CN103215279A - Potassium channel protein gene, and encoded protein and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly discloses a potassium channel protein gene, encoded protein of the gene, and an application of the gene in potassium absorption and salt tolerance of plants. The gene derives from salicornia europaea, and is named as SeAKT1; the gene has a K<+> absorption function, so that a K<+> use ratio of transgenic arabidopsis in 3-millimeter and 100-micrometer K<+> environments; the gene is a double-affinity potassium channel protein which indicates that the gene has an application value of efficient potassium utilization of crops, so that the application of a potassium fertilizer can be reduced, and the production cost is lowered; the gene can also improve the K<+> absorption capacity of the transgenic arabidopsis under the conditions of potassium deficiency and salt stress; the consumption of Na<+> is reduced, and K<+>/Na<+> is improved, so that the salt tolerance of the plants is improved; and the characteristics improving the low soil potassium resistance and the salt tolerance of transgenic plants can be applied on the crops by a transgenic technology, so that the problems of increasingly-severe low soil potassium and salinization are solved.

Description

A kind of potassium-channel proteins gene, its encoded protein and application thereof

Technical field

The invention belongs to biological technical field.The present invention relates to the application aspect efficient utilization of plant potassium and salt tolerance of a kind of potassium-channel proteins gene, its encoded protein and this gene.

Background technology

Potassium is one of necessary for plant growth macronutrient, is distributed widely in each tissue and organ of plant, is the abundantest monovalent cation of vegetable cell intensive amount.Potassium plays an important role in the numerous physiological functions of plant, as keeps the cell plasma balance, regulates cell turgor, regulates the active of various enzymes and participate in protein synthesis etc., and it is most important to plant-growth to keep height and metastable potassium content.Tangible potassium deficiency symptom can appear in the plant potassium deficiency, shows as easy lodging, the easy dehydration of blade, and drought-enduring salt tolerance reduces, yellow leaf and tissue necrosis etc.The arable soil potassium deficiency can cause crop yield and quality to decline to a great extent.Therefore, keeping in the growing process potassium nutrition supplies with very important.The major part of China is ploughed for the potassium deficiency, and wherein the severe potassium deficiency soil is about 2,000 ten thousand hectares, accounts for more than 20% of total cultivated area.And, China's potassium ore resources scarcity, the annual production of potash fertilizer is very limited, and the potassium deficiency situation is having a strong impact on China's Agricultural Development.

Simultaneously, the soil salinization is a global ecological problem.Excessive sodium ion has toxic action to the growth of plant, and most of farm crop can not normal growth under the salt stress state, shows as hypoevolutism, and percentage of germination reduces, and organ growth and differentiation are suppressed, and metabolism such as slows down at symptom.The soil salinization not only can cause grain drop in production, also is the one of the main reasons of the desertification of land and the degeneration of ploughing, and is seriously restricting agriculture production.

Studies show that, there is notable difference in the different varieties of different types of plant or kindred plant to the physiological response of soil potassium deficiency and salt stress and to the efficient that absorbs of potassium, and this otherness can heredity, illustrates that this proterties of plant controlled by gene.Under hypersaline environment, still have the potassium receptivity, and then keep high K ⁺/ Na ⁺Than the key factor that is the salt tolerance of decision plant.Therefore, plant potassium receptivity and its salt tolerance are closely bound up.Since the nineties in 20th century, many responsible plant potassium absorb and the potassium-channel gene and the kalium ion transport protein gene of transhipment are cloned in succession and identified.Wherein, potassium-channel plays an important role in plant potassium absorbs, research potassium-channel gene, and for we go deep into being familiar with and understanding the absorption of making potassium in the object and utilize mechanism, and then the effective rate of utilization of raising potassium has positive effect.At present, the potassium-channel of more existing plants cloned and identifies out, as OsAKT1 (paddy rice), and AKT1 (Arabidopis thaliana), ZMK1(corn), MIRK (muskmelon) and MKT1 (ice plant) etc.Yet these gene major parts are from glycophyte, and majority is to Na ⁺Sensitivity is comprising the MKT1 from halophytes.At soil not only potassium deficiency but also have under the saliferous situation, have only Na ⁺Insensitive potassium translocator just can work orderly, and therefore render transgenic crop not only low-kalium resistant but also salt tolerant are considered to separate Na from true halophytes salicornia europaeal ⁺Insensitive potassium transporter gene.So it is experiment material that this patent adopts dicotyledonous halophytes salicornia europaeal.

Salicornia europaeal (Salicornia europaea): annual dicotyledonous herbaceous plant, Chenopodiaceae salicornia europaeal belong to, and generally are born in the saltings, the seashore is taken up in the salt lake.The salicornia europaeal platymiscium is one of Lu Sheng higher plant monoid of salt tolerant on the earth of reporting up to now, and it also can absorb potassium ion under the 600mM salt concentration conditions, keep plant normal growth.(the salicornia europaeal seed is adopted in the saltings on sub-seashore, municipalization city, Dalian, and plants in the laboratory, regularly irrigates with the 1/2Hoagland nutritive medium that contains 300mM NaCl.Cultivate under the natural condition).

Summary of the invention

In order to address the above problem, the present invention discloses the application aspect absorption of plant potassium and salt tolerance of a kind of potassium-channel proteins gene, its proteins encoded and this gene.This gene is separated from salicornia europaeal, has K ⁺Absorptive function is an a kind of pair of affinity potassium channel protein.This is indicating that it in the using value of farm crop potassium aspect efficiently utilizing, can reduce using of potash fertilizer, thereby reduce production costs.This gene can improve the K of transgenic arabidopsis at potassium deficiency and condition of salt stress ⁺Receptivity reduces simultaneously to Na ⁺Absorption, improved K ⁺/ Na ⁺Thereby, improved the salt tolerance of plant.The characteristic of low potassium of the anti-soil of this raising transgenic plant and salt tolerant can be applied on the farm crop by transgenic technology, thus serious day by day soil potassium deficiency and the salinification problem of reply.

Technical scheme of the present invention is as follows:

One of purpose of the present invention is to provide the gene of the potassium-channel proteins with potassium absorptive function, and this gene is separated from salicornia europaeal, has one of following nucleotide sequences:

1. this gene has SEQ ID NO.17 in the sequence table or its from the base sequence shown in 38～2614 at the 5 ' end;

2. SEQ ID NO.17 or its have the homology 95% or more and the base sequence of the same protein of encoding from the base sequence shown in 38～2614 at the 5 ' end in this gene and the sequence table.

Two of purpose of the present invention has been to provide the proteins encoded with potassium-channel proteins mentioned above, and this albumen is made up of the amino acid residue sequence of SEQ ID NO.18 in the sequence table; And provide the derived protein of this potassium-channel proteins, i.e. the aminoacid sequence of the derived protein that produces by one or several amino-acid residue replacement of amino-acid residue process, disappearance or the interpolation of SEQ ID NO.18 in the sequence table with identical biological function.

Three of purpose of the present invention is to provide a kind of recombinant expression vector, contains potassium-channel proteins gene mentioned above on this recombinant expression vector; And in optimized technical scheme, be with pBI121 as expression vector, in the embodiments of the invention, the construction process and the authentication method of recombinant vectors specifically disclosed.

Four of purpose of the present invention is to provide a kind of host cell that contains recombinant expression vector mentioned above; And in optimized technical scheme, this host cell is an agrobacterium tumefaciens GV3101 bacterial strain, in the embodiments of the invention, specifically discloses the experimental technique of agrobacterium tumefaciens GV3101 for the host bacterium.

Five of purpose of the present invention is that the potassium-channel proteins gene that provides mentioned above is improving transgenic plant K under different potassium concn environment ⁺The application of utilization ratio aspect; And this gene is improving transgenic plant K under low potassium and salt stress environment ⁺Utilization ratio and the application of salt tolerance aspect; Especially in optimized technical scheme, this gene has effect preferably in improvement Arabidopis thaliana proterties.

In a word, gene SeAKT1 of the present invention has the function of potassium-channel proteins, and it can improve transgenic arabidopsis at 3mmol and 100 μ mol concentration K the embodiments of the invention proof ⁺K under the environment ⁺Assimilated efficiency and the K under potassium deficiency, salt stress ⁺Receptivity improves K ⁺/ Na ⁺, and then improve plant potassium utilising efficiency and salt tolerance, also indicating its using value aspect efficient utilization of farm crop potassium and salt tolerance simultaneously.

Description of drawings

Fig. 1 is a SeAKT1 gene clone PCR electrophorogram.Wherein, A is a conserved regions part fragment cloning; B is 3 ' end parts fragment cloning; C is 5 ' end parts fragment cloning; D is an ORF total length PCR electrophorogram.M1：DL2000marker；M2：λ-EcoT14marker。The result shows among the figure: A: clone's gained conserved regions fragment length is about 750bp; B: clone's gained 3 ' end fragment is about 2000bp; C: clone's gained 5 ' end fragment length is about 800bp; The open reading of D:SeAKT1 frame length is 2577bp.To carry out the blast comparison after the calling sequence order-checking of above-mentioned clone institute, the result shows that all there is higher homology in the gained fragment with Shaker family potassium-channel gene.

Fig. 2 is the proteic structure iron of SeAKT1 genes encoding of the present invention.The result shows that this gene has S1-S6 six membrane spaning domains, cNMP binding site and ANK structural domain among the figure.Thereby show that SeAKT1 is a typical Shaker family inward rectification type potassium-channel.

Fig. 3 is a potassium channel protein SeAKT1 hydrophobicity plot of the present invention.The result shows that this albumen has six membrane spaning domains of S1-S6 among the figure, cNMP binding site and ANK structural domain, thus show that SeAKT1 is a transmembrane protein, and have the general constitutional features of Shaker family potassium-channel proteins.

Fig. 4 is the proteic evolutionary analysis figure of SeAKT1 genes encoding of the present invention.The result shows that sibships such as Mktp1 in this gene and the AKT1 subtribe and NKT1 are nearer among the figure, shows that this proteins encoded belongs to the AKT1 subtribe of potassium-channel proteins family.(aminoacid sequence of potassium-channel SeAKT1 adopts the prediction of ClustalX program, and adopts MEGA5 software building evolutionary tree.AKT1/2/5, KAT1/2, AtKC1 and GORK/SKOR-Arabidopis thaliana; SPIK, the PeKC1/2-willow; The NKT1-tobacco; RCAKT1/2/3/6-castor-oil plant; The Mktp1-ice plant; The DKT1-Radix Dauci Sativae; The LKT1-tomato; The TaAKT1-wheat; The HvAKT1-barley; The PutAKT1-flower of Stinkgrass; OsAKT1, the OsKT2-paddy rice.）

Fig. 5 is under the different treatment, SeAKT1 sxemiquantitative RT-PCR electrophorogram.Wherein A is a SeAKT1 expression in the seedling under the different treatment; B becomes SeAKT1 expression in the seedling under the different treatment.Wherein among the A figure 1: be untreated; 2: potassium deficiency is handled; 3:100mM NaCl handles; 4: potassium deficiency+100mM NaCl handles.Among the B figure 1: be untreated; 2: potassium deficiency is handled; 3:700mM NaCl handles; 4: potassium deficiency+700mM NaCl handles.The result shows, under the potassium deficiency situation seedling with become seedling in expression amount all raise to some extent, it is particularly evident especially to go up modulation factor of amplitude modulation in the seedling; Under the situation that potassium deficiency+salt stress is handled, seedling (potassium deficiency+100mM Na ⁺) with become seedling (potassium deficiency+700mM Na ⁺) all increases to some extent of middle expression amount; 100mMNa in seedling ⁺Handling down, the expression amount rising forms 700mMNa in the seedling ⁺Expression amount is slightly reduced under handling.It is reported that the potassium-channel of AKT1 class (as: MKT1, OsAKT1, AKT1) externally concentration is 400mM, expression amount is acutely reduced in the time of 150mM or 50mM, and SeAKT1 is at 100mMNa ⁺Expression amount rises in the salicornia europaeal seedling under handling, at 700mMNa ⁺Become only decline slightly of expression amount in the seedling under handling, have clear superiority by contrast.

Fig. 6 is the structure collection of illustrative plates of reorganization plant expression vector pBI121-SeAKT1.Show this gene can be under the regulation and control of 35S promoter constitutive expression, recombinant vectors has kalamycin resistance.

Fig. 7 is for changeing the kantlex screening figure of SeAKT1 gene Arabidopis thaliana plant.A: the wild-type Arabidopis thaliana does not add the kantlex screening; B: transgenic arabidopsis adds the kantlex screening; C: the wild-type Arabidopis thaliana adds the kantlex screening; Illustrated result proves that changeing SeAKT1 gene masculine seedling has kalamycin resistance, can be at normal growth under the kantlex; The wild-type Arabidopis thaliana then only grows two cotyledons, can't continue to grow true leaf, and withered gradually flavescence, until death.

Fig. 8 is the K of transgenic arabidopsis under the different treatment condition of SeAKT1 gene of the present invention ⁺, Na ⁺Content and K ⁺/ Na ⁺Situation.WT: wild-type Arabidopis thaliana; SeAKT1: change SeAKT1 gene Arabidopis thaliana; Control: normal MS substratum;-K: lack K ⁺The MS substratum; + Na:75mM Na ⁺The MS substratum;-K/+Na: lack K ⁺+ 75mM Na ⁺The MS substratum.The result shows: compares with control group, and all decline to some extent of potassium content in transgenic arabidopsis and wild-type Arabidopis thaliana root and the hat (over-ground part) under the treatment condition, but the potassium content fall is smaller in the commentaries on classics SeAKT1 gene Arabidopis thaliana; At Na ⁺Coerce down the Na in transgenic arabidopsis and the wild-type Arabidopis thaliana ⁺Content all has rising by a relatively large margin, but comparatively speaking, the Na in transgenic arabidopsis root and the hat ⁺Content all is lower than the wild-type Arabidopis thaliana; Compare the K under different stress conditions in transgenosis and contrast Arabidopis thaliana root and the hat with control group ⁺/ Na ⁺Obvious reduction is all arranged, but the K of transgenic arabidopsis ⁺/ Na ⁺Will be apparently higher than the wild-type Arabidopis thaliana.Show that the SeAKT1 gene can make the transgenic arabidopsis under the stress conditions absorb more K ⁺, and reduce Na ⁺Absorption, keep higher relatively K in the cell thereby make ⁺/ Na ⁺, guarantee the metabolism of plant normal growth, improved low-kalium resistant and the salt tolerance of plant.

Fig. 9 for the transgenic arabidopsis of SeAKT1 gene of the present invention at 3mmol concentration K ⁺K under the environment ⁺Exhaust experiment.The result is presented at 3mmol concentration K among the figure ⁺Under the environment, change SeAKT1 gene Arabidopis thaliana and exhaust K in the liquid ⁺Density loss faster, and final concentration is lower.Show that transgenic arabidopsis is at millimolar concentration K ⁺K under the environment ⁺Assimilated efficiency increases.

Figure 10 for the transgenic arabidopsis of SeAKT1 gene of the present invention at 100 μ mol concentration K ⁺K under the environment ⁺Exhaust experiment.The result is presented at 100 μ mol concentration K among the figure ⁺Under the environment, change SeAKT1 gene Arabidopis thaliana and exhaust K in the liquid ⁺Density loss faster, and final concentration is lower.Show that transgenic arabidopsis is at micro-molar concentration K ⁺K under the environment ⁺Assimilated efficiency increases.

Embodiment:

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these examples only to be used to the present invention is described and be not used in and limit range of application of the present invention.

The test method of unreceipted concrete experiment condition among the following embodiment is usually according to condition described in normal condition or the molecular cloning, or according to the condition that is provided on the product description.

Be below material used in the example, reagent like no specified otherwise, all can obtain from commercial channels.

The clone and the analysis of embodiment one SeAKT1 gene cDNA

The total RNA of one salicornia europaeal extracts

Take by weighing the fresh salicornia europaeal tissue of 50mg, grind into powder in liquid nitrogen is transferred to ground material rapidly in the centrifuge tube that contains 1ml trizol reagent, the concussion mixing; Add the 0.2ml chloroform, concuss 15s, room temperature is placed 5min; 4 ° of C12000r/min, 10-15min gets supernatant; Supernatant is transferred in the new centrifuge tube; Add the 0.5ml Virahol, mixing, room temperature 10min; 4 ° of C, 12000r/min, centrifugal 10min; Abandon supernatant, add 70% ethanol (fresh preparation) of 1ml ice precooling, washing precipitation; 4 ° of C, 7500r/min, 5min; Abandon supernatant, room temperature is dried (too not dried), adds 20 μ l RNase-free ddH ₂O fully dissolves RNA, and-70 ° of C preserve standby.1% agarose gel electrophoresis detects the quality that RNA extracts.The result has presented 28S, 18S, three kinds of typical R NA of 5S banding pattern, and each band is clear, does not have tangible conditions of streaking, shows that the RNA of extraction does not have obvious degradation, can be further used for the RT-PCR experiment.

The acquisition of two strand cDNA

The total RNA of salicornia europaeal with extraction is template (500ng), carries out reverse transcription reaction according to the biological Reverse Transcriptase of treasured M-MLV reverse transcription specification sheets, and the strand cDNA that obtains can be directly used in the synthetic or pcr amplification of 2nd-Strand cDNA etc.

The acquisition of three salicornia europaeal SeAKT1 Gene Partial coding regions

1. degenerated primer design.Carry out the homology comparison according to the AKT1 family gene sequence of plants such as the ice plant that provides on the NCBI, tobacco, Arabidopis thaliana, paddy rice and barley, at its high conservative region design pair of degenerate primers AKF(SEQ ID NO.1)/AKR(SEQ ID NO.2).Y=C/T in this degenerated primer, D=A/G, W=A/T, R=A/G.

2. pcr amplification.The strand cDNA that obtains with reverse transcription is a template, AKF(SEQ ID NO.1) and AKR(SEQ ID NO.2) be primer, pcr amplification SeAKT1 channel gene part coding region.Reaction system is as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 50 ℃ (40s), 72 ℃ (1min), 35 circulations; Last 72 ℃ (10min).The PCR product is separated (result such as Figure 1A) through 1% agarose gel electrophoresis, be positioned at gel 2/3 place to the tetrabromophenol sulfonphthalein index strip, under ultraviolet lamp, downcut the gel in 750bp zone and put into the 1.5mL centrifuge tube, reclaim with the MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 recovery test kit of TaKaRa company (Dalian).

3. reclaiming dna fragmentation connects, transforms and order-checking.Adopt precious biological pMD18-T vector test kit, the PCR product after reclaiming is directly linked to each other with the T carrier, reaction system is as follows:

Reaction conditions is that 16 ℃ of incubated overnight connect, and connects product and is used for the intestinal bacteria conversion.PCR and enzyme are cut and are detected the positive colony that obtains the about 750bp of fragment length, send order-checking.Sequencing result is seen SEQ ID NO.14.Sequencing result is carried out the Blast-N comparison on NCBI show: this sequence and ice plant MKT1, and Arabidopis thaliana AKT1, rice Os AKT1, the homology of wheat TaAKT1 and barley HvAKT1 gene order reaches 69%, 61%, 57%, 57% and 53% respectively.The preliminary partial sequence of inferring that this cDNA fragment is a salicornia europaeal potassium-channel gene coding region.

Four RACE methods clone salicornia europaeal SeAKT1 gene, 3 ' cDNA

1. the design of 3 ' RACE special primer.According to acquired salicornia europaeal SeAKT1 Gene Partial cDNA fragment and TaKaRa(Dalian) a pair of nested PCR primer of primer 3 ' RACE Outer Primer/3 ' RACE Inner Prime (table 1) design that provides of 3 '-full RACE Kit of company: 3 ' forward specificity outside primer 3-GSP1(SEQ ID NO.3), the inboard primer 3-GSP2(SEQ of nido specificity ID NO.4).

2. nest-type PRC reaction.Outer PCR reaction is with outside primer 3-GSP1(SEQ ID NO.3) and 3 ' RACE Outer Primer carry out the outside and increase.Reaction system is as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 55 ℃ (40s), 72 ℃ (2min), 35 circulations; Last 72 ℃ (10min).

Inner PCR reaction is a template with outside PCR product, with inboard primer 3-GSP2(SEQ ID NO.4) and 3 ' RACE Inner Primer primer carry out nido and increase.Reaction system is as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 55 ℃ (40s), 72 ℃ (2min), 35 circulations; Last 72 ℃ (10min).The PCR product separates (result such as Figure 1B), cuts glue and reclaim, connect cloning vector, transformed into escherichia coli competence, PCR and enzyme and cut detection (method is the same) through 1% agarose gel electrophoresis, and the positive colony of choosing length and be 2000bp send order-checking.Sequencing result is seen SEQ ID NO.15.Sequencing result is done the Blast-N comparison by ncbi database, and the result shows: this sequence and ice plant MKT1, and castor-oil plant RcAKT1, the homology of tobacco NKT1 and willow SPIK gene order is higher.Preliminary this cDNA fragment of deduction is salicornia europaeal potassium-channel gene a 3 ' end parts sequence.

Five anchor PCR methods clone SeAKT1 gene 5 ' cDNA

SeAKT15 ' cDNA sequence adopts the anchor PCR method to obtain in the present embodiment.Step is as follows: according to cloning 2 the specificity nested primers of SeAKT1 gene conserved regions sequences Design that obtain, the cDNA that becomes with the total RNA reverse transcription of salicornia europaeal is a template, with outside Auele Specific Primer 5-GSP1(SEQ ID NO.5) carry out single primer amplification for primer, endways under the effect of transferring enzyme (TdT), 3 ' end in single-stranded amplification product adds oligomerization guanine Oligo d (G), with the tailing product is template, utilize Auele Specific Primer 5-GSP2(SEQ ID NO.6), 5-GSP3(SEQ ID NO.7) and Oligo d (C) for forward and reverse primer the product of tailing is carried out pcr amplification, with PCR electrophoresis as a result, cut target stripe and reclaim order-checking, and identify.

1. single primer amplification

The salicornia europaeal strand cDNA that produces with reverse transcription is a template, at first with 5-GSP1(SEQ ID NO.5) be that primer carries out single primer amplification, reaction system and reaction conditions are as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 57 ℃ (40s), 72 ℃ (1min), 35 circulations; Last 72 ℃ (10min).

2. add end reaction

Above PCR product is used to add end reaction.The mixing reaction solution is bathed 3h in 37 ℃ of temperature.20 μ l reaction systems are as follows:

3. nest-type PRC amplification

With above-mentioned tailing product is template, Oligo (dC) ₁₅Be forward primer, successively with specificity nested primer 5-GSP2(SEQ ID NO.6), 5-GSP3(SEQ ID NO.7) be that reverse primer carries out nest-type PRC reaction.The PCR reaction system is as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 58 ℃ (40s), 72 ℃ (1min), 35 circulations; Last 72 ℃ (10min).The PCR product separates (Fig. 1 C), cuts the glue recovery through 1% agarose gel electrophoresis, connects cloning vector, the transformed into escherichia coli competence, and PCR and enzyme are cut the detection lug segment length, and method is the same, and the positive colony that detection length is about 800bp send order-checking.Sequencing result is seen SEQ ID NO.16.By ncbi database sequencing result is carried out the Blast-N comparison, the result shows: this sequence and ice plant MKT1, grape VvAKT1, the homology of Radix Dauci Sativae DKT1 and castor-oil plant RcAKT1 gene order is higher, infers that tentatively this cDNA fragment is a salicornia europaeal potassium-channel gene 5 ' end parts sequence.

5SeAKT1 full length gene cDNA obtains

Above-mentioned SeAKT1 channel gene conserved regions, 3 ' end and 5 ' end fragment are spliced, obtain the cDNA sequence (SEQ ID NO.17) of 3189bp, comprising 5 ' end non-coding region 37bp, 3 ' end non-coding region 576bp, coding region 2577bp, promptly hold 38 initiator codon ATG from 5 ' of SEQ ID NO.17 sequence, base sequence to 2614 terminator codon TGA, SeAKT1 coding region for 2577bp, its albumen that is made of 858 amino acid of encoding is with this potassium-channel proteins called after SeAKT1(SEQ ID NO.18); With salicornia europaeal cDNA is template, according to splicing gained full length sequence design coding region total length primer SeAKT1-S(SEQ ID NO.8)/SeAKT1-A(SEQ ID NO.9), PCR obtains the cDNA sequence of this gene complete ORF, and length is 2577bp(such as Fig. 1 D).Enzyme is cut and PCR detects, and the positive plasmid order-checking that to choose 3 length be 2577bp obtains the SeAKT1 coding region of 2577bp.Order-checking shows that this full length sequence is identical with the splicing sequence.

6 bioinformatic analysis

Utilize online expasy software (http://web.expasy.org/protscale/) that SeAKT1 is carried out hydrophobicity analysis, the result shows that SeAKT1 has a plurality of membrane spaning domains, is a transmembrane protein (Fig. 3).Phylogenetic tree analysis revealed SeAKT1 is typical Shaker family's inward rectification type potassium-channel (Fig. 4), and plant potassium-channel proteins amino acid sequence homology such as ice plant of having reported, Arabidopis thaliana, barley, paddy rice is between 39%～69%.

Table 1SeAKT1PCR amplimer

Title	The primer base sequence (5 '--3 ')
		AKF（SEQ?ID?NO.1）	AAYATGCTTCGYCTDTGGCGTCT

AKR（SEQ?ID?NO.2）	AARTCWGTBGGYGCTTCRTTCTGC
		3-GSP1（SEQ?ID?NO.3）	TACCGTCGTTCCACTAGTGATTT
3-GSP2（SEQ?ID?NO.4）	GCCTGCAAGATCAAATGCTTTCTCACT
		3’RACE?Outer?Primer	TACCGTCGTTCCACAGTGATTT
3’RACE?Inner?Primer	CGCGGATCCTCCACTAGTGATTTCACTATAGG
		5-GSP1（SEQ?ID?NO.5）	AGAGACAGAATACAAGCTGCTTCAA
5-GSP2（SEQ?ID?NO.6）	GTCAATAACCACGCTCACAACAGT
		5-GSP3（SEQ?ID?NO.7）	ATTATCGTGACCCGGAACAGACTTG
Oilgod(C)15	CCCCCCCCCCCCCCC
		SeAKT1-S（SEQ?ID?NO.8）	GCTCTAGAATGGATGCTTGGTTTAATTCAC
SeAKT1-A（SEQ?ID?NO.9）	GCGAGCTCTCATTGGTCATTACAAGTG

The SeAKT1 expression amount is analyzed under the embodiment two different treatment conditions

The salicornia europaeal seedling germinateed after a week, changed in the different culture dish and handled 48h.4 metafiltration paper are gone in culture dish bottom shop, and respectively with normal, potassium deficiency (with Ca ²⁺Substitute), the 1/2Hoagland nutritive medium of 100mM NaCl and potassium deficiency+100mM NaCl is wetting.After around salicornia europaeal germinates, choose 5 * 4 of the one-tenth seedlings of growing way unanimity, change over to respectively in 4 water planting containers and handle 48h.The water planting container adds isopyknic normal, potassium deficiency respectively (with Ca ²⁺Substitute), the 1/2Hoagland nutritive medium of 700mM NaCl and potassium deficiency+700mM NaCl, and ventilation regularly.

Take by weighing respectively behind the 48h through the salicornia europaeal seedling of the 0.05g of different treatment growing way unanimity with become seedling to extract total RNA, synthetic cDNA, method is with embodiment one.With internal control gene Actin is contrast, carries out RT-PCR, and the primer base sequence sees Table 2.

Table 2 sxemiquantitative RT-PCR amplimer

Title	The primer base sequence
		D-s（SEQ?ID?NO.10）	5’AAGAACACCTATCTCCCCACAT3’
D-a（SEQ?ID?NO.11）	5’CAATAACCACGCTCACAACAGT3'
		Actin-s（SEQ?ID?NO.12）	5’ATGGCATCACACTTTCTACAACAG3’
Actin-a（SEQ?ID?NO.13）	5’GGATGCAAGGATTGATCCTCCGATC3’

Select suitable pcr amplification cycle number, guarantee on the one hand in agarose gel electrophoresis, to observe the PCR product, guaranteed pcr amplification on the other hand before reaching plateau, determine finally that through preliminary experiment the amplification cycles number is 27 circulations.The pcr amplification reaction system is as follows:

The PCR reaction conditions is as follows: 94 ℃ (5min) of elder generation; 94 ℃ (30s) again, 55 ℃ (40s), 72 ℃ (1min), 27 circulations; Last 72 ℃ (10min).This RT-PCR result adopts 1% agarose electrophoresis to detect, and judges the variation (Fig. 5) of gene expression amount according to each band brightness.The result shows, under the potassium deficiency situation seedling with become seedling in expression amount all raise to some extent, it is particularly evident especially to go up modulation factor of amplitude modulation in the seedling; Under the situation of potassium deficiency+salt stress, seedling (potassium deficiency+100mM Na ⁺) with become seedling (potassium deficiency+700mM Na ⁺) all increases to some extent of middle expression amount; 100mMNa in seedling ⁺Handling down, the expression amount rising forms 700mMNa in the seedling ⁺Expression amount is slightly reduced under handling.It is reported that the potassium-channel of AKT1 class (as: MKT1, OsAKT1, AKT1) externally concentration is 400mM, expression amount is acutely reduced in the time of 150mM or 50mM, and SeAKT1 is at 100mMNa ⁺Expression amount rises in the salicornia europaeal seedling under handling, at 700mMNa ⁺Become only decline slightly of expression amount in the seedling under handling, have clear superiority by contrast.(wherein A is a SeAKT1 expression in the seedling under the different treatment; B becomes SeAKT1 expression in the seedling under the different treatment.Wherein among the A figure 1: be untreated; 2: potassium deficiency is handled; 3:100mM NaCl handles; 4: potassium deficiency+100mM NaCl handles.Among the B figure 1: be untreated; 2: potassium deficiency is handled; 3:700mM NaCl handles; 4: potassium deficiency+700mM NaCl handles.)

Embodiment three changes the acquisition of SeAKT1 gene Arabidopis thaliana

One .SeAKT1 gene plant expression vector establishment

1. the extraction of pBI121 expression vector plasmid and pMD18T-SeAKT1 plasmid.Adopt the operation steps of giving birth to worker's biotechnology little extraction reagent kit of company limited's plasmid (SK8192), extract plasmid, concrete grammar is seen specification sheets.

2. the acquisition of SeAKT1 coding region and expression vector junction fragment.Use Xba I and Sac I to pMD18-SeAKT1 and pBI121 plasmid double digestion respectively,, be used for connecting to obtain the big fragment of pBI121 carrier of 2577bp SeAKT1 coding region fragment and 12947bp.Utilize the T4 ligase enzyme with above two fragments connect, transformed into escherichia coli DH5 α, after PCR and enzyme are cut detection, sift out the correct clone of length, obtained the plant recombination expression vector pBI121-SeAKT1 of SeAKT1 gene.37 ℃ of temperature of endonuclease reaction are bathed and are spent the night, and reaction system is as follows:

3. connect.Reclaim SeAKT1 gene fragment and the big fragment of pBI121 TaKaRa T after enzyme is cut ₄Dna ligase connects the two.The ligation condition is that 16 ℃ of temperature baths are spent the night, and system is as follows:

4. adopt the thermal shock method will connect liquid transformed into escherichia coli DH5 α.PCR and enzyme are cut detection, and (2577bp) filters out positive colony according to fragment length,

5. positive recombinant plasmid transformed Agrobacterium.Upgrading grain pBI121-SeAKT1 transforms Agrobacterium GV3101 competence.The preparation method of agrobacterium tumefaciens GV3101 competent cell is as follows: the single bacterium colony of picking GV3101 is in the YEB liquid nutrient medium that contains 100mg/L Rifampin and 100mg/L Streptomycin sulphate, and 28 ℃, the 180rpm shaking culture is spent the night.The thalline of getting incubated overnight is inoculated in the 50mL YEB liquid nutrient medium in the ratio of 1:100, and 28 ℃, 180rpm shaking culture 3-4h is to bacterial growth logarithmic phase OD ₆₀₀About=0.5-0.6.Get 5mL bacterium liquid in 4 ℃, the centrifugal 10min of 4000rpm, precipitation is washed once with the TE (pH7.5) of 5mL precooling, adds the fresh YEB substratum of 1mL, suspends packing ,-70 ℃ of preservations again.

Adopt freeze-thaw method that plasmid pBI121-SeAKT1 is imported Agrobacterium, method is as follows: get pipe (0.2mL) agrobacterium tumefaciens (Agribecterium tumefaciens) GV3101 bacterial strain competent cell and put thawing on ice, add 1 μ g plasmid pBI121-SeAKT1, mixing, then successively on ice, place 5min in the liquid nitrogen and in 37 ℃ of water-baths, be diluted to 1mL with the YEB liquid nutrient medium, in 28 ℃, 180rpm shaking culture 2-4h; Get an amount of bacterium liquid and coat on the YEB plate culture medium that contains 100mg/L Rifampin, 50mg/L kantlex and 100mg/L Streptomycin sulphate, cultivate about 36h for 28 ℃ and grow the resistance bacterium colony.PCR and enzyme are cut definite positive colony.

5. floral organ infusion method arabidopsis thaliana transformation

At first, prepare the Agrobacterium bacterium liquid that is used to transform.Inoculate Agrobacterium in the test tube that YEP nutrient solution (YEP+100mg/L Rifampin+100mg/L Streptomycin sulphate+50mg/L kantlex) arranged with the 1:100 ratio.28 ℃, 200rpm shakes and spends the night.Morning next day will be the activatory bacterium add by the ratio of 1:100 and continue among the fresh YEB of 250ml to work as OD by above-mentioned condition cultivation ₆₀₀Take out when reaching 2.0 left and right sides, 4 ℃, the centrifugal 10min of 4000rpm collects thalline, outwells supernatant, with 250ml conversion fluid (1/2MS+50g/l sucrose and 0.5ml/LSilwet-77, transferring pH value with KOH is 5.8) suspension thalline, OD ₆₀₀Be about 0.8.Choose about plant height 10-15cm, the wild-type Arabidopis thaliana seedling that maximum inflorescence has produced an angle fruit is used for transforming, and transforms the day before yesterday seedling to be irrigated.Fruit pod and open flower are all cut, only stay bud, good with wide adhesive plaster the grave of flowerpot.Ready Arabidopis thaliana plant is poured in the conversion fluid, guarantee that all buds all immerse in the Agrobacterium suspension, slowly rock 2min clockwise.Mark is transformed plant well, and plant is lain against in the lucifuge box, and loam cake seals film and seals, and lucifuge was cultivated after 2 days, and plant is erected normal cultivation, the results seed (change over to when on behalf of T ₀In generation, the seed of its results is T ₁For transgenic seed).

6. transgenic arabidopsis kantlex screening (Fig. 6)

Aseptic screening transgenic arabidopsis plant in substratum.T ₁Plant in the MS substratum that contains the 50mg/L kantlex (MS+0.7% agar+3% sucrose after for the transgenic arabidopsis seed through the sterilization of 70% alcohol (30s) and 0.1% mercuric chloride (7min), pH6.0) in, 4 ℃ of dark cultivations 2 days, change the photoperiod afterwards over to and be 16h/8h(light/dark), temperature is to cultivate between 22 ℃-25 ℃ group training.The positive seedling that grows is T ₁For transgenic seedling.Same method obtains T ₂For the transgenic arabidopsis seedling, be used for physiological detection.

The K of embodiment four SeAKT1 in transgenic arabidopsis ⁺, Na ⁺Assay.

The Arabidopis thaliana seedling of growing in the MS substratum germinateed about an about week, can filter out positive plant.With the wild-type Arabidopis thaliana is contrast, and at normal MS substratum, potassium deficiency MS substratum adds 75mM Na ⁺Normal MS substratum and add 75mM Na ⁺Potassium deficiency MS substratum (medium component sees Table 2) in growth, 20 seedling of every ware are vertically placed, and gather in the crops root and hat behind the 7d respectively.Arabidopis thaliana root to be measured and bizet tissue are placed thermostatic drying chamber, 120 ℃ completed 2 hours, dry to constant weight (24h) for 68 ℃ then, claim dry weight, place the 100ml triangular flask, with 5mL concentrated nitric acid and perchloric acid mixed solution (4 ︰ 1, v/v) digest a night in the darkroom, heat makes the acid volatilization clean, is cooled to room temperature, add deionized water dissolving respectively, constant volume.Atomic absorption is surveyed the potassium sodium content.Each test is provided with three repetitions.

Experimental result: compare with control group, potassium content all descends to some extent in transgenic arabidopsis and wild-type Arabidopis thaliana root and the hat under potassium deficiency is handled, but the potassium content fall is smaller in the commentaries on classics SeAKT1 gene Arabidopis thaliana; Coerce down at Na+, the Na+ content in transgenic arabidopsis and the wild-type Arabidopis thaliana all has rising by a relatively large margin, but comparatively speaking, the Na+ content in transgenic arabidopsis root and the hat all is lower than the wild-type Arabidopis thaliana; Compare with control group, the K+/Na+ under different stress conditions in transgenosis and contrast Arabidopis thaliana root and the hat all has obvious reduction, but the K+/Na+ of transgenic arabidopsis will be apparently higher than the wild-type Arabidopis thaliana.

The function of potassium channel protein SeAKT1 has been verified in this experiment in transgenic arabidopsis, proved that the transgenic arabidopsis under the stress conditions can absorb more K+, and reduce absorption, thereby make its root and blade K+/Na+ all be higher than wild-type tobacco, improved low-kalium resistant and salt tolerance Na+.

(trace element, molysite and sucrose, agar add-on are constant for table 2 medium component synopsis.）

The potassium of embodiment five SeAKT1 in transgenic arabidopsis is exhausted experiment

Material is cultivated and hungry the processing: take by weighing the transgenic arabidopsis seed 5mg among the embodiment three, sow on the MS substratum every ware two rows, illumination cultivation 6-7 days (just having grown 2 true leaves) after surface sterilization, the vernalization, change the position of a culture dish during this time every day, so that illumination condition is consistent as far as possible; Change over to afterwards hungry liquid (the 200 μ MCaS0 of 50mL are housed ₄, 0.5mM MES regulates pH to 5.8 with Tris) triangular flask in potassium is hungry handled 36 hours, change once hungry liquid every 12h therebetween.Behind the nitric acid dousing of used glassware with dilution, clean up.

Hungry liquid: 5mM MES; 200 μ M CaSO ₄PH5.8 (Tris accent);

Exhaust liquid: 5mM MES; 200 μ M CaSO ₄PH5.8 (Tris accent), other adds 100 μ M or 3mM KCl;

Carry out the potassium absorption dynamics of each strain system measures, compares with solution depletion method (Derw etc., 1984).Get hungry plant of handling after 48 hours, blot surface-moisture, change over to and be equipped with that 25ml contains 3mM and 100 μ M KCl exhaust in the triangular flask of liquid, place that (150r/min) carries out solution exhaustion-potassium absorption experiment at the environment consistent with culture condition on the shaking table.Plant is put into and exhausts that the liquid balance begins sampling after 5 minutes, gets 500 μ L at every turn and exhausts absorption liquid, mends the ultrapure water of equal volume, and the volume of exhausting liquid is remained unchanged.Finish sampling when potassium concn is kept and stablized in exhausting liquid.

Experimental result is presented at 3mM K ⁺Under the concentration, along with the increase of the time of exhaustion, the potassium concentration in the exhaustion liquid of commentaries on classics SeAKT1 gene Arabidopis thaliana and wild-type Arabidopis thaliana is all reducing gradually, and promptly potassium ion has all obtained absorption.Yet by contrast, transgenic arabidopsis potassium concentration rangeability is bigger, and its final concentration of exhausting potassium ion in the liquid is also exhausted liquid (as Fig. 9) less than the wild-type Arabidopis thaliana.Show that the Arabidopis thaliana that transforms the SeAKT1 gene has low affine potassium receptivity, can be at extraneous mmole level K ⁺Absorption of K more effectively under the condition ⁺, keep the potassium nutrition of plant.

Equally, at the outside K of 100 μ M ⁺Transgenic arabidopsis exhausts that the potassium concentration variation is bigger in the liquid in the environment, remains potassium concentration behind the 24h in the solution and also exhausts liquid (as Figure 10) less than the wild-type Arabidopis thaliana.Show that the Arabidopis thaliana that transforms the SeAKT1 gene has high affine potassium receptivity, can be at extraneous millimicro that level K ⁺Absorption of K more effectively under the condition ⁺Ability.

Claims (9)

1. a potassium-channel proteins gene is characterized in that, this gene has one of following nucleotide sequences:

1. this gene has SEQ ID NO.17 in the sequence table or its from the base sequence shown in 38～2614 at the 5 ' end;

2. SEQ ID NO.17 or its have the homology 95% or more and the base sequence of the same protein of encoding from the base sequence shown in 38～2614 at the 5 ' end in this gene and the sequence table.

2. a potassium-channel proteins is characterized in that, this albumen is made up of the amino acid residue sequence of SEQ ID NO.18 in the sequence table.

3. potassium-channel proteins derived protein, it is characterized in that the aminoacid sequence of the derived protein that this albumen is produced by one or several amino-acid residue replacement of amino-acid residue process, disappearance or the interpolation of SEQ ID NO.18 in the sequence table with identical biological function.

4. recombinant expression vector that contains the described potassium-channel proteins gene of claim 1.

5. recombinant expression vector according to claim 4 is characterized in that, its expression vector is pBI121.

6. host cell that contains claim 4 or 5 described recombinant expression vectors.

7. host cell according to claim 6 is characterized in that, this host cell is an agrobacterium tumefaciens GV3101 bacterial strain.

8. gene as claimed in claim 1 is improving transgenic plant K under different potassium concn environment ⁺The application of utilization ratio aspect.

9. gene as claimed in claim 1 is improving transgenic plant K under low potassium and salt stress environment ⁺Utilization ratio and the application of salt tolerance aspect.

Images