CN103374600B - Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection - Google Patents
Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection Download PDFInfo
- Publication number
- CN103374600B CN103374600B CN201210105763.3A CN201210105763A CN103374600B CN 103374600 B CN103374600 B CN 103374600B CN 201210105763 A CN201210105763 A CN 201210105763A CN 103374600 B CN103374600 B CN 103374600B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- site
- snp
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a liquid-phase chip for chromosome 13q22 region SNP detection. The liquid-phase chip mainly comprises: ASPE primers composed of tag sequences of 5' end and sequences of specific primers for SNP sites of target genes of 3' end, wherein the sequences of the specific primers are SEQ ID No.1 and SEQ ID No.2 for A94G site, and/or SEQ ID No.3 and SEQ ID No.4 for G288A site; microballoons coated by anti-tag sequences; and amplimers. The liquid-phase chip for chromosome 13q22 region SNP detection and a sequencing method reach 100% agreement in detection results, and parallel detection of wide type and SNP type of a plurality of SNP sites can be realized.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of karyomit(e) 13q22 section SNP detection specificity primer and the liquid-phase chip of relating to.
Background technology
Target detect of the present invention mutational site is positioned the non-genomic region of karyomit(e) 13q22.1, the people such as Petersen in 2010 pass through whole-genome association (genome-wide association study on Nat Genet, GWAS) disclose, the generation of target detect of the present invention mutational site and kinds cancer, develop closely related, at present, the susceptible risk of this mutational site and carcinoma of the pancreas has become study hotspot.
The karyomit(e) 13q22 section SNP site of target detect of the present invention, it is as shown in the table:
SEQ ID NO.25 (note: the base in square frame is target detect SNP site) SNP site: A94G
ACTGCTCCAAGAGGTTATCTGTGTCCTGCCAGGACTCCCATCTACAGGACGGTAGATTAAGTGTCATGATAGAGAAGGCACAGGTGTGATAGA
GTGCAGCAAGGGCAGCACGTGCATCAGACAAGAAGACAACTTTACCTACTGAGGATTGGGCTGACGAAGTTGAAGAGGGAAAAATTCTTGCTGAATCTATCAACTCCAACCTTGAGCCCACAAAGAGTTCCTTTGAATGCCCTCCCTTCTAGCCAGTCTTTAGGAATCACTCCTGATCCCAGCACCTT。
SEQ ID NO.26 SNP site: G288A
AAGTGCTGGTATTACAGGCGTGAGACACCATGCCGGCCTGAAGGTATACTTTAAATATTGAAATATAATACATTGGAATTCTAAAATTAAAAAGACTGGGAACAGTTTGAAGGCAAGAGGAATTATCATTGTTTTATGTTTAGATTCCTAGTGATTAGCACTCTAAATGTGTGCTACAAGTAATTATTGAGTGAAGGCCTCTTCAGCATGTGTTTACTTATTTCTCAAGCAAAGGAATCAATGAAAATATAGAGAAAAGCCAGTTACATTACAGAACTTCCTTGATG
GGAAGGGGCCCTAGTGATCTTTCTGAGGTAATGAAAATAGTCTATTTCTTAGTTACTGGGTATGTTCCTAGCTAAAAATTACTCTAGCTGCATACTAAAAATTTGTACATTTTACTGTTGTAAATTATACATCAAAAACCAAGACCAAAACCACACAAGA。
Still do not find to detect at present the launch of karyomit(e) 13q22 section gene pleiomorphism both at home and abroad, report about this gene pleiomorphism is also very few, and most report is still in the experimental study stage, existing detection technique is mainly based upon on the basis of round pcr, as direct sequencing, PCR-RFLP technology, the methods such as tradition solid phase chip, tradition solid phase chip exists expensive, the defect of poor repeatability, the sequencing of PCR-based and RFLP technology exist sample easily to pollute, the shortcoming that false positive rate is high, simultaneously, because the limitation that detects flux can not meet clinical needs.
Summary of the invention
One of object of the present invention is to provide karyomit(e) 13q22 section SNP and detects liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of two kinds of common genotype A94G of parallel detection karyomit(e) 13q22 section and G288A.
Realize above-mentioned purpose technical scheme as follows:
A kind of karyomit(e) 13q22 section SNP detects liquid-phase chip, includes:
(A). the wild-type designing respectively for the different SNP of karyomit(e) 13q22 section site and the ASPE primer of saltant type: every kind of ASPE primer is made up of for the specific primer sequence in goal gene SNP site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.1 and the SEQ ID NO.2 in A94G site, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site; Described tag sequence is selected from SEQ ID NO.5～SEQ ID NO.10;
(B). be coated with microballoon anti-tag sequence, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.11～SEQ ID NO.16, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). need primer detection, that there is the target sequence in corresponding SNP site for amplifying.
In an embodiment, described amplimer is therein: for SEQ ID NO.17 and the SEQ ID NO.18 in A94G site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in G288A site.
Therein in an embodiment, described ASPE primer is: for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.1 in A94G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.2, and/or for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.3 in G288A site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.4.
Another object of the present invention is to provide a kind of Auele Specific Primer detecting for karyomit(e) 13q22 section SNP.
The technical scheme that realizes above-mentioned purpose is as follows:
The Auele Specific Primer detecting for karyomit(e) 13q22 section SNP, described Auele Specific Primer is: for SEQ ID NO.1 and the SEQ ID NO.2 in A94G site, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site.
Major advantage of the present invention is: 1. the karyomit(e) 13q22 section SNP detection detected result of liquid-phase chip provided by the present invention and the identical rate of sequencing are up to 100%.And detect the needed time well below conventional sequencing technologies, realistic especially application needs.Prepared karyomit(e) 13q22 section SNP detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in multiple SNP site.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can sensitively be identified the SNP site of target detect specifically, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus SNP situation, the also sudden change situation in the multiple SNP of parallel detection site simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, the amplification that can complete by a step PCR 2 target sequences that contain SNP site is detected in 2 kinds of SNP sites, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR are avoided, thereby can greatly improve Detection accuracy, embody accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1 karyomit(e) 13q22 section SNP detects liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of two kinds of common genotype A94G of karyomit(e) 13q22 section and G288A, design respectively specific primer sequence.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (specific primer sequence) of table 1 karyomit(e) 13q22 section
The ASPE primer sequence (tag sequence) of table 2 karyomit(e) 13q22 section
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence (as shown in Table 2 above) for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 6 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 3:
Corresponding anti-tag sequence on table 3 microballoon numbering and microballoon
6 kinds of microballoons selecting, purchased from Luminex company of the U.S., are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH
2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10
6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 DEG C keeps in Dark Place.
Three, amplify the primer of the target sequence that contains SNP site
For two kinds of common genotype A94G of karyomit(e) 13q22 section and G288A, design of amplification primers, to (in table 4), amplifies 2 target sequences that contain two SNP sites.
Table 4 amplifies the primer of the target sequence with SNP site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
It is as follows that embodiment 2 uses karyomit(e) 13q22 section SNP described in embodiment 1 to detect the formula of the detection described various solution of liquid-phase chip to sample:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
After filtration, be stored in 4 DEG C.
ExoSAP-IT test kit is purchased from USB company of the U.S..
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to " molecular cloning " about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 2 pairs of primers, multiplex PCR one step amplifies the 2 objective sequences that contain respectively two kinds of common genotype A94G of karyomit(e) 13q22 section and G288A, product size is respectively 282bp and 448bp, and primer sequence (SEQ ID NO.17-20) is shown in shown in above-mentioned table 4.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.17-20 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the designed ASPE primer of table 5 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
ASPE combination of primers (tag sequence+specific primer sequence) in table 5 embodiment 2
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
According to design ASPE primer, the microballoon (as described in embodiment 1 and table 5) of the corresponding 4 kinds of coated anti-tag sequences of every group selection, every kind of microballoon concentration is 2.5 × 10
5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 DEG C, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 6, table 7 and table 8.Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 represent with 0);
3. meet the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments karyomit(e) 13q22 section SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with liquid-phase chip result and compare with sequencing, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments karyomit(e) 13q22 sector type detected result and the sequencing result rate of coincideing originally and reaches 100%.Visible karyomit(e) 13q22 section SNP detection liquid-phase chip provided by the present invention can detect the SNP type of karyomit(e) 13q22 section exactly, and result is reliable and stable.
Table 6 pattern detection result (MFI)
Table 7 sample dyeing body 13q22 section SNP ratio (%)
Table 8 sample dyeing body 13q22 section SNP type analysis result
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to karyomit(e) 13q22 section SNP site
One, the design (selection of Tag sequence and Anti-Tag sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking karyomit(e) 13q22 section A94G and G288A site SNP, respectively for the wild-type of A94G and G288A and the specific primer sequence of SNP type design ASPE primer 3 ' end, the Tag5 sequence of ASPE primer 5 ' end is selected from SEQ ID NO.5-SEQ ID NO.10, accordingly, the anti-tag sequence with corresponding t ag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.11-SEQ ID NO.16.Specific design is as shown in following table (table 9).Synthetic, the ant i-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 9 liquid-phase chip
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample sequence number 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 10 sample dyeing body 13q22 section A94G detected result and Polymorphism Analysis
Table 11 sample dyeing body 13q22 section G288A detected result and Polymorphism Analysis
From above-described embodiment, Tag sequence is combined into ASPE primer applicable to different Auele Specific Primers, for described detection system.Other is for the liquid-phase chip in different SNP sites, and ASPE primer uses different Tag sequences, and its result is still reliable and stable.And ASPE primer is while selecting in embodiment 2 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4 karyomit(e) 13q22 section SNP detection specificity primer sequences
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking the SNP site of karyomit(e) 13q22 section G288A, taking the complementary sequence forward or backwards of this place, SNP site target sequence as template, respectively for the wild-type of G288A and the specific primer sequence of SNP type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein,
interior base is SNP site.
Table 12 specific primer sequence
Detect liquid-phase chip as example taking the SNP site of karyomit(e) 13q22 section G288A, select different specific primer sequences for G288A, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 2, and select the anti-tag sequence of answering in contrast, specific design is if following table is (as shown in table 13.Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 13 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 10 pattern detection result and gene mutation analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 7.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detects effect also better, and concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (5)
1. karyomit(e) 13q22 section SNP detects a liquid-phase chip, it is characterized in that, includes:
(A). the wild-type designing respectively for the different SNP of karyomit(e) 13q22 section site and the ASPE primer of saltant type: every kind of ASPE primer is made up of for the specific primer sequence in goal gene SNP site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site, or described specific primer sequence is: for SEQ ID NO.1 and the SEQ ID NO.2 in A94G site, and for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site; Described tag sequence is selected from SEQ ID NO.5～SEQ ID NO.10;
(B). be coated with microballoon anti-tag sequence, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.11～SEQ ID NO.16, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). need primer detection, that there is the target sequence in corresponding SNP site for amplifying,
Described amplimer is for the SEQ ID NO.19 in G288A site and SEQ ID NO.20, or described amplimer is SEQ ID NO.17 and SEQ ID NO.18 for A94G site, and for SEQ ID NO.19 and the SEQ ID NO.20 in G288A site.
2. karyomit(e) 13q22 section SNP according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: for the sequence being made up of SEQ ID NO.7 and SEQ ID NO.3 in G288A site and the sequence that is made up of SEQ ID NO.8 and SEQ ID NO.4; Or be for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.1 in A94G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.2, with for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.3 in G288A site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.4.
3. karyomit(e) 13q22 section SNP according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.1 in A94G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.2, and for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.3 in G288A site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.4.
(B). be coated with microballoon anti-tag sequence, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.11～SEQ ID NO.16, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.17 and the SEQ ID NO.18 in A94G site, and for SEQ ID NO.19 and the SEQ ID NO.20 in G288A site.
4. detect liquid-phase chip according to the arbitrary described karyomit(e) 13q22 section SNP of claim 1-3, it is characterized in that, described spacerarm is 5-10 T.
5. the Auele Specific Primer detecting for karyomit(e) 13q22 section SNP, it is characterized in that, described Auele Specific Primer is: for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site, or be for the SEQ ID NO.1 in A94G site and SEQ ID NO.2 with for SEQ ID NO.3 and the SEQ ID NO.4 in G288A site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210105763.3A CN103374600B (en) | 2012-04-11 | 2012-04-11 | Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210105763.3A CN103374600B (en) | 2012-04-11 | 2012-04-11 | Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103374600A CN103374600A (en) | 2013-10-30 |
| CN103374600B true CN103374600B (en) | 2014-11-26 |
Family
ID=49460432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210105763.3A Expired - Fee Related CN103374600B (en) | 2012-04-11 | 2012-04-11 | Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103374600B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
-
2012
- 2012-04-11 CN CN201210105763.3A patent/CN103374600B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| "A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33";Gloria M Petersen1 et.al.;《NATURE GENETICS》;20100124;第42卷(第3期);第224-228页 * |
| Gloria M Petersen1 et.al.."A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33".《NATURE GENETICS》.2010,第42卷(第3期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103374600A (en) | 2013-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451271B (en) | THADA gene mutation detection specific primer and liquid phase chip | |
| CN103451267B (en) | TERT detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103031369B (en) | CDKN2A gene mutation detection specific primer and liquid chip | |
| CN103374600B (en) | Specific primers and liquid-phase chip for chromosome 13q22 region SNP detection | |
| CN103374599B (en) | Specific primers and liquid-phase chip for ITGA9 gene mutation detection | |
| CN103451272A (en) | BAT3 gene mutation detection specific primer and liquid phase chip | |
| CN103865986B (en) | CDKN1A detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103865991B (en) | XRCC2 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN103451270B (en) | ITGA6 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103374602B (en) | Specific primers and liquid-phase chip for HLA-F gene mutation detection | |
| CN103374611B (en) | LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip | |
| CN103571921B (en) | Specific detection primers and detection liquid phase chip for MSMB gene mutation | |
| CN102994623B (en) | STK11 gene mutation detection specificity primer and liquid chip thereof | |
| CN103849940A (en) | Specific primer and liquid phase chip for detecting BARD1 gene mutation | |
| CN103451273B (en) | TGM5 gene mutation detection specific primer and liquid phase chip | |
| CN103374608B (en) | MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip | |
| CN103571922B (en) | SLC22A3 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN103849675B (en) | RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103849943A (en) | Specific primer and liquid phase chip for detecting MC1R gene mutation | |
| CN103451269B (en) | PDLIM5 gene mutation detection specific primer and liquid phase chip | |
| CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
| CN103451266B (en) | NKX3.1 gene mutation detection specific primers and liquid chip | |
| CN103865985B (en) | BRCA1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C53 | Correction of patent for invention or patent application | ||
| CB02 | Change of applicant information |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD. |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141126 Termination date: 20150411 |
|
| EXPY | Termination of patent right or utility model |