), (b) or sequence (c):
(a) SEQ ID NO:1 is from the nucleotide sequence shown in the 16th to the 2310th Nucleotide;
(b) nucleotide sequence shown in SEQ ID NO:1;
(c) with the nucleotide sequence of the nucleotide sequence complementation (a) or (b) limiting.
Above-mentioned stringent condition can be in 6 × SSC (Trisodium Citrate), 0.5%SDS (sodium lauryl sulphate) solution, and at 65 ℃, hybridization, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.
For achieving the above object, the present invention also provides a kind of mosaic gene that comprises the described tissue-specific promoter being operably connected with object heterologous nucleotide sequence.
Further, described object heterologous nucleotide sequence coding target protein matter.
For achieving the above object, the present invention also provides a kind of expression cassette that comprises described mosaic gene.
For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described mosaic gene.
For achieving the above object, the present invention also provides a kind of corn photosynthetic tissue of containing described mosaic gene in its cell.
For achieving the above object, the present invention also provides a kind of method of expressing object heterologous nucleotide sequence in corn, comprising: by stable being integrated in maize cell of object heterologous nucleotide sequence being operably connected with described tissue-specific promoter.
Preferably, described object heterologous nucleotide sequence is expressed in photosynthetic tissue.More preferably, described photosynthetic tissue is mesophyll tissue.
Further, described object heterologous nucleotide sequence coding target protein matter.
Preferably, described object heterologous nucleotide sequence coding herbicide tolerance protein.Described object heterologous nucleotide sequence coding insect-resistant protein.
For achieving the above object, the present invention also provides a kind of described tissue-specific promoter for the purposes in corn photosynthetic tissue preferential expression object heterologous nucleotide sequence.
Further, described object heterologous nucleotide sequence coding target protein matter.
Term in the present invention " promotor " refers to DNA regulatory region, conventionally contains and can guide rna plymerase ii to start the synthetic TATA box of RNA at the applicable transcription initiation site of specific coding sequence.Promotor can contain other recognition sequence in addition, is generally positioned at upstream or the 5 ' end of TATA box, is called upstream promoter element, and they affect transcription initiation speed.Admittedly, because promoter region nucleotide sequence of the present invention is determined, in 5 ' non-translational region of the concrete promoter region of the present invention upstream, further separate and identify that regulatory element belongs to prior art.Therefore, promoter region of the present invention further comprises upstream regulation element, it gives any heterologous nucleotide sequence tissue specific expression being operably connected with promoter sequence of the present invention, preferably specific expressed in photosynthetic tissue, more preferably specific expressed in mesophyll tissue.
Term in the present invention " gene " refers to any DNA fragmentation that for example, contains the DNA region (" the DNA region of transcribing ") that is transcribed into RNA molecule (for example mRNA) under suitable regulation and control region (plant expressiveness promoter region) controlled at cell.Therefore, gene may contain the DNA fragmentation that several operability connect, for example promotor, 5 ' untranslated leader, coding region and 3 ' the untranslated region of containing polyadenylation site.Endogenous plant gene is the gene of natural discovery in plant species.Mosaic gene is any gene of conventionally not finding in plant species, or in natural situation its promotor and the DNA region of partly or entirely transcribing or with the irrelevant any gene at least another regulation and control region of this gene.
It is specific expressed that the feature of promoter sequence that the present invention separates is to provide the photosynthetic tissue of object heterologous nucleotide sequence.Described photosynthetic tissue for carrying out photosynthesis or potential photosynthetic part in plant materials, such as green blade, leaf sheath, shell etc., photosynthetic tissue utilizes inorganics to produce organism (starch) and storing energy by photosynthesis, so that plant materials obtains the essential nutrient that grows.Term in the present invention " photosynthetic tissue's specificity " refers to as specific purpose, for example, the high degree of specificity expression in plant (rice plants (" Rice Photosynthesis tissue specificity ")) photosynthetic tissue's cell of object heterologous nucleotide sequence.In other words, object heterologous nucleotide sequence is mainly expressed in the photosynthetic tissue of plant, and the DNA transcript level in the non-photosynthetic tissue of plant is (the total RNA of every microgram is lower than approximately 0.2 pik) that cannot detect or low-down.
Those skilled in the art can easily identify and utilize promotor of equal value in function according to identical object.Have in essence to contain SEQ ID NO:1 of the present invention from the nucleotide sequence shown in the 812nd to the 2272nd Nucleotide or SEQ ID NO:1 from nucleotide sequence or the nucleotide sequence shown in SEQ ID NO:1 shown in the 16th to the 2310th Nucleotide or there is the DNA sequence dna of the similar promoter activity of the corn pepc gene promotor of nucleotide sequence of promoter activity part, be the function equivalent of these promotors.These function equivalence promotors can be hybridized with the corn pepc gene promoter region that contains above-mentioned nucleotide sequence under stringent condition.
In hybridization technique, the all or part of probe that is used as of known nucleotide sequence, optionally hybridizes with other the corresponding nucleotide sequence existing in cloned genomic dna fragment from selected organism or cDNA fragment (as genomic library or cDNA library) colony.Hybridization probe can be genomic DNA fragment, cDNA fragment, RNA fragment or other oligonucleotide, can by detectable group as
32p or other any detectable marker substance markers.Therefore, for example, can prepare hybridization probe by the synthetic oligonucleotide of mark sequence according to the present invention.The method of preparing hybridization probe and construction cDNA and genomic library is known in the art and is disclosed in the people such as Sambrook (1989) molecular cloning: the laboratory manual (second edition, Cold Spring Harbor Laboratory Press, Plainview, New York).
The hybridization of sequence can be carried out under stringent condition.Described " stringent condition " refers to that probe will exceed and other sequence hybridization condition of (as at least 2 times to background) with its target sequence hybridization to detectable degree.Stringent condition has sequence dependent, and because of the difference of environment different.Hybridize and/or the severity of wash conditions by control, can identify the target sequence (homology detection) with probe 100% complementation.Selectively, can regulate stringent condition to allow some sequence mispairing, make to detect the similarity (allos detection) compared with low degree.Conventionally, probe length is shorter than about 1000 Nucleotide, is preferably shorter than 500 Nucleotide.
Typically, stringent condition is lower than about 1.5M Na ion pH7.0 to 8.3 time salt concn, typically about 0.01 to 1.0M Na ionic concn (or other salt), temperature is at least about 30 ℃ of short probe (as 10 to 50 Nucleotide), at least about 60 ℃ of long probe (as exceeding 50 Nucleotide).Also can obtain stringent condition by adding destabilizing agent as methane amide.Low stringency condition, for example, be included in 37 ℃ of hybridization in the buffered soln of 30-35% methane amide, 1M NaCl, 1%SDS (sodium laurylsulfonate), 1 × to 50-55 ℃ of washing in 2 × SSC (20 × SSC=3.0M NaCl/0.3M trisodium citrate).Moderate stringent condition, for example, is included in 37 ℃ of hybridization in solution in 40-45% methane amide, 1.0MNaCl, 1%SDS slow, 0.5 × and to 55-60 ℃ of washing in 1 × SSC.Height stringent condition, for example, is included in 37 ℃ of hybridization in the buffered soln of 50% methane amide, 1M NaCl, 1%SDS, 60-65 ℃ of washing in 0.1 × SSC.Optionally, lavation buffer solution can contain about SDS of 0.1% to 1%.Hybridization time is generally less than about 24 hours, about 4 to 12 hours conventionally.
The special function of post-hybridization washing typically, key factor is ionic strength and the temperature of final washing soln.For DNA-DNA crossbred, T
mcan be from the equation estimation of Meinkoth and Wahl (1984) Anal.Biochem.138:267-284: T
m=81.5 ℃+16.6 (logM)+0.41 (%GC)-0.61 (%form)-500/L; Wherein M is the volumetric molar concentration of univalent cation, and %GC is guanylic acid and the per-cent of cytidylic acid(CMP) in DNA, and %form is the per-cent of methane amide in hybridization solution, and L is the length of crossbred in base pair.T
m50% complementary target sequence and the temperature (under the ionic strength and pH of regulation) of matching probe hybridization completely.Every 1% mispairing needs T
mreduce about 1 ℃; Therefore, T
mhybridization and/or wash conditions can be conditioned with the sequence hybridization of required identity.For example, if having>=90% identity of the sequence of seeking, T
mcan reduce by 10 ℃.Usually, the stringent condition of selection is the hot melting temperature(Tm) (T lower than particular sequence
m) about 5 ℃, and complementary under its ionic strength in regulation and pH.But height stringent condition can be applied lower than hot melting temperature(Tm) (T
m) hybridization and/or the washing of 1,2,3 or 4 ℃; Moderate stringent condition can be applied lower than hot melting temperature(Tm) (T
m) hybridization and/or the washing of 6,7,8,9 or 10 ℃; Low stringent condition can be applied lower than hot melting temperature(Tm) (T
m) hybridization and/or the washing of 11,12,13,14,15 or 20 ℃.Apply this equation, hybridization and cleaning composition and required T
m, those of ordinary skills will appreciate that the condition of hybridization and/or washing soln changes with the variation of stringency.If required mispairing degree makes T
mlower than 45 ℃ (aqueous solution) or 32 ℃ (formamide soln), preferably increase SSC concentration can use higher temperature.The guide of nucleic acid hybridization sees Tijssen (1993) biological chemistry and Molecular Biology Lab's technology-use nucleic acid probe hybridization, part i, the 2nd chapter (Elsevier, New York); Edit (1995) molecular biology modernism the 2nd chapter (Greene Publishing and Wiley-Interscience, New York) with people such as Ausubel.See the people such as Sambrook (1989) molecular cloning: laboratory manual (second edition, Cold Spring Harbor Laboratory Press, Plainview, New York).
Therefore, there is promoter activity and comprise in the present invention with the separation sequence of promoter sequence of the present invention or the hybridization of its fragment under stringent condition.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology.Be that the scope of sequence identity is distributed at least approximately 40%-50%, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence identity.
Other function equivalence promotor contains such nucleotide sequence, can with contain SEQ ID NO:1 from the nucleotide sequence shown in the 812nd to the 2272nd Nucleotide or SEQ ID NO:1 the nucleotide sequence at least about 25, preferably at least about 50, particularly increasing in polymerase chain reaction at least about the Oligonucleolide primers of 100 continuous nucleotides from the nucleotide sequence shown in the 16th to the 2310th Nucleotide or the nucleotide sequence shown in SEQ ID NO:1.
Can also build manual activation, the specific internal sequence of photosynthetic tissue of the decision promotor in its 5 ' regulation and control region that comprises the nucleotide sequence shown in SEQ ID NO:1.Described manual activation may comprise " core promoter " or " TATA box region " of another promotor that can express in plant, for example CaMV 35S described in WO 93/19188 " TATA box region ".The suitability of the promoter region that contains described manual activation can be identified in the detection of suitable tissue, the suitably expression of etap by the suitable fusion of they and object heterologous nucleotide sequence and object heterologous nucleotide sequence.
Promoter sequence of the present invention and fragment thereof, in the time being assembled into DNA structure promoter sequence is operably connected with object heterologous nucleotide sequence, manipulate any plant for heredity.Described " being operably connected " refers to functional connection the between promoter sequence of the present invention and second sequence, and wherein promoter sequence starts and regulates transcribing corresponding to the DNA sequence dna of second sequence.Usually, be operably connected and refer to that the nucleotide sequence being connected is continuous, be adjacent to if desired in conjunction with two protein-coding regions, and in same reading frame.In this way, promotor nucleotide sequence and object heterologous nucleotide sequence form described mosaic gene to be provided together with in expression cassette, to express in object plant.This expression cassette provides a large amount of restriction sites to insert object heterologous nucleotide sequence, and described object heterologous nucleotide sequence will be subject to the transcriptional regulatory of the regulatory region that comprises promoter sequence of the present invention.Expression cassette can contain in addition at least one and cotransformation be entered to the episome of organism.Selectively, episome can be provided on multiple expression cassettes.
Expression cassette can contain selectable marker gene in addition.Usually, expression cassette is by the selected marker who comprises for selecting transformant.The cell or tissue of described selected marker for selecting to transform.Described selected marker includes but not limited to, gene (as coding neomycin phosphotransferase II (NPT)), the gene of phosphomannose isomerase (PMI) and the gene of hygromix phosphotransferase (HPT) of coding antibiotics resistance, and the gene of conferring herbicide resistance is as Glufosinate ammonium, bromoxynil, imidazolone type and 2,4-dichlorphenoxyacetic acid ester (2,4-D).
Expression cassette comprises promoter sequence of the present invention, translation initiation district, the object heterologous nucleotide sequence of transcribing along 5 '-3 ' direction and transcribing and translation termination district of working in plant.Object heterologous nucleotide sequence can be natural or to plant host external source or allos.Selectively, object heterologous nucleotide sequence can be native sequences or selectivity composition sequence." external source " refers to and in the natural phant that imports transcription initiation region, do not have described importing transcription initiation region.For example, mosaic gene comprises promoter sequence of the present invention, and promoter sequence of the present invention is operationally connected with the encoding sequence that is different from promoter sequence of the present invention.
Terminator can derive from promoter sequence of the present invention, also can derive from the object heterologous nucleotide sequence being operatively connected, and maybe can derive from other source.Traditional terminator can obtain from the Ti-plasmids of soil Agrobacterium, as carnitine synthetic enzyme and rouge alkali synthetase (NOS) terminator.
In expression cassette preparation, can manipulate different DNA fragmentations so that the DNA sequence dna of suitable direction to be provided, and suitable reading frame is provided in applicable.So, can apply and accept son or connexon in conjunction with DNA fragmentation, maybe can carry out other restriction site that manipulates to provide convenience, remove unnecessary DNA, remove restriction site etc.For this purpose, may relate to vitro mutagenesis, primer reparation, restriction, annealing, replace again, as changed and conversion.
Applicable in the situation that, object heterologous nucleotide sequence can be optimized to be increased in the expression amount in conversion of plant.The codon synthetic gene that is available plant optimization is expressed to improve.
Well known in the art, other sequence modification can improve the gene expression dose in cell host.These include but not limited to, remove the tumor-necrosis factor glycoproteins of the false poly-adenosine signal of coding, exon-intron splice site signal, transposon, and other fully symbolize the sequence that may be unfavorable for genetic expression.The G-C content of sequence can be adjusted to the mean level (ML) of specifying host cell, quotes gene expression dose known in host cell and calculates.Possibly, modification sequence is to avoid the hairpin-type mRNA secondary structure of prediction.
In expression cassette or recombinant vectors, expression cassette can contain 5 ' leader sequence in addition.Described leader sequence can play a part to improve transcribes efficiency.Described leader sequence is known in the art, and includes but not limited to picornavirus leader sequence, for example EMCV leader sequence (encephalomyocarditis 5 ' non-coding region); Potato virus group leader sequence, for example tobacco etch virus (TEV) leader sequence, the short and small mosaic virus of corn (MDMV) leader sequence and human immunoglobulin heavy chain are in conjunction with albumen (BiP); From the untranslated leader of alfalfa mosaic virus coating protein mRNA (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence; With corn yellows mottle virus (MCMV) leader sequence.Can also use other known improvement to transcribe the element of efficiency, such as intron etc.
Promoter sequence of the present invention can be used to start and the messenger RNA(mRNA) (mRNA) of object heterologous nucleotide sequence transcribing of complementary antisense construct at least partly.Build antisense base sequences to hybridize with corresponding mRNA.Can hybridize and disturb it to express with corresponding mRNA as long as antisense sequences grows to, just can carry out the modification of antisense sequences.In this way, can use with corresponding antisense sequences and have 70%, preferred 80%, the antisense construct of preferred 85% sequence identity.In addition, a part for antisense base sequences can be used to destroy the expression of target gene.Generally, can use the sequence of at least 50 Nucleotide, 100 Nucleotide, 200 Nucleotide or more Nucleotide.
Promoter sequence of the present invention also can be used for the expression of transcribing to suppress endogenous gene in plant of the nucleotide sequence that starts just direction.The nucleotides sequence of applying just direction is listed in the method for inhibition of gene expression in plant and is known in the art.The method is usually directed to the DNA structure conversion of plant containing promotor, and promotor may be operably coupled to the nucleotide sequence that a few part is equivalent to endogenous gene transcription, and drives it in plant, to express.Typically, the sequence of described nucleotide sequence and endogenous gene transcription has essence Shangdi sequence identity, preferably exceed about 65% sequence identity, more preferably exceed about 85% sequence identity, most preferably exceed about 95% sequence identity.
Promoter sequence of the present invention is used to the tissue specific expression of object heterologous nucleotide sequence.The sequence that " heterologous nucleotide sequence " refers to non-natural and exist together with promoter sequence.Although described nucleotide sequence and promoter sequence are allos, may be homology or natural or allos or external source to plant host.The heterologous nucleotide sequence codified target protein matter being operationally connected with promotor of the present invention.The example of this heterologous nucleotide sequence includes but not limited to, coding is given the nucleotide sequence of following resistant polypeptides: abiotic stress is as arid, temperature, salinity, ozone and weedicide, or biology stress be attacked as pathogenic agent, comprise insect, virus, bacterium, fungi and threadworms, and prevent the disease that these organisms follow.
In the present invention, herbicide tolerance protein can be expressed resistance and/or the tolerance to weedicide.These genes include but not limited to, acetolactate synthase (ALS) gene, EPSPS gene, pat gene, GOX gene, GAT gene etc.
In the present invention, " insect-resistant " refers to that plant avoids symptom and the infringement due to interacting of plant-insect.The plant damage, farm crop infringement, plant disfigurement and the plant disease that stop insect to cause, or selectively, the plant damage being caused by insect, farm crop infringement, plant disfigurement and plant disease are reduced to minimum or alleviate.Described insect can belong to lepidopteran (as Pyrausta nubilalis (Hubern).), Hemiptera (as stinkbug), Coleoptera (as beetle), Orthoptera (as migratory locusts), Homoptera (as aphid), Diptera (as fly) etc.Well known in the art, object insect-resistant protein includes but not limited to, genus bacillus toxic protein; Lectin class, wherein lectin comprises GNA, pisum sativum agglutinin, ConA, tritin, potato lectin, peanut agglutinin etc.; Lipid oxidation enzyme, wherein lipoxidase comprises pea lipoxidase 1 or soybean lipoxidase; Insect shell polysaccharidase etc.
The insect that sucks myron or gnaw blade passes to health plant by virus from the plant infecting.Described virus includes but not limited to, rice tungro bacilliform virus, tobacco mosaic virus (TMV), the sallow short and small virus of sweet potato and sweet potato pinniform mottle virus etc.Therefore, preferably in photosynthetic tissue, express the minimized heterologous nucleotide sequence of impact that there is anti-pathogenic substance activity or make viral pathogen.
Promoter sequence of the present invention and method can be used for the expression of any object heterologous nucleotide sequence in plant host and regulate, to change the phenotype of plant.Various object phenotypes changes include but not limited to, change the fatty acid component of plant, the aminoacids content that changes plant, change phytopathogen defense mechanism etc.Above-mentioned change can obtain by the expression that the expression of allos product is provided or increases plant endogenous property product.Selectively, above-mentioned change can obtain by the expression that reduces one or more endogenous products in plant, particularly enzyme or cofactor.Above-mentioned change changes the phenotype that causes conversion of plant.
Conversion scheme and scheme that nucleotide sequence is imported to plant be according to the directed plant transforming or vegetable cell type and different, i.e. monocotyledons or dicotyledons.The appropriate methodology that nucleotide sequence is imported to vegetable cell and insert subsequently in Plant Genome includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.
The cell having transformed can grow into plant in a conventional manner.These plants are cultivated, and with identical transformant or different transformant pollinations, the crossbred obtaining is expressed required certified phenotype feature.Can cultivate two generations or many generations to guarantee the expression of stably maintenance and hereditary required phenotype feature, then results can guarantee to obtain the seed of required phenotype feature representation.
The invention provides a kind of tissue-specific promoter and uses thereof, have the following advantages:
1, separate first.Tissue-specific promoter of the present invention separates the pepc gene from Chinese maize kind Z31 first.
2, active high.Tissue-specific promoter of the present invention can improve the expression amount of object heterologous nucleotide sequence in plant photosynthesis tissue significantly, as the GUS activity value being driven by tissue-specific promoter of the present invention in blade can be up to 9897 ± 50 (pmol 4-MU/mg albumen/min), GUS dyeing is also obviously darker.
3, tissue specificity is strong.Tissue-specific promoter of the present invention improves the expression amount of object heterologous nucleotide sequence in plant photosynthesis tissue significantly, and reduce significantly the expression amount of object heterologous nucleotide sequence in the non-photosynthetic tissue of plant, as the root in non-photosynthetic tissue and spend middle expression very weak, strengthen significantly the tissue specificity that object heterologous nucleotide sequence is expressed in plant photosynthesis tissue.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 is that the recombinant cloning vector pT-prZ31PEPC (B & H) of tissue-specific promoter of the present invention and uses thereof builds schema;
Fig. 2 is that the recombinant expression vector p90005 of tissue-specific promoter of the present invention and uses thereof builds schema;
Fig. 3 is that the recombinant expression vector p90007 of tissue-specific promoter of the present invention and uses thereof builds schema;
Fig. 4 is the GUS colored graph of the transgenic corn plant blade of tissue-specific promoter of the present invention and uses thereof;
Fig. 5 is the GUS colored graph of the transgenic corn plant root of tissue-specific promoter of the present invention and uses thereof;
Fig. 6 is the GUS colored graph of the transgenic corn plant stem of tissue-specific promoter of the present invention and uses thereof;
Fig. 7 is the GUS colored graph of the transgenic corn plant pollen of tissue-specific promoter of the present invention and uses thereof.
Embodiment
Further illustrate the technical scheme of killing gene of the present invention and uses thereof below by specific embodiment.
The first embodiment, separation promoter sequence
1, the extraction of DNA
CTAB (cetyl trimethylammonium bromide) method that DNA extraction adopts according to routine: after the blade of getting the tender corn variety Z31 of 2 grams of childrens (combining 31) plant is pulverized in liquid nitrogen, add 0.5ml in the DNA extraction CTAB Buffer of 65 ℃ of preheatings of temperature (20g/L CTAB, 1.4M NaCl, 100mMTris-HCl, 20mM EDTA (ethylenediamine tetraacetic acid (EDTA)), with NaOH tune pH to 8.0), after fully mixing, in 65 ℃ of extracting 90min of temperature; Add 0.5 times of volume phenol, 0.5 times of volume chloroform, puts upside down and mixes; Centrifugal 10min under 12000rpm (rotations per minute) rotating speed; Draw supernatant liquor, add 2 times of volume dehydrated alcohols, softly rock centrifuge tube, in 4 ℃ of standing 30min of temperature; Centrifugal 10min again under 12000rpm rotating speed; Collect DNA to the pipe end; Abandon supernatant liquor, the ethanol that is 70% by 1ml mass concentration, washing precipitation; Centrifugal 5min under 12000rpm rotating speed; Vacuum is drained or is dried up at super clean bench; DNA is precipitated and dissolved in appropriate TE damping fluid (10mM Tris-HCl, 1mM EDTA, PH8.0), is kept under ℃ condition of temperature-20.
Using after 10 times of the DNA dilutions of said extracted as pcr amplification template.
2, amplification promoter region
With the known array (as shown in SEQ ID NO:2 in sequence table) of the pepc gene promotor of corn variety B73, design primer carries out pcr amplification:
Primer 1:CAACTAGGTTGCATAGGATTTCATGATTAA, as shown in SEQ ID NO:3 in sequence table;
Primer 2: GCTGGGCCCGTGGAGGTC, as shown in SEQ ID NO:4 in sequence table.
Concrete reagent and amplification condition are as follows:
Above-mentioned reaction buffer is: 200mM Tris-HCl (PH8.4), 200mM KCl, 15mM MgCl
2.
PCR reaction conditions is: 94 ℃ of denaturation 5min, then enter following circulation: 94 ℃ of sex change 0.5min, and 58 ℃ of annealing 0.5min, 72 ℃ are extended 2min, totally 30 circulations, last 72 ℃ are extended 5min.
3, sequencing
Get the above-mentioned pcr amplification product of 2 μ l and pGEM-T carrier (Promega, Madison, USA, CAT:A3600) and connect, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets.Then connect product heat shock method and transform intestinal bacteria T1 competent cell (Transgen, Beijing, China; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l connect products, 42 ℃ of water-baths 30 seconds; Cultivate 1 hour (shaking table shake under 200rpm rotating speed) for 37 ℃, scribble LB flat board (the Tryptones 10g/L of the penbritin (100mg/L) of X-gal (the chloro-3-indoles-β-D-of the bromo-4-of 5-galactoside) on surface, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH to 7.5) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, precipitation thalline suspends by the solution I (25mM Tris-HCl, 10mM EDTA, 50mM glucose, pH8.0) of 100 μ l ice precoolings; Add the solution II (0.2M NaOH, mass concentration is 1%SDS (sodium lauryl sulphate)) of the new preparation of 150 μ l, pipe is put upside down 4 times, mix, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add TE (10mMTris-HCl, 1mM EDTA, the PH8.0) dissolution precipitation of 30 μ l containing Rnase (RNA enzyme) (20 μ g/ml); Water-bath 30min at 37 ℃ of temperature, digestion RNA; ℃ save backup in temperature-20.
The plasmid extracting is cut after evaluation through BamHI and NcoI enzyme, selects positive colony, carries out sequence verification, confirms that the pepc gene promoter sequence of corn variety Z31 is as shown in SEQ ID NO:1 in sequence table.
The second embodiment, the structure of recombinant expression vector p90005 of pepc gene promoter sequence that contains corn variety Z31
1, design of primers and pcr amplification
According to the pepc gene promoter sequence of the corn variety Z31 as shown in SEQ ID NO:1 in sequence table, design primer:
Primer 3:AAGCAA
gGATCCgGATTTCATGATTAACAGTG is (with BamHI restriction enzyme site) as shown in SEQ ID NO:5 in sequence table;
Primer 4:GGATGG
aAGCTTgGCGCGGCGGGAAGCTAAGC is (with HindIII restriction enzyme site) as shown in SEQ ID NO:6 in sequence table.
Take the DNA of the plasmid of the above-mentioned pepc gene promotor that contains corn variety Z31 as template, carry out pcr amplification according to the reagent described in 2 in the first embodiment and pcr amplification condition.
2, build the recombinant cloning vector pT-prZ31PEPC (B & H) of the pepc gene promoter sequence that contains corn variety Z31
Get pcr amplification product and pGEM-T carrier (Promega described in 2 μ l the second embodiment, Madison, USA, CAT:A3600) connect, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector pT-prZ31PEPC (B & H), it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6 rna polymerase promoter; T7 is T7 rna polymerase promoter; PrZ31PEPC is the pepc gene promotor (SEQ ID NO:1 16-2310 position) of corn variety Z31; MCS is multiple clone site).Then recombinant cloning vector pT-prZ31PEPC (B & H) is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector pT-prZ31PEPC (B & H)), 42 ℃ of water-baths 30 seconds; Cultivate 1 hour (shaking table shake under 200rpm rotating speed) for 37 ℃, scribble LB flat board (the Tryptones 10g/L of the penbritin (100mg/L) of X-gal (the chloro-3-indoles-β-D-of the bromo-4-of 5-galactoside) on surface, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH to 7.5) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.
The plasmid extracting is cut after evaluation through BamHI and HindIII enzyme, positive colony is carried out to sequence verification, result show the pepc gene promoter sequence of the corn variety Z31 inserting in recombinant cloning vector pT-prZ31PEPC (B & H) be in sequence table SEQ ID NO:1 from the nucleotide sequence shown in the 16th to the 2310th Nucleotide.
Further, PEPC is one of most important enzyme in C4 photosynthesis of plant approach.By plantcare, the pepc gene promoter sequence of corn variety Z31 is analyzed, it contains a large amount of cis-acting elements relevant to photosynthesis, such as ACE, Box4, CATT-motif, G-box, GAG-motif, GATA-motif, I-box, MNF1, Sp1, as-2-box etc., mainly concentrate between the 812-2272 position of SEQID NO:1.
3, build the recombinant expression vector p90005 of the pepc gene promoter sequence that contains corn variety Z31
Restriction enzyme BamHI and HindIII respectively enzyme cut recombinant cloning vector pT-prZ31PEPC (B & H) and expression vector p90001 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the pepc gene promoter fragment of the corn variety Z31 cutting is inserted between the BamHI and HindIII site of p90001, be built into recombinant expression vector p90005, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin (ubiquitin) gene promoter; PMI: Phophomannose isomerase gene; PrZ31PEPC: the pepc gene promotor (SEQ ID NO:1 16-2310 position) of corn variety Z31; GUS: beta-glucosiduronatase gene (SEQ ID NO:7); Nos: terminator; LB: left margin).
Recombinant expression vector p90005 is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector p90005), 42 ℃ of water-baths 30 seconds; Cultivate 1 hour (shaking table shake under 200rpm rotating speed) for 37 ℃; Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH to 7.5) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme BamHI and HindIII enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector p90005 between BamHI and HindIII site classify sequence table as in SEQ ID NO:1 from nucleotide sequence, i.e. the pepc gene promoter sequence of corn variety Z31 shown in the 16th to the 2310th Nucleotide.
4, build the recombinant expression vector p90007 (positive control) of the pepc gene promoter sequence that contains corn variety B73
The method of the recombinant cloning vector pT-prZ31PEPC (B & H) of the pepc gene promoter sequence that contains corn variety Z31 according to the structure described in 2 in second embodiment of the invention, utilizes the pepc gene promoter sequence of known corn variety B73 to build the recombinant cloning vector pT-prB73PEPC (B & H) of the pepc gene promoter sequence that contains corn variety B73.Positive colony is carried out to sequence verification, result shows that the pepc gene promoter sequence of the corn variety B73 inserting in recombinant cloning vector pT-prB73PEPC (B & H) is the nucleotide sequence shown in SEQ ID NO:2 in sequence table, and the pepc gene promoter sequence of corn variety B73 correctly inserts.
The method of the recombinant expression vector p90005 of the pepc gene promoter sequence that contains corn variety Z31 according to the structure described in 3 in second embodiment of the invention, utilize the pepc gene promoter sequence of known corn variety B73 to build the recombinant expression vector p90007 of the pepc gene promoter sequence that contains corn variety B73, it builds flow process (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide) as shown in Figure 3; Kan: kanamycin gene; RB: right margin; Ubi: corn Ubiquitin gene promoter; PMI: Phophomannose isomerase gene; PrB73PEPC: the pepc gene promotor (SEQ ID NO:2) of corn variety B73; GUS: beta-glucosiduronatase gene (SEQ ID NO:7); Nos: terminator; LB: left margin).Positive colony is carried out to sequence verification, result shows that the pepc gene promoter sequence of the corn variety B73 inserting in recombinant expression vector p90007 is the nucleotide sequence shown in SEQ ID NO:2 in sequence table, and the pepc gene promoter sequence of corn variety B73 correctly inserts.
5, recombinant expression vector transforms Agrobacterium
To building correct recombinant expression vector p90005 and p90007 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes; It is under 200rpm condition, to cultivate 2 hours in 28 ℃ of temperature, rotating speed that Agrobacterium LBA4404 after transforming is inoculated in LB test tube, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, after cutting with restriction enzyme BamHI and NcoI enzyme, carry out enzyme and cut checking, result show recombinant expression vector p90005 and p90007 structure entirely true.
The 3rd embodiment, proceed to the acquisition of the milpa of the pepc gene promoter sequence of corn variety Z31
The Agrobacterium infestation method adopting according to routine, Agrobacterium described in 5 in the rataria of the corn variety of sterile culture comprehensive 3 (Z3) and the second embodiment is cultivated altogether, so that the T-DNA in 3 and 4 recombinant plant expression vector p90005 and the p90007 that build in the second embodiment (is comprised to the pepc gene promoter sequence of corn variety Z31, the pepc gene promoter sequence of corn variety B73, PMI gene and gus gene) be transferred in maize chromosome group, obtain the milpa of the pepc gene promoter sequence that proceeds to corn variety Z31 and proceeded to the milpa (positive control) of pepc gene promoter sequence of corn variety B73, simultaneously using wild-type milpa as negative contrast.
Corn for agriculture bacillus mediated tissue-specific promoter of the present invention transforms, briefly, from corn, separate immature rataria, contact rataria with agrobacterium suspension, wherein Agrobacterium can be passed to the pepc gene promotor of corn variety Z31 at least one cell (step 1: infect step) of one of rataria, and described promotor is operationally connected with object heterologous nucleotide sequence.In this step, rataria preferably immerses agrobacterium suspension (OD
660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.3)) in start inoculation.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: culturing step altogether) altogether.Preferably, rataria is infecting after step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least there is the microbiotic (cephamycin) of a kind of known inhibition Agrobacterium growth, do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, to eliminate Agrobacterium and to provide decubation as infected cell.Then, the rataria of inoculation is containing cultivating and select the transformed calli (step 4: selection step) of growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivates with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.
The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5mg/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.
The determination of activity of the pepc gene promoter sequence of the 4th embodiment, corn variety Z31
The evaluation of experiment one, gus gene copy number
The about 100mg of blade of milpa of pepc gene promoter sequence that gets respectively the milpa of the pepc gene promoter sequence that proceeds to corn variety Z31 and proceed to corn variety B73 is as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detect the copy number of gus gene by Taqman fluorescence probe quantitative PCR method.Using wild-type milpa as negative contrast, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.
The concrete grammar that detects gus gene copy number is as follows:
Step 11, the milpa of getting respectively the pepc gene promoter sequence that proceeds to corn variety Z31, the milpa of pepc gene promoter sequence that proceeds to corn variety B73 and the each 100mg of blade of wild-type milpa, in mortar, be ground into homogenate with liquid nitrogen respectively, each sample is got 3 repetitions;
The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, measure the genomic dna concentration of above-mentioned sample with NanoDrop 2000 (Thermo Scientific);
Step 14, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;
Step 15, employing Taqman fluorescence probe quantitative PCR method are identified the copy number of sample, using the sample through identifying known copy number as standard substance, contrast as negative using the sample of wild-type milpa, and 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Primer 5 (GF): GAGGACATCTCGGTTGTGACC is as shown in SEQ ID NO:8 in sequence table;
Primer 6 (GR): TGCCTTGAAAGTCCACCGTATAG is as shown in SEQ ID NO:9 in sequence table;
Probe (GP): CTTCAATGGCCCAACCGGGACTG is as shown in SEQ ID NO:10 in sequence table;
PCR reaction system is:
The each 45 μ l of every kind of primer that described 50 × primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 × TE damping fluids, and at 4 ℃, be housed in amber test tube.
PCR reaction conditions is:
Utilize SDS2.3 software (Applied Biosystems) analytical data.
Experimental result shows, the pepc gene promoter sequence of corn variety Z31 and the pepc gene promoter sequence of corn variety B73 have been incorporated in the genome of detected milpa, and proceed to the milpa of pepc gene promoter sequence of corn variety Z31 and the milpa of pepc gene promoter sequence that proceeds to corn variety B73 has all obtained the transgenic corn plant that contains single copy gus gene.
The evaluation of experiment two, GUS activity
Get respectively the milpa of the pepc gene promoter sequence that proceeds to corn variety Z31 and proceed to the blade of milpa of the pepc gene promoter sequence of corn variety B73, root, stem and spend each 100mg as sample, with reference to (Jefferson such as Jefferson, R.A., Kavanagh, T.A.and Bevan, M.W.GUS fusions:beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J., 1987, method 3901-3907), the GUS activity driving by fluorescence spectrometry PEPC with 4-methyl umbelliferone (4-MU).Be accredited as not genetically modified milpa as negative contrast using wild-type milpa with through quantitative fluorescent PCR simultaneously, detect according to the method described above analysis.Test each tissue and establish 3 repetitions, average.
The concrete grammar of measuring GUS activity is as follows:
Step 31, respectively take the milpa of the pepc gene promoter sequence that proceeds to corn variety Z31 and proceed to the pepc gene promoter sequence of corn variety B73 milpa blade, root, stem and spend each 100mg, add 500 μ l Extraction buffer (50mM NaPO
4(pH7.0), 1mM dithiothreitol (DTT) (DTT), 10mM EDTA, 0.1% sarcosyl (Sarcosyl), 0.1% Triton X-100 (Triton X-100)) in mortar, be ground into homogenate;
Step 32, under 4 ℃ of temperature, rotating speed 4000rpm after centrifugal 10min, collect supernatant liquor, at 4 ℃ of juxtapositions, preserve;
Step 33, at reaction buffer (the 50mM NaPO of 250 μ l preheatings (37 ℃, at least 30min)
4(pH7.0), 1mM dithiothreitol (DTT) (DTT), 10mM EDTA, 0.1% sarcosyl (Sarcosyl), 0.1% Triton X-100 (Triton X-100), 1mM 4-methyl umbelliferone acyl-beta-glucoside acid (MUG)) in add supernatant liquor described in 50 μ l, mix, at 37 ℃ of temperature, react after 15min, take out 30 μ l and join termination reaction in 270 μ l reaction terminating liquids (2% (m/v) sodium carbonate);
Step 34, make the typical curve (0,50,100,250,500,1000,1500 be diluted in 2% sodium carbonate with 2000pmol 4-MU) of 4-MU, measure the Ex365/Em455 value of each sample with SpectraMax M2;
Step 35, get described supernatant liquor 30 μ l, water is settled to 360 μ l, after taking out 30 μ l, add 100 μ lBCA (bicinchoninic acid) reactants (BCA protein quantification test kit), at 37 ℃ of temperature, react after 30min, then under room temperature cooling 10min;
Step 36, while, with bovine serum albumin (BSA) production standard curve (0,25,50,75,100,150,200 and 250 μ g/ml), are measured the 560nm absorbance value of each sample with SpectraMax M2;
Step 37, the picomole number of using 4-methyl umbelliferone (4-MU) and the ratio of protein content and time (pmol 4-MU/mg albumen/min) represent GUS activity.
To be accredited as not genetically modified milpa as negative contrast using wild-type milpa with through quantitative fluorescent PCR, detect according to the method described above analysis simultaneously.
The experimental result of the expression amount of transgenic corn plant gus gene is as shown in table 1.Recording respectively the milpa (Z31PEPC) of the pepc gene promoter sequence that proceeds to corn variety Z31, the pepc gene promoter sequence (B73PEPC) that proceeds to corn variety B73, wild-type milpa (WT) and being accredited as GUS activity value (pmol 4-MU/mg albumen/min) in the blade of not genetically modified milpa (NGM) through quantitative fluorescent PCR is 9897 ± 50,9675 ± 73,0 ± 13 and 0 ± 11; Proceeding to the milpa of the pepc gene promoter sequence of corn variety Z31, the pepc gene promoter sequence that proceeds to corn variety B73, wild-type milpa and being accredited as GUS activity value (pmol 4-MU/mg albumen/min) in the root of not genetically modified milpa through quantitative fluorescent PCR is 121 ± 15,144 ± 12,0 ± 21 and 0 ± 23; Proceeding to the milpa of the pepc gene promoter sequence of corn variety Z31, the pepc gene promoter sequence that proceeds to corn variety B73, wild-type milpa and being accredited as GUS activity value (pmol 4-MU/mg albumen/min) in the stem of not genetically modified milpa through quantitative fluorescent PCR is 3321 ± 52,3123 ± 46,0 ± 28 and 0 ± 26; Proceeding to the milpa of the pepc gene promoter sequence of corn variety Z31, the pepc gene promoter sequence that proceeds to corn variety B73, wild-type milpa and being accredited as the middle GUS activity value of spending of not genetically modified milpa (pmol 4-MU/mg albumen/min) through quantitative fluorescent PCR is 99 ± 13,132 ± 15,0 ± 16 and 0 ± 18.
The GUS determination of activity average result of table 1, four plants
The above results shows, in photosynthetic tissue, proceed to GUS activity value (pmol 4-MU/mg albumen/min) in the blade of milpa of the pepc gene promoter sequence of corn variety B73 and stem and be respectively 9675 ± 73 and 3123 ± 46, be respectively 9897 ± 50 and 3321 ± 52 and proceed to GUS activity value (pmol 4-MU/mg albumen/min) in the blade of milpa of the pepc gene promoter sequence of corn variety Z31 and stem, be significantly higher than the former, this result shows that the pepc gene promoter activity of corn variety Z31 is high, increase significantly the expression amount of object heterologous nucleotide sequence in plant photosynthesis tissue.
In non-photosynthetic tissue, proceed to the pepc gene promoter sequence of corn variety B73 milpa root and spend middle GUS activity value (pmol 4-MU/mg albumen/min) to be respectively 144 ± 12 and 132 ± 15, and proceed to the pepc gene promoter sequence of corn variety Z31 milpa root and spend middle GUS activity value (pmol 4-MU/mg albumen/min) to be respectively 121 ± 15 and 99 ± 13, significantly lower than the former, this result shows that the pepc gene promoter sequence of corn variety Z31 has reduced the expression amount of object heterologous nucleotide sequence in the non-photosynthetic tissue of plant significantly, strengthen significantly the tissue specificity that object heterologous nucleotide sequence is expressed in plant photosynthesis tissue.
Experiment three, GUS dyeing
Get respectively the milpa of the pepc gene promoter sequence that proceeds to corn variety Z31 and proceed to the blade of milpa of the pepc gene promoter sequence of corn variety B73, root, stem by manual section and pollen as sample, with reference to (Jefferson R.A. such as Jefferson, Burgess S.M., Hirsh D.Beta-glucuronidase from Escherichia coliasa gene fusion marker.Proc.Natl.Acad.Sci., 1986, method 83:8447-8454) has also been done suitable improvement, dye two days by 37 ℃ of sealings in dyeing solution, check the phraseology of GUS from histological chemistry.The main component of described dyeing solution is: 0.1M NaPO
4, 0.01M EDTA (pH8.0), the 0.5mM Tripotassium iron hexacyanide, 0.5mM yellow prussiate of potash, the chloro-3-indoles-β-D-of the bromo-4-of 0.5mg/ml 5-glucuronide (X-gluc).The GUS enzyme producing in the cell of express transgenic can produce X-gluc decomposition in situ blue precipitation, thereby can locate transgenosis.Chlorophyll from chlorenchyma can be with 70% ethanol decolorization several, with the blueness that helps range estimation to express from GUS.Then, tissue slice checks and takes a picture under dissecting microscope.
Be accredited as not genetically modified milpa as negative contrast using wild-type milpa with through quantitative fluorescent PCR simultaneously, detect according to the method described above analysis.
The experimental result of the GUS dyeing of transgenic corn plant is as shown in Fig. 4-7.Experimental result shows except wild-type milpa (WT) with through blade, root, stem and pollen that quantitative fluorescent PCR is accredited as not genetically modified milpa (NGM) all do not develop the color, proceed to corn variety Z31 pepc gene promoter sequence milpa (Z31PEPC) and to proceed in the blade of milpa (B73PEPC) of the pepc gene promoter sequence of corn variety B73 GUS dyeing darker; Proceed to corn variety Z31 pepc gene promoter sequence milpa and proceed in the stem of milpa of pepc gene promoter sequence of corn variety B73 and have GUS dyeing; Proceed to corn variety Z31 pepc gene promoter sequence milpa and proceed to the pepc gene promoter sequence of corn variety B73 milpa root and spend middle GUS dyeing not obvious.
The above results shows, in photosynthetic tissue, it is dark not as proceeding to the color of GUS dyeing in the blade of milpa of pepc gene promoter sequence of corn variety Z31 and stem to proceed to GUS dyeing in the blade of milpa of the pepc gene promoter sequence of corn variety B73 and stem, this result shows that the pepc gene promoter activity of corn variety Z31 is high, has increased significantly the expression amount of object heterologous nucleotide sequence in plant photosynthesis tissue.
In sum, tissue-specific promoter of the present invention separates the pepc gene from Chinese maize kind Z31 first; Simultaneously, improve significantly the expression amount of object heterologous nucleotide sequence in plant photosynthesis tissue, and reduced significantly the expression amount of object heterologous nucleotide sequence in the non-photosynthetic tissue of plant, strengthen significantly the tissue specificity that object heterologous nucleotide sequence is expressed in plant photosynthesis tissue.
It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.
Claims (14)
1. a tissue-specific promoter, is characterized in that, its nucleotide sequence following (a), (b) or sequence (c):
(a) SEQ ID NO:1 is from the nucleotide sequence shown in the 16th to the 2310th Nucleotide;
(b) nucleotide sequence shown in SEQ ID NO:1;
(c) with the nucleotide sequence of the nucleotide sequence complementation (a) or (b) limiting.
2. a mosaic gene that comprises the tissue-specific promoter claimed in claim 1 being operably connected with object heterologous nucleotide sequence.
3. mosaic gene according to claim 2, is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
4. an expression cassette that comprises the mosaic gene described in claim 2 or 3.
5. a recombinant vectors that comprises the mosaic gene described in claim 2 or 3.
6. one kind contains the corn photosynthetic tissue of the mosaic gene described in claim 2 or 3 in its cell.
7. a method of expressing object heterologous nucleotide sequence in corn, is characterized in that, comprising: by stable being integrated in maize cell of object heterologous nucleotide sequence being operably connected with tissue-specific promoter claimed in claim 1.
8. the method for expressing object heterologous nucleotide sequence in corn according to claim 7, is characterized in that, described object heterologous nucleotide sequence is expressed in photosynthetic tissue.
9. the method for expressing object heterologous nucleotide sequence in corn according to claim 8, is characterized in that, described photosynthetic tissue is mesophyll tissue.
10. the method for expressing object heterologous nucleotide sequence in corn according to claim 7, is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
11. methods of expressing object heterologous nucleotide sequence in corn according to claim 10, is characterized in that, described object heterologous nucleotide sequence coding herbicide tolerance protein.
12. methods of expressing object heterologous nucleotide sequence in corn according to claim 10, is characterized in that, described object heterologous nucleotide sequence coding insect-resistant protein.
13. 1 kinds of tissue-specific promoters claimed in claim 1 are for the purposes in corn photosynthetic tissue preferential expression object heterologous nucleotide sequence.
14. tissue-specific promoters according to claim 13, in the preferential purposes of expressing object heterologous nucleotide sequence of corn photosynthetic tissue, is characterized in that, described object heterologous nucleotide sequence coding target protein matter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110435725.XA CN102517285B (en) | 2011-12-23 | 2011-12-23 | Tissue-specific promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110435725.XA CN102517285B (en) | 2011-12-23 | 2011-12-23 | Tissue-specific promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102517285A CN102517285A (en) | 2012-06-27 |
| CN102517285B true CN102517285B (en) | 2014-05-21 |
Family
ID=46288352
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110435725.XA Active CN102517285B (en) | 2011-12-23 | 2011-12-23 | Tissue-specific promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102517285B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103013939B (en) * | 2012-12-25 | 2015-01-21 | 北京大北农科技集团股份有限公司 | Weedicide-resistant protein, coding gene and application thereof |
| CN103278502B (en) * | 2013-04-23 | 2015-12-23 | 北京大北农科技集团股份有限公司 | The detection method of promoter activity |
| CN104651360B (en) * | 2013-11-25 | 2017-07-11 | 中国农业科学院生物技术研究所 | Corn tissue's specificity promoter and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206638A (en) * | 2010-03-29 | 2011-10-05 | 中国科学院上海生命科学研究院 | Tissue specific expression promoter as well as obtaining method and application thereof |
-
2011
- 2011-12-23 CN CN201110435725.XA patent/CN102517285B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206638A (en) * | 2010-03-29 | 2011-10-05 | 中国科学院上海生命科学研究院 | Tissue specific expression promoter as well as obtaining method and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| 一个含有玉米器官专一性启动子的表达质粒的构建;杨之帆等;《湖北大学学报(自然科学版)》;19980930;第20卷(第03期);284-287 * |
| 农杆菌介导的玉米遗传转化进展;张红梅等;《作物杂志》;20001231(第06期);1-4 * |
| 张红梅等.农杆菌介导的玉米遗传转化进展.《作物杂志》.2000,(第06期),1-4. |
| 杨之帆等.一个含有玉米器官专一性启动子的表达质粒的构建.《湖北大学学报(自然科学版)》.1998,第20卷(第03期),284-287. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102517285A (en) | 2012-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2304127T3 (en) | PROMOTERS OF THE VIRUS OF THE RIZADO OF LEAF YELLOW OF CESTRUM. | |
| JP6679643B2 (en) | Plant regulatory elements and uses thereof | |
| CN103476934B (en) | The preferred promoter of root and using method | |
| AU2018204578A1 (en) | Plant regulatory elements and uses thereof | |
| CN102559677B (en) | Tissue-specific promoter and application thereof | |
| CN102517285B (en) | Tissue-specific promoter and application thereof | |
| US7074985B2 (en) | Development of a stress-responsive promoter from maize | |
| Hiroyuki et al. | Regulation of expression of rice thaumatin-like protein: inducibility by elicitor requires promoter W-box elements | |
| CN103740715A (en) | Chimeric promoter and applicaiton thereof | |
| CN104878041A (en) | Application of Yangbi big-bubble walnut transcription factor gene JsWRKY1 | |
| CN112538107B (en) | Triterpene related protein, encoding gene thereof and application of triterpene related protein in improving content of triterpene compounds in plants | |
| CN104152454B (en) | Derive from drought-induced promoter GmMYB363P and the application thereof of soybean | |
| CN103270160A (en) | Viral promoter, truncations thereof, and methods of use | |
| CN103725679B (en) | Constitutive promoter and uses thereof | |
| CN103145814B (en) | Insecticidal protein, and coding gene and use thereof | |
| US11319548B2 (en) | Cold- and water-inducible promoter from rice | |
| CN103740716B (en) | Constitutive promoter and uses thereof | |
| CN103725678B (en) | Constitutive promoter and application thereof | |
| CN104109682A (en) | Pectate lyase BnPL gene as well as promoter and application thereof | |
| CN103555716A (en) | Intron sequence for enhancing expression and application of intron sequence | |
| CN102993281B (en) | Insecticidal protein and coding gene and application thereof | |
| CN102993280B (en) | Insecticidal protein and coding gene and application thereof | |
| US11845944B2 (en) | Fungal rust-inducible promoter | |
| CN107513532B (en) | Pear constitutive expression promoter PbTMT4P and application thereof | |
| CN102993279B (en) | Insecticidal protein and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200903 Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49 Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Address before: 100193, 14, Zhongguancun Avenue, 27, Beijing, Haidian District Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd. |