CN103571925A - Specific detection primers and detection liquid phase chip for BIM gene mutation - Google Patents

Specific detection primers and detection liquid phase chip for BIM gene mutation Download PDF

Info

Publication number
CN103571925A
CN103571925A CN201210250299.7A CN201210250299A CN103571925A CN 103571925 A CN103571925 A CN 103571925A CN 201210250299 A CN201210250299 A CN 201210250299A CN 103571925 A CN103571925 A CN 103571925A
Authority
CN
China
Prior art keywords
seq
site
sequence
phase chip
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201210250299.7A
Other languages
Chinese (zh)
Other versions
CN103571925B (en
Inventor
许嘉森
刘志明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210250299.7A priority Critical patent/CN103571925B/en
Publication of CN103571925A publication Critical patent/CN103571925A/en
Application granted granted Critical
Publication of CN103571925B publication Critical patent/CN103571925B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a detection liquid phase chip and specific primers for BIM gene mutation. The liquid phase chip mainly comprises: ASPE primers comprising a 5' terminal tag sequence and a 3' terminal target gene mutational site-targeted specific primer sequence, wherein the specific primer sequence comprises deletion mutation-targeted SEQ ID NO.13, deletion mutation-targeted SEQ ID NO.14, A145G site-targeted SEQID NO.15, A145G site-targeted SEQ ID NO.16, C59T site-targeted SEQ ID NO.17, C59T site-targeted SEQ ID NO.18, T86C site-targeted SEQ ID NO.19, T86C site-targeted SEQ ID NO.20, G149C site-targeted SEQ ID NO.21, G149C site-targeted SEQ ID NO.22, and/or C104G site-targeted SEQ ID NO.23 and C104G site-targeted SEQ ID NO.24; anti-tag sequence coated microspheres; and amplification primers. According to the present invention, coincidence frequency of the detection results of the detection liquid phase chip and the sequencing method is up to 100%, and single and parallel detection on the wild-type with multiple mutational sites and the mutant-type with multiple mutational sites can be achieved.

Description

BIM detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of BIM detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
BIM gene is present on No. 2 karyomit(e)s of people, is a kind of B cell leukemia/lymphoma 2(BCL2 gene) the short apoptosis member of protein family.One of BIM genetic expression comprises BH3(BCL2-homology domain3) albumen of structural domain, by with the Bcl2-l1 of Bcl2 family, BCL-XL, BCL2A1, the combine inhibition tumor cell growth of some somatotrophic albumen such as MCL1, or and promote protein B AX, the BAK1 of the apoptosis promotion apoptosis of tumor cells that combines.BH3 structural domain is the key function territory that BIM gene plays a role, and research finds that this functional domain and TKIs play a role closely related.For example in the nonsmall-cell lung cancer (NSCLC) of TKIs medicine treated with gefitinib, need the normal expression of BIM gene, and BH3-similar medicine can obviously strengthen its result for the treatment of.The human tumor cell that a lot of kinase expressions of the mankind cause extremely can be by suppressing the expression of BIM gene or keeping the growth vigor of self by MAPK1 phosphorylation modification BIM albumen.In nearly all mankind's tumour, the activation of BIM gene expresses that for TKIs class medicine, to play a role be necessary, and the expression that suppresses BIM gene can cause TKIs resistance.Show that BIM gene plays a significant role in TKIs medicine plays a role process.
At present, BIM detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology, Affymetrix6.0 chip technology.Although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, be difficult to meet the needs of practical application, the high-throughout Affymetrix 6.0 chip technology comparative maturities that suddenly change, yet this chip technology in low-density clinical diagnosis cake core improper, be difficult to expansion in same reaction system and detect sudden change or the label sudden change that numerous biological characters are relevant.In addition, Affymetrix 6.0 chips that suddenly change are mainly more intense on chip of expression spectrum, and species are more, on sudden change chip relatively a little less than, and detect expensively, can not meet actual needs.
The BIM transgenation of target detect of the present invention, it is as shown in the table:
Figure BDA00001903645000011
Figure BDA00001903645000021
SEQ ID NO.58BIM deletion mutant
GTTGGTAGAGTTATCAATTAGGAAACCCAGTACAGAGTCTATTATAATTTAGATTGTACCTCATGATGAAGGCTAACTCAACAAACCCATCAGAACAGACACTGGAACAAAATGACATTTCTAAATACCATCCAGCTCTGTCTTCATAGGCTTCAGTGAGGTAAATCA
Figure BDA00001903645000022
Figure BDA00001903645000023
Figure BDA00001903645000024
CTGTTCTCCATAGAGGCTGTGCCATTTTACATTCCCACCAACAGGGCACAAGGGTTCCAGTTTCTCCACATACTTACCAACACTTTTTTTTTTTTTTTTTTAACAGTAGTCATCCTAGAGGATATAGGTGATCTTTCACTGTGCTTTGGATTTATATTTACTGGCTTAGATTTGTATGGCCACCACCATAGTCAAGATACAGAACAACTCAACCACAAGGATTTCTCATGATACCTTTTTATAGCCACAGCCACCTCTCTCCCTCTTCCTTGAGCATTTTGTCATATGGTCATTGGTGATTAAA
(illustrate: this sequence is since the 169th bit base, there is the deletion mutantion of 2903 bit bases, in frame, sequence is disappearance region, those skilled in the art use routine techniques means, according to the based composition before and after disappearance region, in gene pool, just can easily obtain the based composition in this disappearance region, therefore, the content of the BIM deletion mutant of target detect of the present invention is fully disclosed.）
SEQ ID NO.59 mutational site: A145G
GGGAGGTCATGCTTGGTTAATTGTTGCTAAGTAAATGGATTTTACCTTTGATTATTATTTTTCTGCCTTTATACAATGTGTTTTAGGCTTCTTTTAGACAAATAGACATTTTCCCATTACAAAGGACACTATCAGTTCTTCAGTATGGAATTTCTGTAAGAGTCAAGAAAACACACATCGGATCTTCCTACCTTTCTGTGGGGGTGTTTGAGGAGAGTGCTGTAGTAATGATTCTGTTGTAAAATGGGAAGTGTGACATTGATGGACTTAAGAATTTCTTAAAATACTGTCTTAAGCTGGCAAAACTCCTGGCATCCTCCACCTGACATAAACCAG
SEQ ID NO.60 mutational site: C59T
CTCTATGGTCTCCCTGCTTCCTGGTGTCAGCAGTGGCTGAGGGAGCCAAGCTTACACACCTCCCCCAACAACTGGACACAATAAAGCAGTGTGCACTGGGGCCCCTCTTTTGTTTGGAAAGTACCAGCAAAGCCAAGGAGAAATCTGAACTTCCAACTTACCTAGTAGAAACAGGCAGAAATCTTAGAATTGAAAAATATAATTAAACATAATTTTAAAAACAATCAGTGAATATGAGGCAAAATCAATAGAATTTACTCAATCTGAAGAGAGAGAAAATCTACTGGAAAAAAATGAACAGTCTCAGGAACTTACAGGAC
SEQ ID NO.61 mutational site: T86C
TGATTCGTGAGTAGAGTTGCCAAGACAGGTGTGGCAAGAAATAGCCCTGAGACAGGGCTGCTGGCACGCAGCTCTCCTCCTGTTCTGCCTTTCTGTGTGGACCACGAGGCAGCAGTGAGGGCTTCCCATGGAGCATGTCTCCCTTTCAGTCACACATCTTGCGCTCACAGTCACTGCCAGCCAGTTGACTGCAAGTGCTGTGTCTGTAAACCTTGCAGTGGGGACTTGACATTGCTTTCAGAG
SEQ ID NO.62 mutational site: G149C
AATCCAGGCACAGCCACAATCCAGGCACAGCCACAATCCAGGCACAGCTCTTAATTTTTTAACTTTTTATTTGAAATAATTTCAGACACACAAAAAGTTTGCAAAATAGTAGAGACACTTTTCTTATAGCCTTTACCCAGAGTACCCAGATGTTACCATTTTGCCACATTTTGCTTTATCCTTCTCCCTTCCAACTGCCACCATTCCATCCTGCCCCACATGCATGTAAGCACATCACATTTTTCTCCTGAACATTGAGAGTAAATTACCTGTTGCCCCTTGCCCCTAAATACTTCAGTGTGTATCTCCTAAAAATGAGGACATCCTCTTACCTAACCAGAGTTCAGCGA
SEQ ID NO.63 mutational site: C104G
TGAGGATGCTGAGTATTTGTGAATTTATCTCCTCTTTAAGATACAGGCCCCAGATTCTGGCCCCTGGCAGTTTCCCTGCATTGTCTTGAGTCTGGAGCTTTCTCCTTGGGTGGGTCTCAGAAATCTTACTGATTTCTGCTTTTTTGCCCACTAAAGGAGATAATTTCACTGCTAAACGGGTCAAATTCTCTTCTGAGGATGGGTCTAAATTCTTGCTAAATATACCTGAATTAACTCTGTCACTGTCTAAATATTTGTGTGTCCCCATAAATTCCTATGTTGAAATCCTAACCCC
Summary of the invention
One of object of the present invention is to provide BIM gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection BIM gene six kinds of common genotype deletion mutantions, A145G, C59T, T86C, G149C and C104G.
Realize above-mentioned purpose technical scheme as follows.
A gene mutation detection liquid-phase chip, includes
(A). the wild-type designing respectively for the different mutational sites of BIM gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.13 and the SEQ ID NO.14 of deletion mutantion, SEQ ID NO.15 and SEQ ID NO.16 for A145G site, SEQ ID NO.17 and SEQ ID NO.18 for C59T site, SEQ ID NO.19 and SEQ ID NO.20 for T86C site, SEQ ID NO.21 and SEQ ID NO.22 for G149C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in C104G site, described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.12,
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.25～SEQ ID NO.36, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
Therein in an embodiment, described amplimer is: for SEQ ID NO.37, SEQ ID NO.38 and the SEQ ID NO.39 of deletion mutantion, SEQ ID NO.40 and SEQ ID NO.41 for A145G site, SEQ ID NO.42 and SEQ ID NO.43 for C59T site, SEQ ID NO.44 and SEQ ID NO.45 for T86C site, for SEQ ID NO.46 and the SEQ ID NO.47 in G149C site, and/or for SEQ ID NO.48 and the SEQ ID NO.49 in C104G site.
Therein in an embodiment, described ASPE primer is: the sequence forming for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.13 of deletion mutantion and SEQ ID NO.2 and SEQ ID NO.14, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.15 in A145G site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.16, for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.17 in C59T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.18, for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.19 in T86C site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.20, for the sequence being formed by SEQ ID NO.9 and SEQ ID NO.21 in G149C site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.22, and/or for the sequence being formed by SEQ ID NO.11 and SEQ ID NO.23 in C104G site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.24.
Another object of the present invention is to provide the Auele Specific Primer for BIM detection in Gene Mutation.
Auele Specific Primer for BIM detection in Gene Mutation, described Auele Specific Primer is: for SEQ ID NO.13 and the SEQ ID NO.14 of deletion mutantion, SEQ ID NO.15 and SEQ ID NO.16 for A145G site, SEQ ID NO.17 and SEQ ID NO.18 for C59T site, SEQ ID NO.19 and SEQ ID NO.20 for T86C site, for SEQ ID NO.21 and the SEQ ID NO.22 in G149C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in C104G site.
Major advantage of the present invention is:
1. the identical rate of the detected result of BIM gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%.And detect the needed time well below conventional sequencing technologies, realistic especially application needs.Prepared BIM gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, 6 kinds of mutational sites are detected and can be completed the amplification of 6 target sequences that contain mutational site by a step PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1BIM gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for BIM gene six kinds of common genotype deletion mutantions, A145G, C59T, T86C, G149C and C104G, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1BIM gene
Figure BDA00001903645000061
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence.Tag sequence of the present invention is when choosing, avoid various tag sequences as far as possible, anti-tag sequence, cross reaction between specific primer sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag sequence may form from different ASPE primer sequences, simultaneously, can also meet the primer in the various mutations site in detection system and the specificity requirement of PCR product parallel detection, thereby realize parallel detection various mutations type in same reaction system, in whole parallel detection system, avoid cross reaction, and make the specificity of liquid-phase chip testing product of the present invention, between sensitivity and repeatability, reach and optimize and balance, accurately distinguish the genotype of various types.On 12 kinds of microballoons numberings selecting and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
Figure BDA00001903645000071
12 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of 5-10 T of the preceding paragraph, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10 6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris(pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/LEDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For BIM gene six kinds of common genotype deletion mutantions, A145G, C59T, T86C, G149C and C104G, design of amplification primers is to (in Table 3), wherein, for A145G, C59T, T86C, G149C and C104G site, amplify respectively 5 corresponding target sequences, for deletion mutantion, detect, if sample to be checked is wild-type homozygote, amplify the product of 191bp, if sample to be checked is saltant type homozygote, amplify the product of 144bp, if sample to be checked is heterozygote, amplify two kinds of products simultaneously.
Table 3 amplifies the primer of the target sequence with mutational site
Figure BDA00001903645000081
Figure BDA00001903645000091
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
The detection of BIM gene mutation detection liquid-phase chip described in embodiment 2 utilization embodiment 2 to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
Figure BDA00001903645000092
2 * Tm hybridization buffer
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 6 pairs of primers, multiplex PCR one step amplifies 6 respectively containing six kinds of common genotype deletion mutantions of BIM gene, A145G, C59T, T86C, the target sequence of G149C and C104G, for deletion mutantion, detect, if sample to be checked is wild-type homozygote, amplify the product of 191bp, if sample to be checked is saltant type homozygote, amplify the product of 144bp, if sample to be checked is heterozygote, amplify two kinds of products simultaneously, other five kinds of genotype product sizes are respectively 336bp, 320bp, 243bp, 350bp, 295bp, primer sequence (SEQ ID NO.37-49) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.37-49 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Figure BDA00001903645000101
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Figure BDA00001903645000111
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 10 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments BIM gene mutation site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments BIM genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible BIM gene mutation detection liquid-phase chip provided by the present invention can detect the mutation type of BIM exactly, and result is reliable and stable.
Table 4 pattern detection result (MFI)
Figure BDA00001903645000121
Table 5 sample B IM transgenation ratio (%)
Figure BDA00001903645000131
Table 6 sample B IM gene mutation type analytical results
Figure BDA00001903645000132
Figure BDA00001903645000141
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to BIM gene mutation site
One, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)
Take BIM Gene A 145G, C59T, G149C and C104G site mutation, to detect liquid-phase chip be example, respectively for the wild-type of A145G, C59T, G149C and C104G and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.12, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.25-SEQ ID NO.36.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
Figure BDA00001903645000142
Figure BDA00001903645000151
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 61-80 by testing process described in embodiment 4 and method, and detected result is as follows:
Table 8 sample B IM Gene A 145G detected result and Polymorphism Analysis
Figure BDA00001903645000152
Figure BDA00001903645000161
Table 9 sample B IM gene C 59T detected result and Polymorphism Analysis
Figure BDA00001903645000171
Table 10 sample B IM gene G149C detected result and Polymorphism Analysis
Figure BDA00001903645000172
Table 11 sample B IM gene C 104G detected result and Polymorphism Analysis
Figure BDA00001903645000182
Figure BDA00001903645000191
From the present embodiment, for the liquid-phase chip in different mutational sites, ASPE primer uses different tag sequence in table 1, and its result is still reliable and stable.And ASPE primer is while selecting described in embodiment 1 in liquid-phase chip tag sequence and specific primer sequence collocation, effect better (signal to noise ratio is better), referring to the present embodiment test group 2, test group 6, test group 9 and test group 12.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.The selection of embodiment 4BIM detection in Gene Mutation specific primer sequence
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
It is example that the pleomorphism site of BIM gene T86C and G149C of take detects liquid-phase chip, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of T86C and G149C and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein,
Figure BDA00001903645000192
interior base is pleomorphism site.
Table 12 specific primer sequence
Figure BDA00001903645000193
Figure BDA00001903645000201
It is example that the pleomorphism site of BIM gene T86C and G149C of take detects liquid-phase chip, for T86C and G149C, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 2, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 13).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Two of design prepared by table 13 liquid-phase chip
Figure BDA00001903645000202
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 81-100 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 14 sample B IM gene T86C detected result and Polymorphism Analysis
Table 15 sample B IM gene G149C detected result and Polymorphism Analysis
Figure BDA00001903645000212
Figure BDA00001903645000221
From the present embodiment, when ASPE primer is selected in embodiment 2 collocation of specific primer sequence and tag sequence, detect effect more than other Auele Specific Primer good (signal to noise ratio is better), result is more accurately and reliably.Referring to the present embodiment test group 13 and test group 16.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Figure IDA00001903645500011
Figure IDA00001903645500021
Figure IDA00001903645500031
Figure IDA00001903645500041
Figure IDA00001903645500051
Figure IDA00001903645500061
Figure IDA00001903645500071
Figure IDA00001903645500081
Figure IDA00001903645500091
Figure IDA00001903645500101
Figure IDA00001903645500111
Figure IDA00001903645500121
Figure IDA00001903645500131

Claims (5)

1. a BIM gene mutation detection liquid-phase chip, is characterized in that, includes
(A). the wild-type designing respectively for the different mutational sites of BIM gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.13 and the SEQ ID NO.14 of deletion mutantion, SEQ ID NO.15 and SEQ ID NO.16 for A145G site, SEQ ID NO.17 and SEQ ID NO.18 for C59T site, SEQ ID NO.19 and SEQ ID NO.20 for T86C site, SEQ ID NO.21 and SEQ ID NO.22 for G149C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in C104G site, described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.12,
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.25～SEQ ID NO.36, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
2. BIM gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is: for SEQ ID NO.37, SEQ ID NO.38 and the SEQ ID NO.39 of deletion mutantion, SEQ ID NO.40 and SEQ ID NO.41 for A145G site, SEQ ID NO.42 and SEQ ID NO.43 for C59T site, SEQ ID NO.44 and SEQ ID NO.45 for T86C site, for SEQ ID NO.46 and the SEQ ID NO.47 in G149C site, and/or for SEQ ID NO.48 and the SEQ ID NO.49 in C104G site.
3. BIM gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is: the sequence forming for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.13 of deletion mutantion and SEQ ID NO.2 and SEQ ID NO.14, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.15 in A145G site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.16, for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.17 in C59T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.18, for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.19 in T86C site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.20, for the sequence being formed by SEQ ID NO.9 and SEQ ID NO.21 in G149C site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.22, and/or for the sequence being formed by SEQ ID NO.11 and SEQ ID NO.23 in C104G site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.24.
4. BIM gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of BIM detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is, SEQ ID NO.13 and SEQ ID NO.14 for deletion mutantion, SEQ ID NO.15 and SEQ ID NO.16 for A145G site, SEQ ID NO.17 and SEQ ID NO.18 for C59T site, SEQ ID NO.19 and SEQ ID NO.20 for T86C site, for SEQ ID NO.21 and the SEQ ID NO.22 in G149C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in C104G site.
CN201210250299.7A 2012-07-18 2012-07-18 Specific detection primers and detection liquid phase chip for BIM gene mutation Active CN103571925B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210250299.7A CN103571925B (en) 2012-07-18 2012-07-18 Specific detection primers and detection liquid phase chip for BIM gene mutation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210250299.7A CN103571925B (en) 2012-07-18 2012-07-18 Specific detection primers and detection liquid phase chip for BIM gene mutation

Publications (2)

Publication Number Publication Date
CN103571925A true CN103571925A (en) 2014-02-12
CN103571925B CN103571925B (en) 2015-06-17

Family

ID=50044634

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210250299.7A Active CN103571925B (en) 2012-07-18 2012-07-18 Specific detection primers and detection liquid phase chip for BIM gene mutation

Country Status (1)

Country Link
CN (1) CN103571925B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
贺韦东等: "BIM在EGFR突变非小细胞肺癌中的表达及其意义", 《山东大学学报（医学版）》, vol. 49, no. 12, 31 December 2011 (2011-12-31) *
陈玮: "液相芯片技术的原理与应用进展", 《成都医学院学报》, vol. 3, no. 3, 30 September 2008 (2008-09-30) *

Also Published As

Publication number Publication date
CN103571925B (en) 2015-06-17

Similar Documents

Publication Publication Date Title
CN103571923B (en) Detection probes and detection liquid phase chip for BIM gene deletion mutation
CN103451271B (en) THADA gene mutation detection specific primer and liquid phase chip
CN103451267A (en) TERT gene mutation detection specific primers and liquid chip
CN103571925B (en) Specific detection primers and detection liquid phase chip for BIM gene mutation
CN103865991B (en) XRCC2 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374607B (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN103571919B (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN103865986B (en) CDKN1A detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103849943A (en) Specific primer and liquid phase chip for detecting MC1R gene mutation
CN103451273B (en) TGM5 gene mutation detection specific primer and liquid phase chip
CN103571924B (en) Specific detection primers and liquid phase chip for IKZF1 gene mutation
CN103571918A (en) Specific detection primers and detection liquid phase chip for FYCO1 gene mutation
CN103865990B (en) CDKN1B detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN103849940A (en) Specific primer and liquid phase chip for detecting BARD1 gene mutation
CN103571921B (en) Specific detection primers and detection liquid phase chip for MSMB gene mutation
CN103374600B (en) Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN103571917A (en) Specific detection primers and detection liquid phase chip for ADH1B gene mutation
CN103571926A (en) Specific detection primers and detection liquid phase chip for chromosome Xp11.22 segment polymorphism
CN103571922A (en) Specific detection primers and detection liquid phase chip for SLC22A3 gene mutation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant