CN103215279B

CN103215279B - Potassium channel protein gene, and encoded protein and application thereof

Info

Publication number: CN103215279B
Application number: CN201310150471.6A
Authority: CN
Inventors: 苏乔; 商玲
Original assignee: Dalian University of Technology
Current assignee: Dalian University of Technology
Priority date: 2013-04-26
Filing date: 2013-04-26
Publication date: 2014-10-29
Anticipated expiration: 2033-04-26
Also published as: CN103215279A

Abstract

The invention belongs to the technical field of biology, and particularly discloses a potassium channel protein gene, encoded protein of the gene, and an application of the gene in potassium absorption and salt tolerance of plants. The gene derives from salicornia europaea, and is named as SeAKT1; the gene has a K<+> absorption function, so that a K<+> use ratio of transgenic arabidopsis in 3-millimeter and 100-micrometer K<+> environments; the gene is a double-affinity potassium channel protein which indicates that the gene has an application value of efficient potassium utilization of crops, so that the application of a potassium fertilizer can be reduced, and the production cost is lowered; the gene can also improve the K<+> absorption capacity of the transgenic arabidopsis under the conditions of potassium deficiency and salt stress; the consumption of Na<+> is reduced, and K<+>/Na<+> is improved, so that the salt tolerance of the plants is improved; and the characteristics improving the low soil potassium resistance and the salt tolerance of transgenic plants can be applied on the crops by a transgenic technology, so that the problems of increasingly-severe low soil potassium and salinization are solved.

Description

The albumen of a kind of potassium channel, its coding and application thereof

Technical field

The invention belongs to biological technical field.The present invention relates to albumen and the application of this gene aspect the efficient utilization of potassium of plants and salt tolerance of a kind of potassium channel, its coding.

Background technology

Potassium is one of necessary macronutrient of plant-growth, is distributed widely in each tissue and the organ of plant, is the abundantest monovalent cation of vegetable cell intensive amount.Potassium plays an important role in the numerous physiological functions of plant, as maintains cell plasma balance, regulates cell turgor, regulate the active of various enzymes and participate in protein synthesis etc., remains high and metastable potassium content is most important to plant-growth.Plant potassium deficiency there will be obvious potassium deficiency symptom, shows as easy lodging, the easy dehydration of blade, and drought-enduring salt tolerance reduces, yellow leaf and tissue necrosis etc.Arable soil potassium deficiency can cause crop yield and quality to decline to a great extent.Therefore, maintaining potassium nutrition in growing process supplies with very important.The major part of China is ploughed for potassium deficiency, and wherein approximately 2,000 ten thousand hectares, severe potassium deficiency soil, accounts for the more than 20% of total cultivated area.And, China's potassium ore resources scarcity, the annual production of potash fertilizer is very limited, and potassium deficiency situation is having a strong impact on the development of China's agricultural.

Meanwhile, the soil salinization is a global ecological problem.Excessive sodium ion has toxic action to the growth of plant, and most of farm crop can not normal growth under salt stress state, shows as hypoevolutism, and percentage of germination reduces, and organ growth and differentiation are suppressed, and metabolism such as slows down at the symptom.The soil salinization not only can cause grain drop in production, is also desertification of land and the one of the main reasons of degenerating of ploughing, and is seriously restricting agriculture production.

Research shows, the physiological response of the different varieties of different types of plant or kindred plant to soil potassium deficiency and salt stress and the efficiency that absorbs of potassium is existed to notable difference, and this otherness can heredity, illustrates that this proterties of plant controlled by gene.Under hypersaline environment, still there is potassium receptivity, and then maintain high K ⁺/ Na ⁺than being the key factor that determines the salt tolerance of plant.Therefore, potassium of plants receptivity and its salt tolerance are closely bound up.Since the nineties in 20th century, many responsible potassium of plants absorb and the potassium-channel gene of transhipment and kalium ion transport protein gene by cloning and identification in succession.Wherein, potassium-channel plays an important role in potassium of plants absorption, research potassium-channel gene, and for we are deeply familiar with and understand absorption and the using mechanism of making potassium in object, and then the effective rate of utilization of raising potassium has positive effect.At present, the potassium-channel of more existing plants is cloned and identifies out, as OsAKT1 (paddy rice), and AKT1 (Arabidopis thaliana), ZMK1(corn), MIRK (muskmelon) and MKT1 (ice plant) etc.But these gene major parts are from glycophyte, and most to Na ⁺sensitivity, comprising the MKT1 from halophytes.At soil not only potassium deficiency but also have in saliferous situation, only have Na ⁺insensitive potassium translocator just can work orderly, and therefore render transgenic crop not only low-kalium resistant but also salt tolerant are considered to separate Na from euhalophyte salicornia europaeal ⁺insensitive potassium transporter gene.So it is experiment material that this patent adopts dicotyledonous halophytes salicornia europaeal.

Salicornia europaeal (Salicornia europaea): annual dicotyledonous herbaceous plant, Chenopodiaceae salicornia europaeal belongs to, and is generally born in saltings, seashore is taken up in salt lake.Salicornia europaeal platymiscium is one of Lu Sheng higher plant monoid of salt tolerant on the earth of reporting up to now, and it also can absorb potassium ion under 600mM salt concentration conditions, maintains plant normal growth.(salicornia europaeal seed is adopted in the saltings on sub-seashore, municipalization city, Dalian, and plants in laboratory, uses containing the 1/2Hoagland nutritive medium of 300mM NaCl and regularly irrigates.Under natural condition, cultivate).

Summary of the invention

In order to address the above problem, the present invention discloses the application aspect potassium of plants absorption and salt tolerance of a kind of potassium channel, its proteins encoded and this gene.This gene is separated from salicornia europaeal, has K ⁺absorptive function is a kind of two affinity potassium channel protein.This indicating it at farm crop potassium the using value aspect efficiently utilizing, can reduce using of potash fertilizer, thereby reduce production costs.This gene can improve the K of transgenic arabidopsis at potassium deficiency and condition of salt stress ⁺receptivity reduces Na simultaneously ⁺absorption, improved K ⁺/ Na ⁺thereby, improved the salt tolerance of plant.The low potassium of resistance to soil of this raising transgenic plant and the characteristic of salt tolerant, can be applied on farm crop by transgenic technology, thus day by day serious soil potassium deficiency and the salinification problem of reply.

Technical scheme of the present invention is as follows:

One of object of the present invention is to provide the potassium channel with potassium absorptive function, and this gene is separated from salicornia europaeal, has one of following nucleotide sequences:

1. this gene has SEQ ID NO.17 in sequence table or its from the base sequence shown in 38～2614,5 ' end;

2. in this gene and sequence table, SEQ ID NO.17 or its have more than 95% homology from the base sequence shown in 38～2614,5 ' end, and the base sequence of coding same protein.

Two of object of the present invention has been to provide the proteins encoded with potassium-channel proteins mentioned above, and this albumen is made up of the amino acid residue sequence of SEQ ID NO.18 in sequence table; And provide the derived protein of this potassium-channel proteins, the aminoacid sequence of the derived protein with identical biological function that replaces, lacks or add and produce through one or several amino-acid residue by the amino-acid residue of SEQ ID NO.18 in sequence table.

Three of object of the present invention is to provide a kind of recombinant expression vector, contains potassium channel mentioned above on this recombinant expression vector; And in preferred technical scheme, be using pBI121 as expression vector, in embodiments of the invention, specifically disclose construction process and the authentication method of recombinant vectors.

Four of object of the present invention is to provide a kind of host cell that contains recombinant expression vector mentioned above; And in preferred technical scheme, this host cell is agrobacterium tumefaciens GV3101 bacterial strain, in embodiments of the invention, specifically discloses the experimental technique that agrobacterium tumefaciens GV3101 is Host Strains.

Five of object of the present invention is that the potassium channel that provides mentioned above is improving transgenic plant K under different potassium concn environment ⁺the application of utilization ratio aspect; And this gene is improving transgenic plant K under low potassium and salt stress environment ⁺utilization ratio and the application of salt tolerance aspect; Especially in preferred technical scheme, this gene has good effect in improvement Arabidopis thaliana proterties.

In a word, gene SeAKT1 of the present invention has the function of potassium-channel proteins, and it can improve transgenic arabidopsis at 3mmol and 100 μ mol concentration K embodiments of the invention proof ⁺k under environment ⁺assimilated efficiency and the K under potassium deficiency, salt stress ⁺receptivity, improves K ⁺/ Na ⁺, and then improve potassium of plants utilising efficiency and salt tolerance, also indicating its using value aspect the efficient utilization of farm crop potassium and salt tolerance simultaneously.

Brief description of the drawings

Fig. 1 is SeAKT1 gene clone PCR electrophorogram.Wherein, A is conserved regions Partial Fragment clone; B is 3 ' end Partial Fragment clone; C is 5 ' end Partial Fragment clone; D is ORF total length PCR electrophorogram.M1：DL2000marker；M2：λ-EcoT14marker。In figure, result shows: A: clone's gained conserved regions fragment length is about 750bp; B: clone's gained 3 ' end fragment is about 2000bp; C: clone's gained 5 ' end fragment length is about 800bp; The open reading frame length of D:SeAKT1 is 2577bp.To after the calling sequence order-checking of above-mentioned clone institute, carry out blast comparison, result show gained fragment all with the higher homology of Shaker family potassium-channel gene existence.

Fig. 2 is the structure iron of the albumen of SeAKT1 genes encoding of the present invention.In figure, result shows that this gene has S1-S6 six membrane spaning domains, cNMP binding site and ANK structural domain.Thereby show that SeAKT1 is typical Shaker family inward rectification type potassium-channel.

Fig. 3 is potassium channel protein SeAKT1 hydrophobicity plot of the present invention.In figure, result shows that this albumen has six membrane spaning domains of S1-S6, cNMP binding site and ANK structural domain, thus show that SeAKT1 is a transmembrane protein, and there is the general structure feature of Shaker family potassium-channel proteins.

Fig. 4 is the evolutionary analysis figure of the albumen of SeAKT1 genes encoding of the present invention.In figure, result shows that the sibship such as Mktp1 and NKT1 in this gene and AKT1 subtribe is nearer, shows that this proteins encoded belongs to the AKT1 subtribe of potassium-channel proteins family.(aminoacid sequence of potassium-channel SeAKT1 adopts the prediction of ClustalX program, and adopts MEGA5 software building evolutionary tree.AKT1/2/5, KAT1/2, AtKC1 and GORK/SKOR-Arabidopis thaliana; SPIK, PeKC1/2-willow; NKT1-tobacco; RCAKT1/2/3/6-castor-oil plant; Mktp1-ice plant; DKT1-Radix Dauci Sativae; LKT1-tomato; TaAKT1-wheat; HvAKT1-barley; PutAKT1-flower of Stinkgrass; OsAKT1, OsKT2-paddy rice.）

Fig. 5 is under different treatment, SeAKT1 sxemiquantitative RT-PCR electrophorogram.Wherein A is SeAKT1 expression in seedling under different treatment; B is SeAKT1 expression in seedling under different treatment.Wherein in A figure 1: untreated; 2: potassium deficiency processing; 3:100mM NaCl processes; 4: potassium deficiency+100mM NaCl processes.In B figure 1: untreated; 2: potassium deficiency processing; 3:700mM NaCl processes; 4: potassium deficiency+700mM NaCl processes.Result shows, all rises to some extent of expression amount in seedling and seedling in potassium deficiency situation, and especially in seedling, upper modulation factor of amplitude modulation is particularly evident; The in the situation that of the processing of potassium deficiency+salt stress, seedling (potassium deficiency+100mM Na ⁺) and seedling (potassium deficiency+700mM Na ⁺) all increases to some extent of middle expression amount; 100mMNa in seedling ⁺process lower expression amount to rise and 700mMNa in seedling ⁺processing lower expression amount slightly lowers.It is reported, the potassium-channel (as: MKT1, OsAKT1, AKT1) of AKT1 class is 400mM in outside concentration, and when 150mM or 50mM, expression amount is acutely lowered, and SeAKT1 is at 100mMNa ⁺in salicornia europaeal seedling under processing, expression amount rises, at 700mMNa ⁺process expression amount in lower seedling and only slightly decline, there is by contrast clear superiority.

Fig. 6 is the structure collection of illustrative plates of restructuring plant expression vector pBI121-SeAKT1.Show this gene can be under the regulation and control of 35S promoter constitutive expression, recombinant vectors has kalamycin resistance.

Fig. 7 is the kantlex screening figure that turns SeAKT1 gene Arabidopis thaliana plant.A: wild-type Arabidopis thaliana does not add kantlex screening; B: transgenic arabidopsis adds kantlex screening; C: wild-type Arabidopis thaliana adds kantlex screening; Illustrated result proves that turning SeAKT1 gene masculine seedling has kalamycin resistance, can be at normal growth under kantlex; Wild-type Arabidopis thaliana only grows two cotyledons, cannot continue to grow true leaf, and withered flavescence gradually, until dead.

Fig. 8 is the transgenic arabidopsis of SeAKT1 gene of the present invention K under different treatment condition ⁺, Na ⁺content and K ⁺/ Na ⁺situation.WT: wild-type Arabidopis thaliana; SeAKT1: turn SeAKT1 gene Arabidopis thaliana; Control: normal MS substratum;-K: lack K ⁺mS substratum; + Na:75mM Na ⁺mS substratum;-K/+Na: lack K ⁺+ 75mM Na ⁺mS substratum.Result shows: compared with control group, and all decline to some extent of potassium content in transgenic arabidopsis and wild-type Arabidopis thaliana root and hat (over-ground part) under treatment condition, but it is smaller to turn in SeAKT1 gene Arabidopis thaliana potassium content fall; At Na ⁺coerce down the Na in transgenic arabidopsis and wild-type Arabidopis thaliana ⁺content all has rising by a relatively large margin, but comparatively speaking, the Na in transgenic arabidopsis root and hat ⁺content is all lower than wild-type Arabidopis thaliana; Compared with control group, the K under Different stress condition in transgenosis and contrast Arabidopis thaliana root and hat ⁺/ Na ⁺all there is obvious reduction, but the K of transgenic arabidopsis ⁺/ Na ⁺will be apparently higher than wild-type Arabidopis thaliana.Show that SeAKT1 gene can make the transgenic arabidopsis under stress conditions absorb more K ⁺, and reduce Na ⁺absorption, thereby make to maintain in cell relatively high K ⁺/ Na ⁺, ensure the metabolism of plant normal growth, improve low-kalium resistant and the salt tolerance of plant.

Fig. 9 is that the transgenic arabidopsis of SeAKT1 gene of the present invention is at 3mmol concentration K ⁺k under environment ⁺exhaust experiment.In figure, result is presented at 3mmol concentration K ⁺under environment, turn SeAKT1 gene Arabidopis thaliana and exhaust K in liquid ⁺density loss faster, and final concentration is lower.Show that transgenic arabidopsis is at millimolar concentration K ⁺k under environment ⁺assimilated efficiency increases.

Figure 10 is that the transgenic arabidopsis of SeAKT1 gene of the present invention is at 100 μ mol concentration K ⁺k under environment ⁺exhaust experiment.In figure, result is presented at 100 μ mol concentration K ⁺under environment, turn SeAKT1 gene Arabidopis thaliana and exhaust K in liquid ⁺density loss faster, and final concentration is lower.Show that transgenic arabidopsis is at micro-molar concentration K ⁺k under environment ⁺assimilated efficiency increases.

Embodiment:

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these examples are only not used in restriction range of application of the present invention for the present invention is described.

The test method of unreceipted specific experiment condition in embodiment below, conventionally according to condition described in normal condition or molecular cloning, or according to the condition providing on product description.

Be below material, reagent etc. used in example if no special instructions, all can obtain from commercial channels.

The cloning and analysis of embodiment mono-SeAKT1 gene cDNA

The total RNA of one salicornia europaeal extracts

Take the fresh salicornia europaeal tissue of 50mg, grind into powder in liquid nitrogen, is transferred to ground material rapidly in the centrifuge tube that contains 1ml trizol reagent, and concussion mixes; Add 0.2ml chloroform, concuss 15s, room temperature is placed 5min; 4 ° of C12000r/min, 10-15min, gets supernatant; Supernatant is transferred in new centrifuge tube; Add 0.5ml Virahol, mix, room temperature 10min; 4 ° of C, 12000r/min, centrifugal 10min; Abandon supernatant, add 70% ethanol (fresh preparation) of 1ml ice precooling, washing precipitation; 4 ° of C, 7500r/min, 5min; Abandon supernatant, room temperature is dried (too not dry), adds 20 μ l RNase-free ddH ₂o, fully dissolves RNA, and-70 ° of C save backup.1% agarose gel electrophoresis detects the quality that RNA extracts.Result has presented 28S, 18S, tri-kinds of typical RNA banding patterns of 5S, and each band is clear, without obvious conditions of streaking, shows that the RNA extracting is without obvious degradation, can be further used for RT-PCR experiment.

The acquisition of two strand cDNA

Taking the total RNA of salicornia europaeal that extracts as template (500ng), carry out reverse transcription reaction according to the biological Reverse Transcriptase of treasured M-MLV reverse transcription specification sheets, the strand cDNA obtaining can be directly used in the synthetic or pcr amplification of 2nd-Strand cDNA etc.

The acquisition of three salicornia europaeal SeAKT1 Gene Partial coding regions

1. degenerated primer design.Carry out sequence analysis according to the AKT1 family gene sequence of the plants such as the ice plant providing on NCBI, tobacco, Arabidopis thaliana, paddy rice and barley, at its high conservative region design pair of degenerate primers AKF(SEQ ID NO.1)/AKR(SEQ ID NO.2).Y=C/T in this degenerated primer, D=A/G, W=A/T, R=A/G.

2. pcr amplification.Taking reverse transcription obtain strand cDNA as template, AKF(SEQ ID NO.1) and AKR(SEQ ID NO.2) be primer, pcr amplification SeAKT1 channel gene part coding region.Reaction system is as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 50 DEG C (40s), 72 DEG C (1min), 35 circulations; Last 72 DEG C (10min).PCR product is separated to (result is as Figure 1A) through 1% agarose gel electrophoresis, be positioned at gel 2/3 place to tetrabromophenol sulfonphthalein index strip, under ultraviolet lamp, cut the gel in 750bp region and put into 1.5mL centrifuge tube, reclaim test kit with the MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 of TaKaRa company (Dalian) and reclaim.

3. reclaiming DNA fragmentation connects, transforms and order-checking.Adopt precious biological pMD18-T vector test kit, the PCR product after reclaiming is directly connected with T carrier, reaction system is as follows:

Reaction conditions is that 16 DEG C of incubated overnight connect, and connects product and transforms for intestinal bacteria.PCR and enzyme are cut and are detected the positive colony that obtains the about 750bp of fragment length, send order-checking.Sequencing result is shown in SEQ ID NO.14.Sequencing result being carried out on NCBI to Blast-N comparison shows: this sequence and ice plant MKT1, and Arabidopis thaliana AKT1, rice Os AKT1, the homology of wheat TaAKT1 and barley HvAKT1 gene order reaches respectively 69%, 61%, 57%, 57% and 53%.The preliminary partial sequence of inferring that this cDNA fragment is salicornia europaeal potassium-channel gene coding region.

Four RACE method clone salicornia europaeal SeAKT1 gene 3 ' cDNA

1. the design of 3 ' RACE special primer.According to acquired salicornia europaeal SeAKT1 Gene Partial cDNA fragment and TaKaRa(Dalian) primer 3 ' RACE Outer Primer/3 ' the RACE Inner Prime (table 1) that provides of 3 '-full RACE Kit of company designs a pair of nested PCR primer: primer 3-GSP1(SEQ ID NO.3 outside 3 ' forward specificity), primer 3-GSP2(SEQ ID NO.4 inside nido specificity).

2. nest-type PRC reaction.Outside primer 3-GSP1(SEQ ID NO.3 for Outer PCR reaction) and 3 ' RACE Outer Primer carry out outside and increase.Reaction system is as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 55 DEG C (40s), 72 DEG C (2min), 35 circulations; Last 72 DEG C (10min).

Inner PCR reacts taking outside PCR product as template, with inner side primer 3-GSP2(SEQ ID NO.4) and 3 ' RACE Inner Primer primer carry out nido amplification.Reaction system is as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 55 DEG C (40s), 72 DEG C (2min), 35 circulations; Last 72 DEG C (10min).PCR product separates (result is as Figure 1B), cuts glue and reclaim, connect cloning vector, transform intestinal bacteria competence, PCR and enzyme and cut detection (method is the same) through 1% agarose gel electrophoresis, and the positive colony of choosing length and be 2000bp send order-checking.Sequencing result is shown in SEQ ID NO.15.Sequencing result does Blast-N comparison by ncbi database, and result shows: this sequence and ice plant MKT1, and castor-oil plant RcAKT1, the homology of tobacco NKT1 and willow SPIK gene order is higher.Preliminary this cDNA fragment of deduction is salicornia europaeal potassium-channel gene 3 ' end sub-sequence.

Five anchor PCR method clone SeAKT1 gene 5 ' cDNA

In the present embodiment, SeAKT15 ' cDNA sequence adopts anchor PCR method to obtain.Step is as follows: according to cloning 2 the specificity nested primers of SeAKT1 gene conserved regions sequences Design that obtain, the cDNA becoming taking the total RNA reverse transcription of salicornia europaeal is as template, with outside Auele Specific Primer 5-GSP1(SEQ ID NO.5) carry out single primer amplification for primer, endways under the effect of transferring enzyme (TdT), add oligomerization guanine Oligo d (G) at 3 ' end of single-stranded amplification product, taking tailing product as template, utilize Auele Specific Primer 5-GSP2(SEQ ID NO.6), 5-GSP3(SEQ ID NO.7) and Oligo d (C) carry out pcr amplification for the product of forward and reverse primer pair tailing, by PCR result electrophoresis, cut target stripe and reclaim order-checking, and qualification.

1. single primer amplification

The salicornia europaeal strand cDNA producing taking reverse transcription is as template, first taking 5-GSP1(SEQ ID NO.5) as primer carries out single primer amplification, reaction system and reaction conditions are as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 57 DEG C (40s), 72 DEG C (1min), 35 circulations; Last 72 DEG C (10min).

2. add end reaction

Above PCR product is used for adding end reaction.Mix reaction solution, bathe 3h in 37 DEG C of temperature.20 μ l reaction systems are as follows:

3. nest-type PRC amplification

Taking above-mentioned tailing product as template, Oligo (dC) ₁₅for forward primer, successively taking specificity nested primer 5-GSP2(SEQ ID NO.6), 5-GSP3(SEQ ID NO.7) carry out nest-type PRC reaction as reverse primer.PCR reaction system is as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 58 DEG C (40s), 72 DEG C (1min), 35 circulations; Last 72 DEG C (10min).PCR product separates (Fig. 1 C), cuts glue recovery through 1% agarose gel electrophoresis, connects cloning vector, transforms intestinal bacteria competence, and PCR and enzyme are cut detection lug segment length, and method is the same, and the positive colony that detection length is about 800bp send order-checking.Sequencing result is shown in SEQ ID NO.16.By ncbi database, sequencing result is carried out to Blast-N comparison, result shows: this sequence and ice plant MKT1, grape VvAKT1, the homology of Radix Dauci Sativae DKT1 and castor-oil plant RcAKT1 gene order is higher, tentatively infers that this cDNA fragment is salicornia europaeal potassium-channel gene 5 ' end sub-sequence.

5SeAKT1 full length gene cDNA obtains

Above-mentioned SeAKT1 channel gene conserved regions, 3 ' end and 5 ' end fragment are spliced, obtain the cDNA sequence (SEQ ID NO.17) of 3189bp, comprising 5 ' end non-coding region 37bp, 3 ' end non-coding region 576bp, coding region 2577bp, hold 38 initiator codon ATG from 5 ' of SEQ ID NO.17 sequence, to the base sequence of 2614 terminator codon TGA, for the SeAKT1 coding region of 2577bp, its albumen by 858 Amino acid profiles of encoding, by this potassium-channel proteins called after SeAKT1(SEQ ID NO.18); Taking salicornia europaeal cDNA as template, according to splicing gained full length sequence design coding region total length primer SeAKT1-S(SEQ ID NO.8)/SeAKT1-A(SEQ ID NO.9), PCR obtains the cDNA sequence of this gene complete ORF, and length is that 2577bp(is as Fig. 1 D).Enzyme is cut and PCR detects, and chooses the positive plasmid order-checking that 3 length are 2577bp, obtains the SeAKT1 coding region of 2577bp.Order-checking shows that this full length sequence is identical with splicing sequence.

6 bioinformatic analysis

Utilize online expasy software (http://web.expasy.org/protscale/) to carry out hydrophobicity analysis to SeAKT1, result shows that SeAKT1 has multiple membrane spaning domains, is a transmembrane protein (Fig. 3).Phylogenetic tree analysis shows that SeAKT1 is typical Shaker family's inward rectification type potassium-channel (Fig. 4), and the K+ channels in plants Argine Monohydrochloride sequence homology such as ice plant of having reported, Arabidopis thaliana, barley, paddy rice is between 39%～69%.

Table 1SeAKT1PCR amplimer

Title	Primer base sequence (5 '--3 ')
		AKF（SEQ?ID?NO.1）	AAYATGCTTCGYCTDTGGCGTCT

AKR（SEQ?ID?NO.2）	AARTCWGTBGGYGCTTCRTTCTGC
		3-GSP1（SEQ?ID?NO.3）	TACCGTCGTTCCACTAGTGATTT
3-GSP2（SEQ?ID?NO.4）	GCCTGCAAGATCAAATGCTTTCTCACT
		3’RACE?Outer?Primer	TACCGTCGTTCCACAGTGATTT
3’RACE?Inner?Primer	CGCGGATCCTCCACTAGTGATTTCACTATAGG
		5-GSP1（SEQ?ID?NO.5）	AGAGACAGAATACAAGCTGCTTCAA
5-GSP2（SEQ?ID?NO.6）	GTCAATAACCACGCTCACAACAGT
		5-GSP3（SEQ?ID?NO.7）	ATTATCGTGACCCGGAACAGACTTG
Oilgod(C)15	CCCCCCCCCCCCCCC
		SeAKT1-S（SEQ?ID?NO.8）	GCTCTAGAATGGATGCTTGGTTTAATTCAC
SeAKT1-A（SEQ?ID?NO.9）	GCGAGCTCTCATTGGTCATTACAAGTG

SeAKT1 expression analysis under embodiment bis-different treatment conditions

Salicornia europaeal seedling germinateed after one week, proceeded in different culture dish and processed 48h.Culture dish bottom spreads into 4 metafiltration paper, and respectively with normal, potassium deficiency (with Ca ²⁺substitute), the 1/2Hoagland nutritive medium of 100mM NaCl and potassium deficiency+100mM NaCl is wetting.After salicornia europaeal germination surrounding, choose 5 × 4 of the seedlings that growing way is consistent, proceed to respectively in 4 water planting containers and process 48h.Water planting container adds respectively isopyknic normal, potassium deficiency (with Ca ²⁺substitute), the 1/2Hoagland nutritive medium of 700mM NaCl and potassium deficiency+700mM NaCl, and regularly ventilation.

After 48h, take respectively the salicornia europaeal seedling consistent through the 0.05g of different treatment growing way and seedling and extract total RNA, synthetic cDNA, method is with embodiment mono-.Taking reference gene Actin as contrast, carry out RT-PCR, primer base sequence is in table 2.

Table 2 sxemiquantitative RT-PCR amplimer

Title	Primer base sequence
		D-s（SEQ?ID?NO.10）	5’AAGAACACCTATCTCCCCACAT3’
D-a（SEQ?ID?NO.11）	5’CAATAACCACGCTCACAACAGT3'
		Actin-s（SEQ?ID?NO.12）	5’ATGGCATCACACTTTCTACAACAG3’
Actin-a（SEQ?ID?NO.13）	5’GGATGCAAGGATTGATCCTCCGATC3’

Select applicable pcr amplification cycle number, ensure on the one hand in agarose gel electrophoresis, to observe PCR product, ensure that on the other hand pcr amplification is before reaching plateau, finally determine that through preliminary experiment amplification cycles number is 27 circulations.Pcr amplification reaction system is as follows:

PCR reaction conditions is as follows: first 94 DEG C (5min); 94 DEG C (30s) again, 55 DEG C (40s), 72 DEG C (1min), 27 circulations; Last 72 DEG C (10min).This RT-PCR result adopts 1% agarose electrophoresis to detect, and judges the variation (Fig. 5) of gene expression amount according to each band brightness.Result shows, all rises to some extent of expression amount in seedling and seedling in potassium deficiency situation, and especially in seedling, upper modulation factor of amplitude modulation is particularly evident; The in the situation that of potassium deficiency+salt stress, seedling (potassium deficiency+100mM Na ⁺) and seedling (potassium deficiency+700mM Na ⁺) all increases to some extent of middle expression amount; 100mMNa in seedling ⁺process lower expression amount to rise and 700mMNa in seedling ⁺processing lower expression amount slightly lowers.It is reported, the potassium-channel (as: MKT1, OsAKT1, AKT1) of AKT1 class is 400mM in outside concentration, and when 150mM or 50mM, expression amount is acutely lowered, and SeAKT1 is at 100mMNa ⁺in salicornia europaeal seedling under processing, expression amount rises, at 700mMNa ⁺process expression amount in lower seedling and only slightly decline, there is by contrast clear superiority.(wherein A is SeAKT1 expression in seedling under different treatment; B is SeAKT1 expression in seedling under different treatment.Wherein in A figure 1: untreated; 2: potassium deficiency processing; 3:100mM NaCl processes; 4: potassium deficiency+100mM NaCl processes.In B figure 1: untreated; 2: potassium deficiency processing; 3:700mM NaCl processes; 4: potassium deficiency+700mM NaCl processes.)

Embodiment tri-turns the acquisition of SeAKT1 gene Arabidopis thaliana

One .SeAKT1 gene plant expression vector establishment

1. the extraction of pBI121 expression vector plasmid and pMD18T-SeAKT1 plasmid.Adopt the operation steps of the Sheng Gong biotechnology little extraction reagent kit of company limited's plasmid (SK8192), extract plasmid, concrete grammar is shown in specification sheets.

2. the acquisition of SeAKT1 coding region and expression vector junction fragment.Use respectively Xba I and Sac I to pMD18-SeAKT1 and pBI121 plasmid double digestion, to obtain the pBI121 carrier large fragment of 2577bp SeAKT1 coding region fragment and 12947bp, for connecting.Utilize T4 ligase enzyme that above two fragments are connected, transform bacillus coli DH 5 alpha, after PCR and enzyme are cut detection, sift out the clone that length is correct, obtained the plant recombination expression vector pBI121-SeAKT1 of SeAKT1 gene.37 DEG C of temperature of endonuclease reaction are bathed and are spent the night, and reaction system is as follows:

3. connect.Reclaim SeAKT1 gene fragment and pBI121 large fragment TaKaRa T after enzyme is cut ₄dNA ligase connects the two.Ligation condition is that 16 DEG C of temperature baths are spent the night, and system is as follows:

4. adopt thermal shock method that connecting fluid is transformed to bacillus coli DH 5 alpha.PCR and enzyme are cut detection, filter out positive colony according to fragment length (2577bp),

5. positive recombinant plasmid transformed Agrobacterium.Upgrading grain pBI121-SeAKT1, transforms Agrobacterium GV3101 competence.The preparation method of agrobacterium tumefaciens GV3101 competent cell is as follows: the mono-bacterium colony of picking GV3101 is in the YEB liquid nutrient medium that contains 100mg/L Rifampin and 100mg/L Streptomycin sulphate, and 28 DEG C, 180rpm shaking culture is spent the night.The thalline of getting incubated overnight is inoculated in 50mL YEB liquid nutrient medium in the ratio of 1:100, and 28 DEG C, 180rpm shaking culture 3-4h is to bacterial growth logarithmic phase OD ₆₀₀=0.5-0.6 left and right.Get 5mL bacterium liquid in 4 DEG C, the centrifugal 10min of 4000rpm, precipitation is washed once with the TE (pH7.5) of 5mL precooling, adds the YEB substratum that 1mL is fresh, Eddy diffusion, packing ,-70 DEG C of preservations.

Adopt freeze-thaw method that plasmid pBI121-SeAKT1 is imported to Agrobacterium, method is as follows: get a pipe (0.2mL) agrobacterium tumefaciens (Agribecterium tumefaciens) GV3101 bacterial strain competent cell and put thawing on ice, add 1 μ g plasmid pBI121-SeAKT1, mix, then successively on ice, in liquid nitrogen and place 5min in 37 DEG C of water-baths, be diluted to 1mL with YEB liquid nutrient medium, in 28 DEG C, 180rpm shaking culture 2-4h; Get appropriate bacterium liquid and coat on the YEB plate culture medium that contains 100mg/L Rifampin, 50mg/L kantlex and 100mg/L Streptomycin sulphate, cultivate 36h left and right for 28 DEG C and grow resistance bacterium colony.PCR and enzyme are cut definite positive colony.

5. floral organ infusion method arabidopsis thaliana transformation

First, for the preparation of the Agrobacterium bacterium liquid transforming.Inoculate Agrobacterium in having the test tube of YEP nutrient solution (YEP+100mg/L Rifampin+100mg/L Streptomycin sulphate+50mg/L kantlex) with 1:100 ratio.28 DEG C, 200rpm shakes and spends the night.Add the bacterium having activated in the YEB that 250ml is fresh and continue to cultivate by above-mentioned condition in the ratio of 1:100 morning next day, works as OD ₆₀₀while reaching 2.0 left and right, take out, 4 DEG C, the centrifugal 10min of 4000rpm, collects thalline, outwells supernatant, with 250ml conversion fluid (1/2MS+50g/l sucrose and 0.5ml/LSilwet-77, adjusting pH value with KOH is 5.8) suspension thalline, OD ₆₀₀it is 0.8 left and right.Choose plant height 10-15cm left and right, maximum inflorescence has produced the wild-type Arabidopis thaliana seedling of an angle fruit for transforming, and transforms and the day before yesterday seedling is irrigated.Fruit pod and open flower are all cut, only stay bud, with wide adhesive plaster, the grave of flowerpot is good.Ready Arabidopis thaliana plant is poured in conversion fluid, guarantee that all buds all immerse in Agrobacterium suspension, slowly rock 2min clockwise.Well transformed plant of mark, lies against plant in lucifuge box, and upper cover sealed membrane is sealed, and lucifuge was cultivated after 2 days, and plant is erected to normal cultivation, results seed (proceed to when on behalf of T ₀in generation, the seed of its results is T ₁for transgenic seed).

6. transgenic arabidopsis kantlex screening (Fig. 6)

Aseptic screening transgenic Arabidopis thaliana plant in substratum.T ₁plant in MS substratum (MS+0.7% agar+3% sucrose containing 50mg/L kantlex after 70% alcohol (30s) and 0.1% mercuric chloride (7min) sterilization for transgenic arabidopsis seed, pH6.0) in, 4 DEG C of dark cultivations 2 days, proceed to afterwards the photoperiod and be 16h/8h(light/dark), temperature is to cultivate between the group training of 22 DEG C-25 DEG C.The positive seedling growing is T ₁for transgenic seedling.Same method obtains T ₂for transgenic arabidopsis seedling, for physiological detection.

The K of embodiment tetra-SeAKT1 in transgenic arabidopsis ⁺, Na ⁺assay.

The Arabidopis thaliana seedling of growing in MS substratum germinates about approximately one week, can filter out positive plant.Taking wild-type Arabidopis thaliana as contrast, at normal MS substratum, potassium deficiency MS substratum, adds 75mM Na ⁺normal MS substratum and add 75mM Na ⁺potassium deficiency MS substratum (medium component is in table 2) in growth, 20 seedling of every ware, vertically place, after 7d, gather in the crops respectively root and hat.Arabidopis thaliana root to be measured and bizet tissue are placed in to thermostatic drying chamber, 120 DEG C complete 2 hours, then dry to constant weight (24h) for 68 DEG C, claim dry weight, be placed in 100ml triangular flask, with 5mL concentrated nitric acid and perchloric acid mixed solution (4 ︰ 1, v/v) in darkroom, digest a night, heat makes acid volatilization clean, is cooled to room temperature, add respectively deionized water dissolving, constant volume.Atomic absorption is surveyed potassium sodium content.Each test is provided with three repetitions.

Experimental result: compared with control group, all decline to some extent of potassium content in transgenic arabidopsis and wild-type Arabidopis thaliana root and hat under potassium deficiency is processed, but it is smaller to turn in SeAKT1 gene Arabidopis thaliana potassium content fall; Under Na+ coerces, the Na+ content in transgenic arabidopsis and wild-type Arabidopis thaliana all has rising by a relatively large margin, but comparatively speaking, the Na+ content in transgenic arabidopsis root and hat is all lower than wild-type Arabidopis thaliana; Compared with control group, the K+/Na+ under Different stress condition in transgenosis and contrast Arabidopis thaliana root and hat all has obvious reduction, but the K+/Na+ of transgenic arabidopsis will be apparently higher than wild-type Arabidopis thaliana.

The function of potassium channel protein SeAKT1 has been verified in this experiment in transgenic arabidopsis, prove that the transgenic arabidopsis under stress conditions can absorb more K+, and reduce the absorption to Na+, thereby make its root and blade K+/Na+ all higher than wild-type tobacco, improved low-kalium resistant and salt tolerance.

(trace element, molysite and sucrose, agar add-on are constant for table 2 medium component synopsis.）

The potassium of embodiment five SeAKT1 in transgenic arabidopsis is exhausted experiment

Material is cultivated and hungry processing: take the transgenic arabidopsis seed 5mg in embodiment tri-, after surface sterilization, vernalization, sow on MS substratum, every ware two is arranged, illumination cultivation 6-7 days (just having grown 2 true leaves), change during this time the position of a culture dish every day, so that illumination condition is as far as possible consistent; Proceed to afterwards hungry liquid (the 200 μ MCaS0 of 50mL are housed ₄, 0.5mM MES, regulates pH to 5.8 with Tris) triangular flask in potassium is hungry processes 36 hours, change once hungry liquid every 12h therebetween.After the glassware used nitric acid dousing with dilution, clean up.

Hungry liquid: 5mM MES; 200 μ M CaSO ₄; PH5.8 (Tris tune);

Exhaust liquid: 5mM MES; 200 μ M CaSO ₄; PH5.8 (Tris tune), separately adds 100 μ M or 3mM KCl;

Carry out the potassium absorption dynamics of each strain measures, compares with solution depletion method (Derw etc., 1984).Get hungry plant of processing after 48 hours, blot surface-moisture, proceed to and 25ml is housed contains in the triangular flask that 3mM and 100 μ M KCl exhaust liquid, be placed in (150r/min) on shaking table and carry out solution exhaustion-potassium absorption experiment at the environment consistent with culture condition.Plant is put into and exhausts that liquid balance starts sampling after 5 minutes, gets 500 μ L at every turn and exhausts absorption liquid, fills into the ultrapure water of same volume, and the volume of exhausting liquid is remained unchanged.Until potassium concn maintains and finishes sampling while stablizing in exhaustion liquid.

Experimental result is presented at 3mM K ⁺under concentration, along with exhausting the increase of time, the potassium concentration turning in the exhaustion liquid of SeAKT1 gene Arabidopis thaliana and wild-type Arabidopis thaliana is all reducing gradually, and potassium ion has all obtained absorption.But by contrast, transgenic arabidopsis potassium concentration rangeability is larger, and it exhausts that the final concentration of potassium ion in liquid is also less than wild-type Arabidopis thaliana and exhausts liquid (as Fig. 9).Show that the Arabidopis thaliana that transforms SeAKT1 gene has low affine potassium receptivity, can be at extraneous mmole level K ⁺under condition, more effectively absorb K ⁺, maintain the potassium nutrition of plant.

Equally, at the outside K of 100 μ M ⁺in environment, transgenic arabidopsis exhausts that in liquid, potassium concentration variation is larger, remains potassium concentration and be also less than wild-type Arabidopis thaliana exhaustion liquid (as Figure 10) after 24h in solution.Show that the Arabidopis thaliana that transforms SeAKT1 gene has high affine potassium receptivity, can be at extraneous millimicro that level K ⁺under condition, more effectively absorb K ⁺ability.

Claims

1. a potassium channel, is characterized in that, one of this gene is following nucleotide sequences:

1. this gene be in sequence table SEQ ID NO.17 or its from the base sequence shown in 38 ~ 2614,5 ' end;

2. this gene be with sequence table in the base sequence of SEQ ID NO.17 coding same protein; Or this gene for sequence table in SEQ ID NO.17 there is 95% above homology and the base sequence of the same protein of encoding from the base sequence of 5 ' end shown in 38 ~ 2614.

2. a potassium-channel proteins, is characterized in that, this albumen is made up of the amino acid residue sequence of SEQ ID NO.18 in sequence table.

3. a recombinant expression vector that contains potassium channel claimed in claim 1.

4. recombinant expression vector according to claim 3, is characterized in that, its expression vector is pBI121.

5. a host cell that contains recombinant expression vector described in claim 3 or 4.

6. host cell according to claim 5, is characterized in that, this host cell is agrobacterium tumefaciens GV3101 bacterial strain.

7. gene as claimed in claim 1 is improving transgenic plant K under different potassium concn environment ⁺the application of utilization ratio aspect.

8. gene as claimed in claim 1 is improving transgenic plant K under low potassium and salt stress environment ⁺utilization ratio and the application of salt tolerance aspect.