CN103097540A - Tailored oils produced from recombinant heterotrophic microorganisms - Google Patents

Abstract

Methods and compositions for the production of oil, fuels, oleochemicals, and other compounds in recombinant microorganisms are provided, including oil-bearing microorganisms and methods of low cost cultivation of such microorganisms. Microalgal cells containing exogenous genes encoding, for example, a lipase, a sucrose transporter, a sucrose invertase, a fructokinase, a polysaccharide-degrading enzyme, a keto acyl-ACP synthase enzyme, a fatty acyl-ACP thioesterase, a fatty acyl-CoA/aldehyde reductase, a fatty acyl-CoA reductase, a fatty aldehyde reductase, a fatty aldehyde decarbonylase, and/or an acyl carrier protein are useful in manufacturing transportation fuels such as renewable diesel, biodiesel, and renewable jet fuel, as well as oleochemicals such as functional fluids, surfactants, soaps and lubricants.

Description

The tailor-made oil of being produced by the restructuring heterotrophic microorganism

The cross reference of related application

According to the 35th piece of the 119th (e) money of United States Code, the application requires to enjoy the U.S. Provisional Patent Application the 61/349th of submitting on May 28th, 2010, the U.S. Provisional Patent Application the 61/374th that on August 18th, No. 774 1 submits to, the U.S. Provisional Patent Application the 61/414th that on November 16th, No. 992 1 submits to, the U.S. Provisional Patent Application the 61/428th that No. 393 and on December 29th, 2010 submit to, the rights and interests of No. 192.These the application separately for reach all purposes by reference integral body be incorporated to this paper.

Quoting of sequence table

The application comprises the sequence table that the 1-195 page is shown, at this, encloses described sequence table.

Invention field

The production of the oils that the present invention relates to be made by microorganism, fuel and grease chemical article.Specifically, the present invention relates to oil-producing microalgae, they are cultivated to produce the useful compound method of (comprising lipid, fatty acid ester, lipid acid, aldehyde, alcohol and alkane), and for they being carried out to the genetics change to enhance productivity and to change type and the method formed and the reagent by the oils of they production.

Background of invention

Fossil oil is the generic term of the flammable geologic sediments of the organic materials that buries, by rotten plant and animal, formed, described plant and animal is by going through the heat that is exposed in several hundred million ten thousand years in the earth's crust and pressure and having changed into crude oil, coal, Sweet natural gas or heavy oil.Fossil oil is limited, non-renewable resource.The energy demand increase that global economy is brought also makes the cost pressure of hydrocarbon increase gradually.Except the energy, a lot of industries, comprise Plastics Industry and chemical manufacturers, mainly depends on and obtain the raw material of hydrocarbon as its manufacture method.The ever-increasing pressure that cost-benefit substitute can help to alleviate the energy and these material cost that has to current supply source.

PCT announces and to have described for No. 2008/151149 for cultivating method and the material of micro-algae with production oils, and especially example the oils that produced by the original chlorella of micro-algae (Chlorellaprotothecoides) produce diesel oil fuel.Still need to be provided at the modified form method of production oils in micro-algae, particularly with higher yields with efficiency production chain length is shorter, saturation ratio is higher and there is no the method for the oils of pigment.The present invention meets this demand.

Summary of the invention

The invention provides the oleaginous microorganism cell with unique lipid kenel, microalgae cell preferably, and comprise and express the reconstitution cell of coding as the allogenic gene of the protein of fatty acyl group-ACP thioesterase.The present invention also provides the method that is prepared lipid and oil-based products (comprising fuel, as biofuel, renewable diesel and rocket engine fuel) by described cell.

In first aspect, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that C8:0 accounts at least 1% or at least 5%, preferably accounts at least 3%.In some cases, the lipid kenel is that C8:0 accounts at least 10% or at least 15%, preferably accounts at least 12%.In some embodiments, described cell is reconstitution cell.In some cases, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C8 for chain length has hydrolytic activity.In some embodiments, described allogenic gene coding wetland calyx is apart from flower (Cupheapalustris) fatty acyl-acp thioesterase.In some cases, described cell is former algae (Prototheca) cell.In some cases, described cell belongs to micro-Trentepohlia or the species that are selected from the micro-algae indicated in table 1.

In second aspect, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that C10:0 accounts at least 4%.In some cases, the lipid kenel is that C10:0 accounts at least 20%, at least 25% or at least 30%, preferably accounts at least 24%.In some cases, the ratio of C10:0 and C12:0 is at least 6: 1.In some embodiments, described cell is reconstitution cell.In some cases, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C10 for chain length has hydrolytic activity.In some embodiments, described allogenic gene coding is from the fatty acyl-acp thioesterase albumen of following species, and described species select the group of free spire calyx apart from flower (Cuphea hookeriana) and white elm (Ulmus americana) composition.In some cases, described cell is former frustule.In some embodiments, described cell belongs to micro-Trentepohlia or the species that are selected from the micro-algae indicated in table 1.

In the third aspect, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that C12:0 accounts at least 10% or at least 15%, preferably accounts at least 13%.In some cases, the lipid kenel is that C12:0 accounts at least 30%, at least 35% or at least 40%, preferably accounts at least 34%.In some cases, the ratio of C12 and C14 is at least 5: 1.In some cases, described cell is reconstitution cell.In some embodiments, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C12 for chain length has hydrolytic activity.In some cases; described reconstitution cell comprises at least two kind allogenic genes of coding from the fatty acyl-acp thioesterase albumen of California bay (Umbellularia californica) and camphor tree (Cinnamomum camphora), and the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C12 for chain length has hydrolytic activity.In some embodiments, described cell is former frustule.

In fourth aspect, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that C14:0 accounts at least 5% or at least 15%, preferably accounts at least 10%.In some cases, the lipid kenel is that C14:0 accounts at least 40%, at least 45% or at least 50%, preferably accounts at least 43%.In some cases, the ratio of C14:0 and C12:0 is at least 7: 1.In some cases, described cell is reconstitution cell.In some embodiments, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C14 for chain length has hydrolytic activity.In some embodiments, described fatty acyl-acp thioesterase albumen comes from the species of the group of selecting free camphor tree and white elm to form.In some cases, described cell is former frustule.In some embodiments, described cell belongs to micro-Trentepohlia or the species that are selected from the micro-algae indicated in table 1.

Aspect the 5th, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that C16:0 accounts at least 10% or at least 20%, preferably accounts at least 15%.In some cases, the lipid kenel is that C16:0 accounts at least 30%, at least 35% or at least 40%, preferably accounts at least 37%.In some cases, described cell is reconstitution cell.In some embodiments, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C16 for chain length has hydrolytic activity.In some embodiments; described reconstitution cell comprises at least two kind allogenic genes of coding from the fatty acyl-acp thioesterase albumen of California bay and camphor tree, and the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C16 for chain length has hydrolytic activity.In some cases, described cell is former frustule.

Aspect the 6th, the invention provides the oleaginous microorganism cell, microalgae cell preferably, the lipid kenel of described cell is that saturated fatty acid accounts at least 55% or at least 65%, preferably accounts at least 60%.In some cases, the lipid kenel of described cell is that saturated fatty acid accounts at least 80%, at least 85% or at least 90%, preferably accounts at least 86%.In some cases, described cell is reconstitution cell.In some embodiments, the allogenic gene that described reconstitution cell comprises coding fatty acyl-acp thioesterase albumen, the fatty acyl group-ACP substrate that described fatty acyl-acp thioesterase albumen is C10-C16 for chain length has hydrolytic activity.In some embodiments, the allogenic gene that described cell comprises coding keto acyl base synthase protein.In some cases, described cell is former frustule.

Aspect the 7th, the invention provides the oleaginous microorganism cell, microalgae cell preferably, described cell comprises saltant type endogenous delta 8 desaturase genes, and wherein said sudden change makes described gene or desaturase non-activity.In some cases, the lipid kenel of described cell is that saturated fatty acid accounts at least 40% or at least 50%, preferably accounts at least 45%.In some cases, the lipid kenel of described cell is that C18:0 accounts at least 15%, at least 20% or at least 25%, preferably accounts at least 19%.In some embodiments, described cell comprises saltant type endogenous delta 8 desaturase genes, and described saltant type endogenous delta 8 desaturase genes makes to be compared C18:0 lipid acid and be increased at least 2 times with wild-type cell.In some cases, the lipid kenel of described microalgae cell is that C18:2 accounts at the most 1% or at the most 5%, preferably accounts at the most 2%.In some embodiments, the lipid kenel of described microalgae cell is to account at the most 5% or at the most 10% at 18: 1, preferably accounts at the most 7%.

In some embodiments of reconstitution cell as herein described, described cell comprises saltant type endogenous delta 8 desaturase genes, and wherein said sudden change makes described gene or desaturase non-activity.

In eight aspect, the invention provides a kind of method for preparing lipid.In one embodiment, described method comprises that (a) cultivation cell as described above is until account at least 15% or at least 25% with the dry weight basis lipid in described cell, preferably account for till at least 20%, and (b) lipid is separated with water-soluble biological matter component.

Aspect the 9th, the invention provides the method that another kind prepares lipid.In one embodiment; described method comprises that (a) cultivates the oleaginous microorganism cell; preferably cultivate microalgae cell; the allogenic gene that described cell contains the two kinds of different fatty acyl-acp thioesterases of encoding; the lipid kenel of wherein said cell is different from (i) containing the kenel of the cell of described allogenic gene with (ii) only containing a kind of kenel of cell of allogenic gene, and (b) lipid is separated with water-soluble biological matter component.The fatty acyl group of the group that in some cases, at least one allogenic gene coding selects the thioesterase that indicates in Free Surface 4 to form-ACP thioesterase.

Aspect the tenth, the invention provides a kind of method for preparing oil-based products.In one embodiment, described method comprises that (a) cultivation cell as described above is until account at least 5% or at least 15% with the dry weight basis lipid in described cell, preferably account for till at least 10%, (b) lipid is separated with water-soluble biological matter component, and (c) lipid is selected to freely at least one chemical reaction of the following group formed: saponification; Metathesis; Acid hydrolysis; Basic hydrolysis; Enzymically hydrolyse; Catalytic hydrolysis; The hot pressurized water hydrolysis; Catalytic hydrolysis reaction, wherein make lipid resolve into glycerine and lipid acid; Produce the amination reaction of aliphatics nitrogen compound; Produce the ozonolysis reactions of monoprotic acid and diprotic acid; The triglyceride level decomposition reaction, select free enzymatic decomposition and pressure to decompose the group formed; Carry out condensation reaction after hydrolysis reaction; The hydrotreatment reaction; Hydrotreatment reaction and before the hydrotreatment reaction or simultaneously carry out deoxygenation or condensation reaction; Except solid/liquid/gas reactions; Deoxygenation, the group of selecting free hydrogenolysis, hydrogenation, continuous hydrogenation-hydrogenolysis, continuous hydrogenolysis-hydrogenation and associating hydrogenation-hydrogenolysis to form; Carry out condensation reaction after deoxygenation; Esterification; Transesterification reaction; Transesterification; Hydroxylating; And carry out condensation reaction after hydroxylating, so as to the base product that produces oil.

In some cases, described oil-based products is selected from soap or fuel product.In some embodiments, described oil-based products is the fuel product of the group of selecting free biofuel, renewable diesel and rocket engine fuel to form.In some cases, described fuel product is the biofuel with one or more lower Column Properties: (i) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably total carotinoid of 0.05mcg/g-0.244mcg/g; (ii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the Lyeopene of 0.003mcg/g; (iii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the β-carotene of 0.003mcg/g; (iv) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably Chlorophyll A of 0.045mcg/g-0.268mcg/g; (v) 1mcg/g-500mcg/g, 35mcg/g-175mcg/g, the preferably Gamma-Tocopherol of 38.3mcg/g-164mcg/g; (vi) be less than 1%, be less than 0.5%, preferably be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; (vii) 100mcg/g-500mcg/g, 225mcg/g-350mcg/g, preferably total tocotrienols of 249.6mcg/g-325.3mcg/g; (viii) 0.001mcg/g-0.1mcg/g, 0.0025mcg/g-0.05mcg/g, the preferably xenthophylls of 0.003mcg/g-0.039mcg/g; Or (ix) 10mcg/g-500mcg/g, 50mcg/g-300mcg/g, the preferably tocopherol of 60.8mcg/g-261.7mcg/g.In some cases, fuel product is the renewable diesel that T10-T90 is at least 20 ℃, 40 ℃ or 60 ℃.In some cases, fuel product is the rocket engine fuel that meets HRJ-5 and/or ASTM standard D1655.

The tenth on the one hand, the invention provides a kind of triglyceride level oils, described triglyceride level oils comprises that (a) C8:0 accounts at least 3%, C10:0 accounts at least 4%, C12:0 accounts at least 13%, C14:0 account at least 10% and/or saturated fatty acid account at least 60% lipid kenel, and (b) one or more lower Column Properties: (i) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably total carotinoid of 0.05mcg/g-0.244mcg/g; (ii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the Lyeopene of 0.003mcg/g; (iii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the β-carotene of 0.003mcg/g; (iv) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably Chlorophyll A of 0.045mcg/g-0.268mcg/g; (v) 1mcg/g-300mcg/g, 35mcg/g-175mcg/g, the preferably Gamma-Tocopherol of 38.3mcg/g-164mcg/g; (vi) be less than 1%, be less than 0.5%, preferably be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; (vii) 100mcg/g-500mcg/g, 225mcg/g-350mcg/g, preferably total tocotrienols of 249.6mcg/g-325.3mcg/g; (viii) 0.001mcg/g-0.1mcg/g, 0.0025mcg/g-0.05mcg/g, the preferably xenthophylls of 0.003mcg/g-0.039mcg/g; Or (ix) 10mcg/g-500mcg/g, 50mcg/g-300mcg/g, the preferably tocopherol of 60.8mcg/g-261.7mcg/g.

Aspect the 12, the invention provides a kind of oil of separation, described oil is from C8: the C10 fatty acid rate is micro-algae of at least 5: 1.In related fields, the invention provides a kind of oil of separation, described oil is from having at least 50% to 75%, preferably micro-algae of at least 60% saturated fatty acid.In another related fields, the invention provides a kind of oil of separation, described oil is from C16: 14 fatty acid rates are about micro-algaes of 2: 1.In another related fields again, the invention provides a kind of oil of separation, described oil is from C12: the C14 fatty acid rate is micro-algae of at least 5: 1.In some embodiments, described micro-algae contains at least one allogenic gene.In some cases, described micro-Trentepohlia is in former Trentepohlia.

At the tenth three aspects:, the invention provides a kind of triglyceride level oils, described triglyceride level oils comprises (a) following lipid kenel:<C12 and accounts for and be less than 5% or be less than 2%, preferably accounts for and is less than 1%; C14:0 accounts between 1%-10%, preferably accounts between 2%-7%; C16:0 accounts between 20%-35%, preferably accounts between 23%-30%; C18:0 accounts between 5%-20%, preferably accounts between 7%-15%; C18:1 accounts between 35%-60%, preferably accounts between 40%-55%; And C18:2 lipid acid accounts between 1%-20%, preferably account between 2%-15%; And (b) one or more lower Column Properties: (i) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably total carotinoid of 0.05mcg/g-0.244mcg/g; (ii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the Lyeopene of 0.003mcg/g; (iii) be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the β-carotene of 0.003mcg/g; (iv) 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, the preferably Chlorophyll A of 0.045mcg/g-0.268mcg/g; (v) 1mcg/g-300mcg/g, 35mcg/g-175mcg/g, the preferably Gamma-Tocopherol of 38.3mcg/g-164mcg/g; (vi) be less than 1%, be less than 0.5%, preferably be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; (vii) 100mcg/g-500mcg/g, 225mcg/g-350mcg/g, preferably total tocotrienols of 249.6mcg/g-325.3mcg/g; (viii) 0.001mcg/g-0.1mcg/g, 0.0025mcg/g-0.05mcg/g, the preferably xenthophylls of 0.003mcg/g-0.039mcg/g; Or (ix) 10mcg/g-500mcg/g, 50mcg/g-300mcg/g, the preferably tocopherol of 60.8mcg/g-261.7mcg/g.

In some cases, triglyceride level oils is to separate the microorganism from comprising one or more allogenic genes.In some embodiments, one or more allogenic gene coding fatty acyl group-ACP thioesterases.In some cases, the fatty acyl group-ACP substrate that described fatty acyl group-ACP thioesterase is C14 for chain length has hydrolytic activity.In some embodiments, described microorganism further comprises saltant type endogenous delta 8 desaturase genes, and wherein said sudden change makes described gene or desaturase non-activity.

Aspect the 14, the invention provides a kind of method for preparing triglyceride level oils, described triglyceride level oils comprises following lipid kenel:<C12 and accounts for and be less than 5% or be less than 2%, preferably accounts for and is less than 1%; C14:0 accounts between 1%-10%, preferably accounts between 2%-7%; C16:0 accounts between 20%-35%, preferably accounts between 23%-30%; C18:0 accounts between 5%-20%, preferably accounts between 7%-15%; C18:1 accounts between 35%-60%, preferably accounts between 40%-55%; And C18:2 lipid acid accounts between 1%-20%, preferably account between 2%-15%, wherein from the microorganism that comprises one or more allogenic genes, isolate described triglyceride level oils.In some cases, described triglyceride level oils comprises following lipid kenel: C14:0 accounts for 1%-10%, preferably accounts for 3%-5%; C16:0 accounts for 20%-30%, preferably accounts for 25%-27%; C18:0 accounts for 5%-20%, preferably accounts for 10%-15%; And C18:1 accounts for 35%-50%, preferably account for 40%-45%.In some embodiments, one or more allogenic gene coding fatty acyl group-ACP thioesterases.In some cases, the fatty acyl group-ACP substrate that described fatty acyl group-ACP thioesterase is C14 for chain length has hydrolytic activity.In some cases, described microorganism further comprises saltant type endogenous delta 8 desaturase genes, and wherein said sudden change makes described gene or desaturase non-activity.In some cases, one or more allogenic genes are invertases.In some embodiments, described saltant type endogenous delta 8 desaturase genes is stearyl--acyl carrier protein desaturase (SAD) (for example SEQ ID NO:199-200).In some embodiments, described saltant type endogenous delta 8 desaturase genes is fatty acid desaturase (FAD).

Aspect the 15, the invention provides a kind of oleaginous microorganism cell, microalgae cell preferably, described cell comprises triglyceride level oils, and the lipid acid kenel choosing of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%.In some cases, the oleaginous microorganism cell comprises allogenic gene, and optionally comprises the endogenous desaturase of described oleaginous microorganism cell, inactivation or the sudden change and have less enzymic activity of described endogenous desaturase.

In some cases, the lipid acid kenel of triglyceride level oils is similar to the lipid acid kenel of naturally occurring oil.In some cases, the group formed below naturally occurring grease separation freely: theobroma oil, Oleum Cocois, plam oil, palm-kernel oil, shea butter, tallow and lard.In some cases, the lipid acid kenel of triglyceride level oils comprises the freely kenel of the following group formed of choosing: the combination total amount of C8:0 and C10:0 is at least about 10%; The combination total amount of C10:0, C12:0 and C14:0 is at least about 50%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%; And the combination total amount of C18:1 and C18:2 is less than approximately 30%.In some cases, the lipid acid kenel of triglyceride level oils comprises the freely fatty acid rate of the following group formed of choosing: the ratio of C8:0 and C10:0 is at least about 5: 1; The ratio of C10:0 and C12:0 is at least about 6: 1; The ratio of C12:0 and C14:0 is at least about 5: 1; The ratio of C14:0 and C12:0 is at least about 7: 1; And the ratio of C14:0 and C16:0 is at least about 1: 2.

In some cases, the endogenous desaturase selects the group that free stearyl-ACP desaturase and δ-12 fatty acid desaturase form.In some cases, allogenic gene selects the group of the genomic constitution of the fatty acyl-acp thioesterase of freely encoding.In some cases, the allogenic gene coding selects the fatty acyl-acp thioesterase of the group of those fatty acyl-acp thioesterases compositions that indicate in Free Surface 4.In some cases, the oleaginous microorganism cell further comprises the gene of encoding sucrose saccharase.

In various embodiments, the oleaginous microorganism cell is to be selected from following micro-Trentepohlia or the cell of species: the bent shell algae (Achnanthes orientalis) in east, Ah lattice's Trentepohlia (Agmenellum), transparent cocoon shape algae (Amphiprora hyaline), Amphora coffeaeformis (Amphoracoffeiformis), the linear mutation of Amphora coffeaeformis (Amphora coffeiformis linea), Amphora coffeaeformis point line mutation (Amphora coffeiformis punctata), Amphora coffeaeformis Tai Leshi mutation (Amphora coffeiformis taylori), the small-sized mutation of Amphora coffeaeformis (Amphora coffeiformis tenuis), graceful two eyebrow algae (Amphora delicatissima), graceful two eyebrow algae head mutation (Amphora delicatissima capitata), double eyebrow algae spp (Amphora sp.), necklace Trentepohlia (Anabaena), Ankistrodesmus (Ankistrodesmus), crescent algae fibre (Ankistrodesmus falcatus), gold look algae (Boekelovia hooglandii), Podbielniak Trentepohlia (Borodinella sp.), Botryococcus braunii (Botryococcus braunii), Su Taidekesi grape algae (Botryococcus sudeticus), block special Trentepohlia (Carteria), Chaetoceros gracilis (Chaetoceros gracilis), Chaetoceros muelleri (Chaetoceros muelleri), the wide salt mutation of Chaetoceros muelleri (Chaetoceros muelleri subsalsum), Chaetoceros belongs to (Chaetoceros sp.), without nitre chlorella (Chlorella anitrata), South Pole chlorella (Chlorella Antarctica), gold green chlorella (Chlorella aureoviridis), Ka Shi chlorella (Chlorella candida), packing chlorella (Chlorella capsulate), dehydration chlorella (Chlorella desiccate), oval chlorella (Chlorella ellipsoidea), chlorella (Chlorella emersonii) swims, light brown chlorella (Chlorella fusca), light brown chlorella cavity mutation (Chlorella fusca var.vacuolata), Gu Shi chlorella (Chlorella glucotropha), water small stream chlorella (Chlorellainfusionum), the seashore mutation (Chlorella infusionum var.actophila) of dwelling of water small stream chlorella, water small stream chlorella increases mutation (Chlorella infusionum var.auxenophila), Kai Shi chlorella (Chlorella kessleri), crawl and fan chlorella (Chlorellalobophora) (algae strain SAG 37.88), yellowish green chlorella (Chlorella luteoviridis), the green mutation (Chlorella luteoviridis var.aureoviridis) of yellowish green chlorella gold, the yellowish mutation of yellowish green chlorella (Chlorella luteoviridis var.lutescens), red algae chlorella (Chlorellaminiata), atomic chlorella (Chlorella minutissima), sudden change chlorella (Chlorellamutabilis), chlorella at night (Chlorella nocturna), bar Fu Shi chlorella (Chlorellaparva), have a liking for light chlorella (Chlorella photophila), Pu Shi chlorella (Chlorellapringsheimii), original chlorella (Chlorella protothecoides) (comprises UTEX algae strain 1806, 411, 264, 256, 255, 250, 249, 31, 29, 25 and the strain 211/17 of CCAP algae and 211/8d in any), the acidproof mutation of original chlorella (Chlorellaprotothecoides var.acidicola), rule chlorella (Chlorella regularis), the rule small-sized mutation of chlorella (Chlorella regularis var.minima), rule chlorella umbrella mutation (Chlorella regularis var.umbricata), Rui Shi chlorella (Chlorella reisiglii), have a liking for sugared chlorella (Chlorella saccharophila), have a liking for the oval mutation (Chlorellasaccharophila var.ellipsoidea) of sugared chlorella, the living chlorella of salt (Chlorella salina), simple chlorella (Chlorella simplex), heat resistance chlorella (Chlorella sorokiniana), Chlorella (Chlorella sp.), spheroidal globule algae (Chlorella sphaerica), Si Dige chlorella (Chlorella stigmatophora), ten thousand Nissl chlorellas (Chlorella vanniellii), chlorella vulgaris (Chlorella vulgaris), chlorella vulgaris, chlorella vulgaris tertia modification (Chlorellavulgaris f.tertia), chlorella vulgaris autotrophy mutation (Chlorella vulgaris var.autotrophica), the green mutation (Chlorella vulgaris var.viridis) of chlorella vulgaris, the common mutation of chlorella vulgaris (Chlorella vulgaris var.vulgaris), the common mutation tertia of chlorella vulgaris modification (Chlorella vulgaris var.vulgaris f.tertia), the green modification (Chlorella vulgaris var.vulgaris f.viridis) of the common mutation of chlorella vulgaris, yellow chlorella (Chlorella xanthella), Zuo Shi chlorella (Chlorella zofingiensis), his Bai Shi chlorella (Chlorella trebouxioides), chlorella vulgaris, water small stream Chlorococcum (Chlorococcuminfusionum), Chlorococcum (Chlorococcum sp.), green shuttle Trentepohlia (Chlorogonium), Chroomonas (Chroomonas sp.), gold goal Trentepohlia (Chrysosphaera sp.), ball calcium plate Trentepohlia (Cricosphaera sp.), hidden Trentepohlia (Cryptomonas sp.), hidden little ring algae (Cyclotellacryptica), Mei Nixiao encircles algae (Cyclotella meneghiniana), Cyclotella (Cyclotellasp.), Dunaliella (Dunaliella sp.), Baeyer Dai Weiledushi algae (Dunaliellabardawil), eyes Du Shi algae (Dunaliella bioculata), graininess Du Shi algae (Dunaliellagranulate), ocean Du Shi algae (Dunaliella maritime), small Du Shi algae (Dunaliellaminuta), Ba Fudushi algae (Dunaliella parva), than thunder Du Shi algae (Dunaliellapeircei), Pu Linmodushi algae (Dunaliella primolecta), Dunaliella salina (Dunaliellasalina), Lu Sheng Du Shi algae (Dunaliella terricola), Te Shi Du Shi algae (Dunaliellatertiolecta), green Du Shi algae (Dunaliella viridis), Te Shi Du Shi algae, green solely ball algae (Eremosphaera viridis), only ball Trentepohlia (Eremosphaera sp.), oval Trentepohlia (Ellipsoidon sp.), Euglena (Euglena), Fu Shi Trentepohlia (Franceia sp.), the crisp bar algae in Crow (Fragilaria crotonensis), Fragilaria (Fragilaria sp.), Gloeocapsa (Gleocapsa sp.), Liz Trentepohlia (Gloeothamnion sp.), hymenomonas (Hymenomonas sp.), Isochrysis galbana ball affinis (Isochrysis aff.galbana), ball Isochrysis galbana (Isochrysis galbana), Lepocinclis (Lepocinclis), Micractinium (Micractinium), Micractinium (UTEX LB 2614), small single needle algae (Monoraphidium minutum), single needle Trentepohlia (Monoraphidium sp.), Nannochloropsis oculata belongs to (Nannochloris sp.), salt is given birth to micro-plan ball algae (Nannochloropsis salina), micro-Sphaerellopsis (Nannochloropsis sp.), agreeable boat-shaped algae (Navicula acceptata), Bi Shi boat-shaped algae (Navicula biskanterae), Navicula pseudotenelloides, film boat-shaped algae (Navicula pelliculosa), have a liking for rotten boat-shaped algae (Navicula saprophila), Navicula (Navicula sp.), kidney Dictyocha (Nephrochloris sp.), Nephroselmis (Nephroselmis sp.), common rhombus algae (Nitschia communis), Alexandria rhombus algae (Nitzschiaalexandrina), common rhombus algae (Nitzschia communis), disperse rhombus algae (Nitzschiadissipata), fragment rhombus algae (Nitzschia frustulum), Han Shi rhombus algae (Nitzschiahantzschiana), mediocre rhombus algae (Nitzschia inconspicua), medium-sized rhombus algae (Nitzschia intermedia), microcephaly's rhombus algae (Nitzschia microcephala), small rhombus algae (Nitzschia pusilla), the oval mutation (Nitzschia pusilla elliptica) of small rhombus algae, small rhombus algae does not receive mutation (Nitzschia pusilla monoensis), quadrangle rhombus algae (Nitzschia quadrangular), Nitzschia (Nitzschia sp.), Ochromonas (Ochromonas sp.), ovule born of the same parents algae (Oocystis parva), minimum ooecium algae (Oocystispusilla), ooecium Trentepohlia (Oocystis sp.), algae (Oscillatoria limnetica) quivers in lake, Oscillatoria (Oscillatoria sp.), the inferior short algae that quivers (Oscillatoria subbrevis), have a liking for sour Pa Shi algae (Pascheria acidophila), bar husband's Trentepohlia (Pavlova sp.), Phacus (Phagus), Phormidium (Phormidium), flat algae belongs to (Platymonas sp.), Ka Shi cocolith (Pleurochrysiscarterae), dentation cocolith (Pleurochrysis dentate), coccolith Trentepohlia (Pleurochrysissp.), Prototheca wickerhamii (Prototheca wickerhamii), the stagnant former algae of harmony (Protothecastagnora), Puerto Rico former algae (Prototheca portoricensis), the former algae of mulberry fruit shape (Prototheca moriformis), the former algae of Rao Shi (Prototheca zopfii), tower born of the same parents Trentepohlia (Pyramimonas sp.), mulberry fruit Trentepohlia (Pyrobotrys), cryptomere chrysophyceae (Sarcinoidchrysophyte), by first grid algae (Scenedesmus armatus), Spirogyra (Spirogyra), blunt top spirulina (Spirulina platensis), split Ulothrix (Stichococcus sp.), Synechococcus belongs to (Synechococcus sp.), four Ceratiums (Tetraedron), four slit bamboo or chopped wood Trentepohlias (Tetraselmissp.), department Xisi slit bamboo or chopped wood algae (Tetraselmis suecica), Wei Shi hailian seaweed (Thalassiosiraweissflogii) and Viridiella fridericiana.

In some cases, the cell that described oleaginous microorganism cell is former Trentepohlia.In some cases, the cell that described oleaginous microorganism cell is the former Trentepohlia of mulberry fruit shape.

In some cases, described oleaginous microorganism cell is the oleaginous yeast cell.In some cases, described oleaginous microorganism cell is the produce oil bacterial cell.

In some cases, naturally occurring oil is that theobroma oil and allogenic gene comprise safflower (Carthamus tinctorus) thioesterase gene.In some cases, naturally occurring oil is Oleum Cocois.In some cases, naturally occurring oil is that plam oil and allogenic gene comprise oil palm (Elaeis guiniensis) thioesterase gene, spire calyx apart from flower thioesterase gene, spire calyx apart from the combination of spending KAS IV gene and bad Te Shi calyx apart from flower (Cuphea wrightii) FATB2 gene, or through designing to destroy the construct of endogenous KAS II gene.In some cases, naturally occurring oil is that palm-kernel oil and allogenic gene comprise bad Te Shi calyx apart from flower FATB2 gene and the combination with the construct of destruction endogenous SAD2B gene through design.In some cases, naturally occurring oil is shea butter.In some cases, naturally occurring oil is tallow.In some cases, naturally occurring oil is lard, and allogenic gene comprises California bay thioesterase gene and combination, mangosteen (Garcinia mangostana) thioesterase gene and combination, swede type rape (Brassica napus) thioesterase gene of process design with the construct of destruction endogenous SAD2B gene through designing the construct to destroy endogenous SAD2B gene, or the spire calyx is apart from the flower thioesterase gene.

Aspect the 16, the invention provides a kind of oleaginous microorganism triglyceride oil based composition, the lipid acid kenel choosing of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%.In various embodiments, prepare the triglyceride oil based composition by cultivation oleaginous microorganism cell in substratum or restructuring oleaginous microorganism cell colony, wherein the oleaginous microorganism cell as described above, especially above about described those cells of a fifteenth aspect of the present invention.

In some cases, oleaginous microorganism triglyceride oil based composition further comprises the freely attribute of the following group formed of choosing: the total carotinoid that (i) is less than 0.3mcg/g; (ii) be less than the Lyeopene of 0.005mcg/g; (iii) be less than the β-carotene of 0.005mcg/g; (iv) be less than the Chlorophyll A of 0.3mcg/g; (v) be less than the Gamma-Tocopherol of 175mcg/g; (vi) be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; (vii) be less than total tocotrienols of 350mcg/g; (viii) be less than the xenthophylls of 0.05mcg/g; Or (ix) be less than the tocopherol of 275mcg/g.

Aspect the 17, the invention provides a kind of method for preparing oleaginous microorganism triglyceride oil based composition, the lipid acid kenel choosing of described composition is the following group formed freely: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%, wherein said method comprises the following steps: (a) in substratum, cultivate the oleaginous microorganism cell colony until the dry cell weight of described oleaginous microorganism cell at least 10% be triglyceride level oils; And (b) isolate the triglyceride oil based composition from the oleaginous microorganism cell.In various embodiments, via the oleaginous microorganism cell or restructuring oleaginous microorganism cell (especially above about described those cells of a fifteenth aspect of the present invention) colony that cultivate as described above, prepare the triglyceride oil based composition.

In the tenth eight aspect, the invention provides a kind of method for preparing oil-based products, wherein said method comprises the following steps: (a) to as above about the described oleaginous microorganism triglyceride oil of a sixteenth aspect of the present invention based composition, select freely at least one chemical reaction of the group of following composition: saponification; Metathesis; Acid hydrolysis; Basic hydrolysis; Enzymically hydrolyse; Catalytic hydrolysis; The hot pressurized water hydrolysis; Catalytic hydrolysis reaction, wherein make lipid resolve into glycerine and lipid acid; Produce the amination reaction of aliphatics nitrogen compound; Produce the ozonolysis reactions of monoprotic acid and diprotic acid; The triglyceride level decomposition reaction, select free enzymatic decomposition and pressure to decompose the group formed; Carry out condensation reaction after hydrolysis reaction; The hydrotreatment reaction; Hydrotreatment reaction and before the hydrotreatment reaction or simultaneously carry out deoxygenation or condensation reaction; Except solid/liquid/gas reactions; Deoxygenation, the group of selecting free hydrogenolysis, hydrogenation, continuous hydrogenation-hydrogenolysis, continuous hydrogenolysis-hydrogenation and associating hydrogenation-hydrogenolysis to form; Carry out condensation reaction after deoxygenation; Esterification; Transesterification reaction; Transesterification; Hydroxylating; And carry out condensation reaction after hydroxylating; And (b) reaction product is separated with other component.

In some cases, described oil-based products is selected the group that free soap, fuel, dielectric fluid, hydraulic liquid, softening agent, lubricant, heat-transfer fluid and metal working fluid form.In some cases, described oil-based products is the freely fuel product of the following group formed of choosing: (a) biofuel; (b) renewable diesel; And (c) rocket engine fuel.

In some cases, described fuel product is the biofuel with one or more lower Column Properties: the total carotinoid that (i) is less than 0.3mcg/g; (ii) be less than the Lyeopene of 0.005mcg/g; (iii) be less than the β-carotene of 0.005mcg/g; (iv) be less than the Chlorophyll A of 0.3mcg/g; (v) be less than the Gamma-Tocopherol of 175mcg/g; (vi) be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; (vii) be less than total tocotrienols of 350mcg/g; (viii) be less than the xenthophylls of 0.05mcg/g; Or (ix) be less than the tocopherol of 275mcg/g.

In some cases, fuel product is the renewable diesel that T10-T90 is at least 20 ℃, 40 ℃ or 60 ℃.

In some cases, fuel product is the rocket engine fuel that meets HRJ-5 and/or ASTM standard D1655.

During these and other side of the present invention and embodiment are described and are illustrated in following examples in accompanying drawing (accompanying drawing is sketched following closely) and following detailed Description Of The Invention.Above and any or all feature of discussing in whole the application can in various embodiments of the present invention, combine.

The accompanying drawing summary

Fig. 1 shows the color atlas of the renewable diesel of being produced by former algae triglyceride level oils.

Detailed Description Of The Invention

The present invention is because finding that former algae and some related microorganisms have unexpectedly the advantageous feature and the discovery that can be used for low-cost and production oils in large quantities, fuel and other hydro carbons or lipid composition and produce with method and the reagent of improveing these characteristics for these microorganisms being carried out to the genetics change.Oils by these microorganisms can be used in transport fuel, grease chemical article and/or foods and cosmetics industry and other application.Lipid is carried out to transesterification effect meeting and produce the long chain fatty acid ester that can be used as biofuel.Other enzymatic and chemical process can be suitable for producing lipid acid, aldehyde, alcohol, alkane and alkene.In some applications, production renewable diesel, rocket engine fuel or other hydrocarbon compound.The present invention also provides the method for cultivating micro-algae, in order to improve output and to improve the lipid productive rate, and/or more cost-effective produces composition as herein described.

For the ease of reading, this detailed Description Of The Invention is divided into several parts.Part i provides the definition of term used herein.Part ii has been described the culture condition used in the inventive method.III has partly described genetically engineered method and material.IV has partly described and for example, has carried out genetically engineered can utilize sucrose to microorganism (former algae).V partly described microorganism (for example former algae) is carried out genetically engineered to regulate the lipid biosynthesizing.VI has partly described the method for preparing fuels and chemicals.VII partly discloses embodiments of the invention and embodiment.The detailed Description Of The Invention back is the embodiment of explanation all respects of the present invention and embodiment.

I. definition

Unless otherwise defined, otherwise all technology used herein and scientific terminology have common the understood implication with those skilled in the art in the invention.Following reference provides the General Definition of the many terms that use in the present invention: Singleton etc. for the technician, Dictionaryof Microbiology and Molecular Biology (1994 the 2nd edition); The CambridgeDictionary of Science and Technology (Walker writes, 1988); TheGlossary of Genetics, the 5th edition, R.Rieger etc. (writing), Springer Verlag (1991); And Hale and Marham, The Harper Collins Dictionary of Biology (1991).Except as otherwise noted, otherwise following term used herein has the implication that belongs to them.

" in micro-algae, there is activity " and refer to the nucleic acid that there is function in micro-algae.For instance, be used to drive antibiotics resistance gene to give Transgenic Microalgae and there is activity with the promotor of antibiotics resistance in micro-algae.

" acyl carrier protein " or " ACP " is a kind of following protein, described protein lipid acid between synthesis phase 4 '-component of being combined and comprising the Fatty acid synthetase mixture with the mercaptan ester-formin with the acyl chain increased on the end mercaptan of phosphopantetheine part.

" acyl group-coenzyme A molecule " or " acyl group-coenzyme A " are a kind of following molecules, described molecule be included in 4 of coenzyme A '-the end mercaptan of phosphopantetheine part on via mercaptan ester bond and the covalently bound acyl moiety of coenzyme A.

" area percentage " refers to the peak area that utilizes FAME GC/FID detection method to observe, and in described detection method, before detection, each lipid acid in sample all changed into to fatty acid methyl ester (FAME).For instance, with other any lipid acid (as C14:1), compare, for thering are 14 carbon atoms, without undersaturated lipid acid (C14:0), observe independent peak.The peak area of all kinds of FAME is directly proportional to its shared percentage composition in mixture, and the summation that is based on all peaks that exist in sample is calculated (i.e. [total areas at the area of specific peak/all peaks that measure] * 100).When mentioning the lipid kenel of oils of the present invention and cell, " C8-C14 accounts at least 4% " meaning be in cell or the glyceride composition that extracts in total fatty acids at least 4% there is the chain length that comprises 8,10,12 or 14 carbon atoms.

" aseptic " is not to be subject to the organic culture that other Living Organism pollutes.

" biofuel " is the fatty acid alkyl ester that utilizes biological method to produce, and it is suitable for being used as fuel in diesel motor.

" biomass " are the materials produced by Growth of Cells and/or breeding.Biomass may contain inclusion and ECM in cell and/or cell, include but not limited to the compound by emiocytosis.

" bio-reactor " be a kind of in the middle of optionally with the seal bootr of form of suspension culturing cell or partial closure's cover.

" catalyzer " is a kind of reagent, and as molecule or macromolecular complex, it can be facilitated or promote to make reactant to form the chemical reaction of product and can not become the part of product.Catalyzer can improve speed of reaction, and catalyzer may act on another reactant to form product afterwards.Catalyzer generally makes the total activation energy that reacts required reduce, so that reaction is carried out quickly or at lower temperature.Therefore, may reach more quickly molecular balance.The example of catalyzer comprises enzyme, and it is biological catalyst; Heat, it is non-biological catalyst; And for the metal of petroleum refinery process.

" cellulosic material " is cellulosic digestion product, comprises glucose and xylose, and other compound optionally, as disaccharides, oligosaccharides, xylogen, furfural and other compound.The limiting examples in the source of cellulosic material comprises bagasse, beet pulp, corn stalk, wood shavings, sawdust and switchgrass.

" cultivate altogether " and its variant, as " cultivating altogether " and " fermentation altogether " refers to, have the cell of two or more types in same bio-reactor.The cell of two or more types may be all microorganisms, as micro-algae, may be maybe that microalgae cell is cultivated together from different cell types.Culture condition can be to promote the Growth of Cells of two or more types and/or the condition of breeding, or facilitates the growth of a kind of or subset and/or breeding in two or more cells, maintains the condition of all the other Growth of Cells simultaneously.

" cofactor " is to bring into play the required any molecule of its enzymic activity for enzyme except substrate.

" complementary DNA " or " cDNA " is the DNA copy of mRNA, and reverse transcription or the amplification (for example, via polymerase chain reaction (" PCR ")) by messenger RNA(mRNA) (mRNA) obtains usually.

" cultivation " and its variant, as " cultivation " and " fermentation " refers to by using condition selected and/or that control to promote wittingly one or more Growth of Cells (cell size, cell content and/or cytoactive increase) and/or breeding (cell number being increased via mitotic division).The combination of growth and reproduction can be known as propagation.The example selected and/or condition controlled comprises and utilizes limited substratum (having known features, as pH value, ionic concn and carbon source), assigned temperature, oxygen pressure, carbon dioxide level and grow in bio-reactor.Cultivate and do not refer to microorganism in the situation that occurring in nature or growth or the breeding for intervening at nobody; For example, thereby organic nature is grown, the process that produces geology crude oil of finally becoming fossilized not is to cultivate.

" cytolysis " is the dissolving of cell in hypotonic environment.Cytolysis is to be caused to lateral movement (excess moisture) in cell by excessive permeation or water.Cell can not bear the osmotic pressure of inboard water, and therefore breaks.

" spent meal (Delipidated meal) " and " microbial biomass of degreasing " are that central oils (comprising lipid) has been extracted or has isolated later microbial biomass, and described extraction or separation are via use mechanical system (implementing by squeezing machine) or solvent-extraction process or realize by these two kinds of modes simultaneously.With extraction from microbial biomass or before separating oils/lipid, compare, the amount of the oils/lipid in spent meal reduces, but contains some residual oils/lipids.

" expression vector " or " expression construct " or " plasmid " or " recombinant DNA construction body " refer to the nucleic acid produced via human intervention (comprising by recombinant means or directly chemosynthesis), and wherein the nucleic acid elements of a series of appointments makes the specific nucleic acid can be in host cell transcription and/or translation.Expression vector can be the part of plasmid, virus or nucleic acid fragment.Expression vector generally includes the nucleic acid that remains to be transcribed, and it is operably connected with promotor.

" allogenic gene " is be introduced into (" conversion ") in cell and encoded so that the nucleic acid of RNA and/or protein expression.Reconstitution cell can be called as through the cell transformed, wherein other allogenic gene may be introduced.With respect to transformed cell, allogenic gene may come from different species (and being therefore allos), or comes from identical species (and being therefore homology).Therefore, allogenic gene can comprise that the endogenous copy with respect to gene occupies different positions or the homologous gene under difference is controlled in cellular genome.Allogenic gene can exist and surpass a copy in cell.Allogenic gene can be used as the inset in genome or is maintained in cell as the sequestered molecule.

" exogenous providing " is that the molecule provided in the substratum of cell culture is provided.

" squeezing " is to extract a kind of mechanical means of oils from starting material (as soybean and Semen Brassicae campestris).Squeezing machine is a kind of spiral type machine, and it is via cage shape ladle sample cavity pressed material.Starting material enter a side of squeezing machine, and useless filter cake discharges from opposite side, and oils spills and is collected between the cage bar of cage.The frictional force that described machinery utilization is produced by screw drive and continuous move and compress starting material.Oils spills by the little opening that does not allow solid to pass through.Because starting material are suppressed, so frictional force makes its heating usually.

" fatty acyl group-ACP thioesterase " is the enzyme in the cracking from acyl carrier protein (ACP) of catalysis lipid acid during lipid synthesis.

" fatty acyl group-coenzyme A/aldehyde reductase " is that catalyzing acyl-coenzyme A molecule is reduced into the enzyme of primary alconol.

" fatty acyl group-CoA-reductase " is that catalyzing acyl-coenzyme A molecule is reduced into the enzyme of aldehyde.

" alkanoic decarbonylation base enzyme " is the enzyme that the catalysis alkanoic changes into alkane.

" alkanoic reductase enzyme " is the enzyme that catalysis aldehyde is reduced into primary alconol.

" fixedly carbon source " is a kind of carbon-containing molecules, and organic molecule normally, during it is present in substratum with solid or liquid form under envrionment temperature and pressure and can the Institute of Micro-biology in being incubated at substratum utilize.

" homogenate " is by the biomass of physical damage.

" hydrocarbon " is the molecule that only contains hydrogen atom and carbon atom, the main chain of straight chain, side chain, ring-type or part ring-type that wherein the covalently bound formation of carbon atom is connected with hydrogen atom.The molecular structure of hydrocarbon compound is from the simplest methane (CH ₄) (composition of Sweet natural gas) form to very greatly and very complicated structure (as some molecules of finding in crude oil, oil and pitch, as bituminous matter) do not wait.Hydrocarbon can be gaseous state, liquid state or solid-state form, or any combination of these forms, and can have one or more pairs of keys or triple bond between adjacent carbon atom in main chain.Therefore, described term comprises alkane, alkene, lipid and the paraffin of straight chain, side chain, ring-type or part ring-type.Example comprises propane, butane, pentane, hexane, octane and squalene.

" hydrogen: carbon ratio " is to take each atom in molecule as basic hydrogen atom and the ratio of carbon atom.Described ratio can be used to refer to the number of carbon atom and hydrogen atom in hydrocarbon molecule.For instance, the hydrocarbon that has a ceiling rate is methane CH ₄(4: 1).

" hydrophobic components " be in material in hydrophobic solubility in mutually than part or component high in water.Hydrophobic components is water insoluble and common tool is nonpolar haply.

" lipid gain in yield " refers to that the output of microorganisms cultures increases, for example, by dry cell weight, the per-cent that increases the cell that forms lipid that increases every liter of culture or the lipid total amount that increases every liter of culture volume of time per unit.

" inducible promoter " is to mediate the promotor that the gene that is operatively connected is transcribed in response to specific stimulator.The example of described promotor may be the promoter sequence of inducing under the condition that changes change pH values or nitrogen level.

" being operatively connected " is the functional connection between two nucleotide sequences, and described nucleotide sequence is as control sequence (normally promotor) and institute's catenation sequence (normally the sequence of coded protein, be also referred to as encoding sequence).If promotor can mediate allogenic gene and transcribe, so described promotor and described allogenic gene are operatively connected.

" original position " meaning is " in position going up " or " on its original position ".

" the restricted concentration of nutrient substance " is the concentration that the compound in culture limits the organism breeding of cultivating." the non-limiting concentration of nutrient substance " is to support the at utmost concentration of breeding in given incubation time.Therefore, the cell count of the cell count produced in given incubation time under the nutrient substance of restricted concentration exists when tool is not restricted at described nutrient substance.When the concentration of the nutrient substance existed is greater than the concentration that support at utmost breeds, described nutrient substance is called as in culture " excessive ".

" lipase " is a kind of water-soluble enzyme, the ester linkage hydrolyzing of the water-fast lipid substrates of its catalysis.The Lipase catalysis lipid hydrolysis becomes glycerine and lipid acid.

" lipid-modified enzyme " refers to a kind of enzyme that changes the lipid covalent structure.The example of lipid-modified enzyme comprises lipase, fatty acyl group-ACP thioesterase, fatty acyl group-coenzyme A/aldehyde reductase, fatty acyl group-CoA-reductase, alkanoic reductase enzyme, desaturase (comprising stearyl-acyl carrier protein desaturase (SAD) and fatty acyl group desaturase (FAD)) and alkanoic decarbonylation base enzyme.

" lipid pathway enzyme " is any enzyme played a role in lipid metabolism (being lipid synthesis, modification or degraded), and any protein and the carrier proteins that lipid are carried out to chemically modified.

" lipid " is to dissolve in non-polar solvent (as EC) and relative or complete water-fast molecule.Lipid molecule because of their major parts by the hydrophobic long hydrocarbon tail of tool in nature, forming and there is these characteristics.The example of lipid comprises lipid acid (saturated and unsaturated); Glyceryl ester or glyceride (as monoglyceride, triglyceride, triglyceride level or neutral fat, and phosphoglyceride or glyceryl phosphatide); Nonglyceride (sphingolipid, sterol lipid (comprising cholesterol and steroid hormone), prenol lipid (comprising terpene), fatty alcohol, wax and polyketide); And the compound lipid derivative (connect sugared lipid, or glycolipid, and the lipid that connects albumen)." fat " is the subgroup of lipid, is called as " triacylglycerol ester ".

" molten born of the same parents' thing " is the solution of the inclusion of the cell that contains dissolving.

" dissolving " be the plasma membrane of biological organism and optionally cell walls break and be enough to discharge at least inclusion in some cell, this often realizes by machinery, virus or its integrity of infiltration mechanism damage.

" dissolving " be the cytolemma of biological organism or cell and optionally cell walls destroyed and be enough to discharge at least inclusion in some cell.

" micro-algae " is contain chloroplast(id) or plastid and optionally can carry out photosynthetic eukaryotic microorganisms organism, or can carry out photosynthetic prokaryotic micro-organisms organism.Micro-algae comprises energy metabolism fixed carbon source not as the obligate photoautotroph of energy and relies on the heterotroph that fixedly carbon source is survived fully.Micro-algae comprises the unicellular organism (as Chlamydomonas (Chlamydomonas)) at once separated with sister cell after cell fission, and as the microorganism of volvox (Volvox, it is the simple many cells photosynthetic microorganism of two kinds of different cell types).Micro-algae comprises the cell as chlorella, Dunaliella salina and former algae.Micro-algae also comprises other microorganism photosynthetic organism that represents the intercellular adhesion effect, as Ah lattice's Trentepohlia, necklace Trentepohlia and mulberry fruit Trentepohlia.Micro-algae also comprises loses the obligate heterotrophic microorganism that carries out photosynthetic ability, as the species of some dino flagellate algae species and former Trentepohlia.

" microorganism (microorganism) " and " microorganism (microbe) " is the unicellular organism of microcosmic.

" natural coexpression " meaning about two kinds of protein or gene for example is because express in response to identical stimulator under the control of gene in common adjusting sequence of these two kinds of protein of coding or because of them, so described protein or the natural coexpression of their gene are in the tissue or organism that produce them.

" osmotic shock " is the cell rupture in solution after osmotic pressure reduces suddenly.Induced infiltration is pressed shock so that the cellular component of described cell is discharged in solution sometimes.

" polysaccharide degrading enzyme " is can any polysaccharide hydrolysis of catalysis or any enzyme of saccharification.For instance, cellulase catalyzing cellulose hydrolysis.

The carbohydrate that " polysaccharide " or " glycan " is comprised of the monose connected together by glycosidic link.Mierocrystalline cellulose is the polysaccharide that forms the certain plants cell walls.Can make the Mierocrystalline cellulose depolymerization by enzyme, produce monose (as xylose and glucose) and larger disaccharides and oligosaccharides.

" promotor " is the nucleic acid control sequence of guiding transcribed nucleic acid.Promotor used herein comprises near essential nucleotide sequence transcription initiation site, as in the situation that II type polymerase promoter is the TATA element.Promotor also optionally comprises end enhanser or repressor element, and they can be positioned at transcription initiation site and apart reach on the position of thousands of base pairs.

" restructuring " is that cell, nucleic acid, protein or carrier are modified because introducing has Exogenous Nucleic Acid or primary nucleic acid to change.Therefore, non-existent gene or express the primary gene different with those genes by non-reconstitution cell expression in reconstitution cell express cell primary (non-restructuring) form for example." recombinant nucleic acid " is generally for example, by nucleic acid being operated to (using polysaccharase and endonuclease) and initial in the nucleic acid of external formation, or otherwise is the nucleic acid of the common non-existent form of occurring in nature.Can produce recombinant nucleic acid, for example so that two or more nucleic acid be operatively connected.Therefore, in order to realize purpose of the present invention, by being bonded on the DNA molecular that occurring in nature can not connect usually, the nucleic acid of the separation formed in vitro or expression vector all are considered to restructuring.After recombinant nucleic acid is produced and is incorporated in host cell or organism, it can use the cells in vivo mechanism of host cell to be copied; Yet, although described nucleic acid is copied subsequently after restructuring produces in cell, in order to realize purpose of the present invention, still be considered to restructuring.Equally, " recombinant protein " is to use recombinant technology, by making recombinant nucleic acid express the protein prepared.

" renewable diesel " is the mixture via the alkane (as C10:0, C12:0, C14:0, C16:0 and C18:0) that makes lipid carry out hydrogenation and deoxidation and produce.

" saccharification " is to make biomass (normally Mierocrystalline cellulose or wood fiber biomass) change into the process of monomer sugar (as glucose and xylose)." the process saccharification " or " the process depolymerization " cellulosic material or biomass refer to cellulosic material or the biomass that by saccharification, changed into monomer sugar.

Contained the highest two kinds of triglyceride level and the naturally occurring oils of oils that term " similar " means to compare with naturally occurring oils while not having in the situation that be used to compare with naturally occurring oils further to limit differs about +/-15% or +/-10%.For instance, shea butter (oils of Butyrospermum Parkii (the B.Parkii)) C18:0 that contains 41.2%-56.8% and the C18:1 of 34.0%-46.9% are as two kinds of modal components of triglycerides (referring to table 5).Differ +/-10% using interior " similar " oils should be containing having an appointment 37% to about 62% C18:0 and 31% to about 52% C18:1 as two kinds of modal components of triglycerides.When being used in this case, term " similar " comprises and differs +/-9%, +/-8%, +/-7%, +/-6%, +/-5%, +/-4%, +/-3%, +/-2% or ten/-1%, and can further mean Senior Three kind or the highest four kinds of triglyceride level with naturally occurring oils, or in Senior Three kind triglyceride level two kinds, or in the highest four kinds of triglyceride level three kinds compare.

" sonic treatment " is to utilize acoustic wave energy to destroy the process of biomaterial (as cell).

" furfural material " is 2 furan carboxyaldehyde or the derivative of the identical basic structural feature of maintenance.

" straw " is dry stem and the leaf of results residual crop after cereal.

" sucrose utilizes gene " is when expressing, to help cell can utilize the gene of sucrose as energy derive.This paper utilizes the protein of genes encoding to be called as " sucrose utilizes enzyme " by sucrose, and comprises sucrose transporter, invertase and hexokinase (as glucokinase and fructokinase).

II. cultivate

The present invention relates generally to microorganisms (for example micro-algae, oleaginous yeast, fungi and bacterium), and micro-algae algae strain of especially recombinating comprises that the strain of former Trentepohlia algae is to produce lipid.For easy-to-read, this part is divided into several small portions again.The 1st small portion has been described former Trentepohlia species and algae strain and how by genomic dna, relatively have been identified novel former Trentepohlia species and algae strain and relevant micro-algae and other microorganism.The 2nd small portion has been described the bio-reactor that is applicable to be cultivated.The 3rd small portion has been described the substratum for cultivating.The 4th small portion has been described according to illustrative cultivating method production oils of the present invention.These are described content and also generally are applicable to other microorganism.

1. former Trentepohlia species and algae strain and other micro-lifething

Former algae is the noticeable microorganism for the production of lipid, and this is because it can produce high-caliber lipid, particularly is applicable to produce the lipid of fuel.With the lipid produced by other micro-algae, compare, the lipid produced by former algae has the hydrocarbon chain that chain length is shorter and saturation ratio is higher.In addition, former algae lipid is generally containing pigment (level of chlorophyll and some carotenoid is hanged down and can not be detected), and under any circumstance, and contained pigment is recently from the lipid much less of other micro-algae.In addition, with respect to from other microorganisms producing lipid, by the former frustule of restructuring provided by the invention, can be used to higher yields and efficiency and the cost production lipid to reduce.For the former Trentepohlia algae of the illustrative strain of the inventive method, comprise in addition, this micro-algae grows in the heterotrophism mode and can pass through genetically engineered one-tenth Prototheca wickerhamii, the stagnant former algae of harmony (comprising UTEX 327), Peurto Rican former algae, the former algae of mulberry fruit shape (comprising UTEX algae strain 1441,1435) and the former algae of Rao Shi.The species of former Trentepohlia are obligate heterotrophs.

Can identify the former Trentepohlia species for the present invention by some target area of amplification gene group.For instance, can be via using primer and using the method (such as using Wu etc., the method for describing in Bot.Bull.Acad.Sin. (2001) 42:115-121) in any zone of genome increased and check order to identify specific former Trentepohlia species or algae strain core and/or chloroplast DNA.Identify the strain isolated of Chlorella with ribosomal dna sequence.Those skilled in the art can use generally acknowledged phylogenetic analyse method, as rrna the Internal Transcribed Spacer (ITS1 and ITS2rDNA), 23S rRNA, 18S rRNA and other conservative genome area are increased and are checked order, thereby not only can identify the species of former Trentepohlia, can also identify that other hydrocarbon and lipid with similar lipid kenel and throughput produce organism.About the example of the method algae being identified and classify also referring to for example Genetics, in August, 2005; 170 (4): 1601-10 and RNA, in April, 2005; 11 (4): 361-4.

Therefore, can utilize genomic dna relatively to identify the suitable micro-algae species for the present invention.Can increase from micro-algae species genomic dna zone (such as, but not limited to the DNA of coding 23S rRNA) conservative, and compare with consensus sequence, with screening and preferred micro-algae for the present invention relevant micro-algae species on taxonomy.The described DNA sequence dna examples show relatively of carrying out for the species in former Trentepohlia below.Micro-algae species that genomic dna relatively can also be identified for the identification of algae strain preservation center mistake.Algae strain preservation center is usually based on phenotypic characteristic and the micro-algae species of identification by morphological characters.Use these features may cause micro-algae species or micro-Trentepohlia are carried out to mis-classification.Use genomic dna relatively to be based on the better method that the phylogenetics relation is classified to micro-algae species.

For micro-algae of the present invention usually have coding 23S rRNA and with SEQ ID NO:11-19 in listed at least one sequence there is the conforming genomic dna sequence of at least 99%, at least 95%, at least 90% or at least 85% Nucleotide.

Relatively measure Nucleotide or amino acid consistence per-cent for carrying out sequence, a common sequence, as canonical sequence, compares cycle tests with it.When using sequence comparison algorithm, by cycle tests and canonical sequence input computer, specify in case of necessity the subsequence coordinate, and the program parameter of specified sequence algorithm.The sequence comparison algorithm then program parameter based on appointment calculates the sequence identity per-cent of cycle tests with respect to canonical sequence.

Can for example pass through local homology's algorithm (Smith and Waterman, Adv.Appl.Math.2:482 (1981)), sequence analysis algorithm (Needleman and Wunsch, J.Mol.Biol.48:443 (1970)), similarity searching method (Pearson and Lipman, Proc.Nat ' l.Acad.Sci.USA 85:2444 (1988)), these algorithms of computer realization (WisconsinGenetics software package, Genetics Computer Group, 575 Science Dr., Madison, GAP in WI, BESTFIT, FASTA and TFASTA) or by visual inspection (generally referring to (the same) such as Ausubel), sequence is carried out to the best comparison to compare.

The another kind of example algorithm that is applicable to measure sequence identity per-cent and sequence similarity per-cent is the BLAST algorithm, is described in Altschul etc., in J.Mol.Biol.215:403-410 (1990).For the software that carries out the BLAST analysis, can obtain via American National biotechnology information center (National Center for Biotechnology Information) (network address is www.ncbi.nlm.nih.gov) is open.This algorithm comprises that at first being tested and appraised short word that in search sequence, length is W identifies that high sub-sequence is to (HSP), described short word with database sequence in there is equal length word coupling or meet certain on the occasion of facing limit mark T while comparing.T is called as adjacent words mark threshold value (Altschul etc. (the same)).These initial adjacent words are hit as seed and are started search, the longer HSP that contains them with searching.Then described word hits and extends on both direction along each sequence, until can increase accumulation comparison mark.For nucleotide sequence, operation parameter M (the award mark of a pair of coupling residue; All the time>0) and the N (point penalty of mispairing residue; All the time<0) calculate running summary of the points scored.For aminoacid sequence, use score matrix computations running summary of the points scored.On all directions, word hits stops while extending in following situations: the maximum value that accumulation comparison mark reaches with respect to it has reduced amount X; Due to the accumulation of one or more residues comparison negative values make running summary of the points scored be down to 0 or below; Or arrive the end of arbitrary sequence.For whether within the scope of the invention identifying nucleic acid or polypeptide, the parameter preset of blast program is suitable.The preset value that BLASTN program (for nucleotide sequence) is used is that word length (W) is 11, and expected value (E) is 10, M=5, N=-4 and two chains are compared.For aminoacid sequence, the preset value that the BLASTP program is used is that word length (W) is 3, and expected value (E) is 10 and BLOSUM62 score matrix.The TBLATN program is (for nucleotide sequence, the use protein sequence) preset value used is that word length (W) is 3, expected value (E) is 10 and BLOSUM 62 score matrixes (referring to Henikoff and Henikoff, Proc.Natl.Acad.Sci.USA 89:10915 (1989)).

Except sequence of calculation consistence per-cent, the BLAST algorithm also carries out statistical study (referring to for example Karlin and Altschul, Proc.Nat ' l.Acad.Sci.USA 90:5873-5787 (1993)) to the similarity between two sequences.A kind of similarity measurement provided by the BLAST algorithm is minimum probability summation (P (N)), indicates the probability that accidentally has coupling between two Nucleotide or aminoacid sequence.For instance, if will test nucleic acid minimum probability summation with reference to the nucleic acid comparison time, be less than approximately 0.1, more preferably be less than approximately 0.01, and most preferably be less than approximately 0.001, so described nucleic acid is considered to similar to canonical sequence.

Except producing suitable lipid or hydrocarbon with production oils, fuel and grease chemical article, other Consideration that impact is selected the microorganism for the present invention also comprises: (1) lipid content high (accounting for the per-cent of cell weight); (2) be easy to growth; (3) be easy to carry out genetically engineered; And (4) are easy to biomass are processed.In specific embodiments, wild-type or have at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65% or at least 70% or the cell of more lipid through genetically engineered microorganisms.Preferred organism is with heterotrophism mode grow (utilizing sugar to grow under the lucifuge condition).

The example that can be used for carrying out algae of the present invention includes but not limited to following algae listed in table 1.

The example of table 1. algae.

The example that can be used for carrying out oleaginous yeast of the present invention includes but not limited to following oleaginous yeast listed in table 26.

The example of table 26. oleaginous yeast.

Crooked Cryptococcus (Cryptococcus curvatus), Lu Sheng Cryptococcus (Cryptococcusterricolus), mycocandida (Candida sp.), Si Shi saccharomyces oleaginosus (Lipomyces starkeyi), produce oil saccharomyces oleaginosus (Lipomyces lipofer), produce fat endomycopsi.sp (Endomycopsis vernalis), rhodotorula glutinis (Rhodotorula glutinis), Rhodotorula gracilis (Rhodotorula gracilis) and Yarrowia lipolytica (Yarrowia lipolytica)

The example that can be used for carrying out other fungi of the present invention includes but not limited to following fungi listed in table 27.

The example of table 27. fungi.

Genus mortierella (Mortierella), Portugal's wine and women-sensual pursuits mortierella (Mortierrla vinacea), Mortierella alpina (Mortierella alpine), pythium debaryanum (Pythium debaryanum), volume branch Mucor (Mucorcircinelloides), palm fibre aspergillus (Aspergillus ochraceus), terreus (Aspergillus terreus), thin mould (Pennicillium iilacinum), Hansenula (Hensenulo), Chaetomium (Chaetomium), Blastocladia (Cladosporium), Malbranchea (Malbranchea), Rhizopus (Rhizopus) and pythium (Pythium)

In some embodiments of the present invention, microorganism is bacterium.The example of in bacterium (as intestinal bacteria (E.coli)), expressing allogenic gene is known; Referring to for example MolecularCloning:A Laboratory Manual, Sambrook etc. (the 3rd edition, 2001, Cold SpringHarbor Press).

2. bio-reactor

For example, purpose to realize carrying out genetic manipulation and to produce hydrocarbon (lipid, lipid acid, aldehyde, alcohol and alkane) of culturing micro-organisms.The cultivation of last type is to carry out on a small scale and under the condition that at least can grow in initial microorganism at first.Take produce cultivation that hydrocarbon is purpose usually extensive in bio-reactor (for example 10,000L, 40,000L, 100,000L or larger bio-reactor) carry out.Usually in bio-reactor, in liquid nutrient medium, micro-algae (comprising former Trentepohlia species) is cultivated in the method for the invention.Bio-reactor does not allow light to enter usually.

Cultivate the oleaginous microorganism cell with bio-reactor or fermentor tank, preferably cultivate microalgae cell, experience the stages of their physiological period.Bio-reactor provides a lot of advantages with for heterotrophic growth and propagation method.In order to produce the biomass for food, preferably in liquid culture, (such as in suspension culture) makes micro-algae bulk fermentation.Bio-reactor (as the steel fermentor tank) can hold very large culture volume (using 40,000 liters and more jumbo bio-reactor in various embodiments of the present invention).Bio-reactor also allows to control culture condition usually, as temperature, pH value, oxygen are pressed and carbon dioxide level.For instance, bio-reactor is normally configurable, for example uses the port be connected with pipeline, to allow gaseous fraction (as oxygen or nitrogen) bubbling, passes through liquid culture.Utilize bio-reactor more easily to be controlled other culture parameters (as the pH value of substratum, identity and concentration and other medium component of trace element).

Bio-reactor can be through configuration so that substratum copy during increasing with number and flow through bio-reactor in micro-algae.In some embodiments, for example can be after inoculation but before cell reaches desired density, substratum is injected to bio-reactor.In other cases, when cultivating beginning, bio-reactor is filled with substratum, and the substratum that do not reinject after the inoculation culture thing.In other words, cultivate micro-algal biomass for some time in aqueous culture medium, during micro-algae copy and number increases; Yet, whole, do not have a large amount of aqueous culture mediums to flow through bio-reactor in during this period of time.Therefore in some embodiments, after inoculation, do not have aqueous culture medium to flow through bio-reactor.

Can use be equipped with as rotating knife and revolve oar, head motion, stirring rod, the bio-reactor of the devices such as parts that inject for gas under pressure mixed micro-algae culture.Mixing can be successional or intermittent.For instance, in some embodiments, do not maintain gas and enter the turbulent state that enters with substratum so that micro-algae is copied, until realize that the required number of described micro-algae only increases to.

Can use the bio-reactor port that gas, solid, semisolid and liquid are introduced or extracted in the bio-reactor chamber that holds micro-algae.Surpass a port (for example a port enters for substratum, and another port is for sampling) although a lot of bio-reactors have, there is no need to allow a port only for a kind of material, enter or discharge.For instance, port can for make substratum flow into bio-reactor and subsequently for sampling, gas enter, gas is discharged or other purpose.Preferably can be in the situation that do not change or the aseptic properties that endangers culture is reused thief hole.Thief hole can have valve through configuration or allows sample to stop and starting flowing or other devices of serial sampling parts is provided.Bio-reactor has at least one port that allows the inoculation culture thing usually, and described port can also be for other purpose, as substratum or gas enter.

The bio-reactor port allows the gas content of micro-algae culture is controlled.For instance, a part of volume of bio-reactor can be gas and on-liquid, and the gas inlet of bio-reactor allows gas is pumped in bio-reactor.The gas that can advantageously be pumped in bio-reactor comprises air, air/CO ₂mixture, inert gas (as argon gas) and other gas.Bio-reactor is usually through equipping so that the user can control the speed that gas enters bio-reactor.The gas flow that can enter in bio-reactor by increase as mentioned above, promotes culture to mix.

The gas flow increase also can affect the turbidity of culture.Can be by settle an inlet mouth below the aqueous culture medium liquid level so that the gas sparging that enters bio-reactor to the culture surface, thereby realize turbulent flow.One or more air outlets make the gas loss, thereby prevent acute build up of pressure in bio-reactor.Air outlet is preferably led to and is prevented that the contaminative microorganism from entering " unidirectional " valve in bio-reactor.

3. substratum

Micro-algae culture medium usually containing just like the fixed nitrogen source, fixedly carbon source, trace element, optionally for the damping fluid that maintains the pH value and the component of phosphoric acid class material (usually providing with phos-phate forms).Other component can comprise salt (as sodium-chlor), especially for the micro-algae of seawater.Nitrogenous source comprises organic and inorganic nitrogen-sourced, comprises that (pure ammonia or salt form, as (NH such as but not limited to dinitrogen, nitrose material, nitrate, ammonia ₄) ₂sO ₄and NH ₄oH), protein, soyflour, corn impregnation liquid and yeast extract.The example of trace element comprises zinc, boron, cobalt, copper, manganese and molybdenum, for example is respectively ZnCl ₂, H ₃bO ₃, CoCl ₂6H ₂o, CuCl ₂2H ₂o, MnCl ₂4H ₂o and (NH ₄) ₆mo ₇o ₂₄4H ₂the form of O.

The microorganism that the method according to this invention is used is present in each place, the whole world and environment.Due to them and the separating and evolutionary divergence that their occur of other species, so be difficult to the particular growth medium of prediction for optimum growh being provided and producing lipid and/or hydrocarbon composition.In some cases, the certain micro-organisms strain may not grow in specific growth medium, and this is because have certain inhibition component or do not have needed certain the basic nutritional needs of described specified microorganisms strain.

Solid and liquid growth medium generally can obtain from multiple source, and preparation method's the explanation that is applicable to the defined medium of multiple-microorganism strain can for example see http://www.utex.org/ online (by the University of Texas (University ofTexas) of Austin (Austin), 1 University Station A6700, Austin, Texas, the website that 78712-0183 maintains for its algal cultures preservation center (UTEX)) on.For instance, various fresh water and salt water culture medium comprise the substratum be described in PCT publication No. 2008/151149, and described announcement is incorporated to this paper by reference.

In a specific embodiment, the proteose substratum is applicable to sterile culture, and can be by 1g proteose peptone being joined to the substratum for preparing the 1L volume in 1 liter of Bu Shi substratum (Bristol Medium) (pH approximately 6.8).The Bu Shi substratum comprises 2.94mM NaNO in the aqueous solution ₃, 0.17mM CaCl ₂2H ₂o, 0.3mM MgSO ₄7H ₂o, 0.43mM, 1.29mM KH ₂pO ₄and 1.43mM NaCl.Nutrient agar for 1.5%, can join 15g agar in 1L solution.Solution covered and carry out autoclaving, then being stored under refrigerating temperature before use.Another example is former algae isolation medium (PIM), it comprises 10g/L Potassium Hydrogen Phthalate (KHP), 0.9g/L sodium hydroxide, 0.1g/L sal epsom, 0.2g/L potassium hydrogen phosphate, 0.3g/L ammonium chloride, 10g/L glucose, 0.001g/L vitamin, 20g/L agar, 0.25g/L 5-flurocytosine, pH value scope is 5.0 to 5.2 (referring to Pore, 1973, App.Microbiology, 26:648-649).Can easily identify other substratum that is applicable to the inventive method by the consulting URL that above indicate or by other tissue (as SAG, CCAP or CCALA) that consulting maintains microorganisms cultures.SAG refers to (the University of of brother's Dettingen university

) (

germany) algal cultures preservation center, CCAP refers to the (Scotland by Scotland ocean science association (ScottishAssociation for Marine Science), United Kingdom) management algae and protozoon culture collection center, and CCALA refer to Institute of Botany (Institute of Botany) (

czech Republic) algal cultures preservation laboratory.In addition, United States Patent (USP) the 5th, described the substratum preparation and the condition that are suitable for former Trentepohlia species heterotrophic fermentation for 900, No. 370.

For oils production, select that fixedly carbon source is very important, this is because fixedly the cost of carbon source is necessary enough low and can low cost production oils.Therefore, when suitable carbon source for example comprises acetic ester, floridoside (floridoside), fructose, semi-lactosi, glucuronic acid, glucose, glycerine, lactose, seminose, 2-Acetamido-2-deoxy-D-glucose, rhamnosyl, sucrose and/or wood sugar, selecting the raw material that contains these compounds is an importance of the inventive method.The suitable raw material used according to the inventive method comprises cellulosic material, whey, molasses, potato, Chinese sorghum, sucrose, beet, sugarcane, rice and the wheat of for example black liquor, W-Gum, process depolymerization.Carbon source can also form of mixtures provide, as the mixture of sucrose with the beet pulp of process depolymerization.One or more carbon sources can be at least about 50 μ M, at least about 100 μ M, at least about 500 μ M, at least about 5mM, at least about 50mM and at least about one or more exogenous fixedly carbon source forms that provide of 500mM concentration, provide.Relevant especially carbon source comprises Mierocrystalline cellulose (being the depolymerization form), glycerine, sucrose and Chinese sorghum for purposes of the present invention, is discussed in hereinafter in more detail separately.

According to the present invention, can utilize the cellulose biomass through depolymerization to carry out culturing micro-organisms as raw material.Cellulose biomass (for example straw, as corn stalk) is cheap and is easy to obtain; Yet, attempt to use this material to end in failure as the raw material for yeast.Specifically, have been found that described raw material can suppress yeast growth, and yeast can not utilize the 5-carbon sugar that produced by the cellulosic material wood sugar of hemicellulose (for example from).On the contrary, micro-algae can rely on the cellulosic material growth through processing.Cellulosic material generally comprises the hemicellulose of the Mierocrystalline cellulose of about 40%-60%, about 20%-40% and the xylogen of 10%-30%.

Suitable cellulosic material comprises the resistates that comes from draft and woody energy crop, and farm crop (not taking from the field of Major Foods or fiber product), and plant part, be mainly stem and leaf.Example comprises agricultural waste, as bagasse, rice husk, zein fiber (comprising stem, leaf, shell and rod), Wheat Straw, straw, beet pulp, citrus pulp, orange peel; Forestry waste, as hardwood and cork thinnings, and the hardwood and the cork resistates that from timber, operate; Timber waste, as sawmill's waste (wood shavings, sawdust) and pulp mill's refuse; Municipal waste, as papery part, city timber waste and the City Green refuse (as cut grass in city) of municipal solid waste; And wooden construction refuse.Other cellulosic material comprises special Mierocrystalline cellulose crop, as switchgrass, hybridization aspen and awns genus, fiber sugarcane and fiber Chinese sorghum.The five-carbon sugar produced by these materials comprises wood sugar.

Cellulosic material is processed to improve the efficiency that microorganism utilizes sugar contained in these materials.The invention provides for after sour explosion, cellulosic material being processed, for example, so that described material is applicable to the novel method that microorganism (micro-algae and oleaginous yeast) is carried out to the heterotrophism cultivation.Wood fiber biomass as described above comprises various components, comprises Mierocrystalline cellulose, the crystalline polymer of the glucose (a kind of hexose) that β-Isosorbide-5-Nitrae connects; Hemicellulose, more loosely connected polymkeric substance, mainly comprise wood sugar (a kind of five-carbon sugar) and comprise a small amount of seminose, semi-lactosi, pectinose; Xylogen, a kind of aromatic polymer of complexity, comprise sinapyl alcohol and its derivative and pectin (straight chain of the polygalacturonic acid that α-Isosorbide-5-Nitrae is connected).Because Mierocrystalline cellulose and hemicellulose have paradigmatic structure, for example, so being, the sugar (monomer glucose and xylose) in the middle of their can not efficiently be utilized by a lot of microorganisms the form of (metabolism).For these microorganisms, cellulose biomass is carried out to further processing and to produce the monomer sugar that forms polymkeric substance, can contribute to very much to guarantee that cellulosic material is used as raw material (carbon source) efficiently.

The process that Mierocrystalline cellulose or cellulose biomass is called to " explosion " is wherein processed biomass with dilute sulphuric acid (or other acid) under high temperature and high pressure.This process adjusts biomass so that Mierocrystalline cellulose wherein and hemicellulose component can be become the glucose and xylose monomer by enzymically hydrolyse efficiently.Resulting monomer sugar is called as cellulose sugar.Cellulose sugar can be utilized by microorganism subsequently, produces multiple metabolite (for example lipid).Acid explosion step makes the hemicellulose component partly be hydrolyzed into constitutive character monose.These sugar can be in the situation that further process and discharge from biomass fully.In some embodiments, further processing is hydrothermal process, comprises with hot water the material through explosion is washed, and removes pollutent (as salt).Cellulose alcoholic fermentation does not need this step, and this is because use rarer sugared concentration in described method.In other embodiments, further processing is other acid treatment.In other embodiment again, further processing is that material to through explosion carries out enzymically hydrolyse.These are processed and can also any array configuration use.The type of processing can affect the type (for example five-carbon sugar is compared hexose) of discharged sugar and their d/d stages during the course.Therefore, can produce is mainly the different sugar stream of five-carbon sugar or hexose.These therefore can be for the specified microorganisms that has different carbon and utilize ability through five-carbon sugars of enrichments or hexose stream.

Method of the present invention generally includes fermentation to produce the cell density higher than the cell density reached in ethanol fermentation.Because the density of the culture of producing for heterotrophism Mierocrystalline cellulose oils is higher, for example, so fixedly carbon source (sugar of cellulose-derived stream) preferably is conc forms.Glucose level before incubation step in the process cellulosic material of depolymerization is at least 300 grams per liters, at least 400 grams per liters, at least 500 grams per liters or at least 600 grams per liters preferably, described incubation step is optionally that fed-batch type is cultivated, in wherein at Growth of Cells and while gathering lipid, passing in time material being delivered to cell.Do not use the cellulose sugar stream that equals or approach this concentration range in production of cellulosic ethanol.Therefore, in order to produce during producing wood fibre oils and to continue very high cell density, the carbon raw material must be delivered in the heterotrophism culture with the height conc forms.Yet, not the substrate of oleaginous microorganism in incoming flow or can not can be gathered in bio-reactor by any component of oleaginous microorganism metabolism, maybe can suppress required final product and produce if described component has toxicity, will cause problem so.And in ethanol fermentation, the derivative by product of xylogen and xylogen, carbohydrate-derived by product (as furfural and hydroxymethylfurfural) and stem from cellulosic material produce the salt of (in the explosion process and in follow-up N-process) and even not pentose/the hexose of metabolism all can cause problem, these affect in the meeting method that the concentration in initial feed is higher at these materials and are significantly enlarged.For the hexose that makes to can be used for the wood fibre oils described in scale operation the present invention reaches the sugared concentration in 300g/L scope (or higher), the concentration of these toxicants can be 20 times of common existing concentration in the ethanol fermentation of cellulose biomass.

Cellulosic material is carried out to the decrepitation method processing and can utilize a large amount of sulfuric acid, heat and pressure, thus the by product of release carbohydrate, i.e. furfural and hydroxymethylfurfural.Furfural and hydroxymethylfurfural during hydrolysis of hemicellulose via making wood sugar be dehydrated into furfural and water and produce.In some embodiments of the present invention, before will introducing bio-reactor through the lignocellulosic substance of saccharification, for example, from wherein removing these by products (furfural and hydroxymethylfurfural).The method of in certain embodiments of the invention, removing the by product of carbohydrate is that the cellulosic material through explosion is carried out to hydrothermal process.In addition, the invention provides the method for with tolerating, producing wood fibre oils as the algae strain of the compound of furfural or hydroxymethylfurfural.In another embodiment, the present invention also provides the furfural in not only can the tolerate fermentable substratum, but also in fact can metabolism in method and the microorganism of these by products of wood fibre oils production period.

The explosion process also produces the salt of significance level.For instance, when making the water with 10: 1 through the cellulose biomass of explosion: when solids ratio (dry weight) is resuspended, for the representative condition of explosion, can produce the specific conductivity over 5mS/cm.In certain embodiments of the invention, to what diluted, through the biomass of explosion, carry out the enzymatic saccharification, and by the supernatant liquor that obtains nearly 25 times concentrated with for bio-reactor.High (up to 1.5M Na unexpectedly through the salt level in concentrated sugar stream (as measured by specific conductivity) ⁺equivalent).When being neutralized to carry out follow-up enzymatic method for saccharifying, the material to through explosion can produce again salt equally.The invention provides and remove these salt so that the concentrated cellulose sugar stream of the process of gained can be used to produce the method in the heterotrophism method of wood fibre oils.The method of in some embodiments, removing these salt is to carry out deionization with resin (such as, but not limited to DOWEX Marathon MR3).In certain embodiments, use the step of resin deionization before biomass being carried out to hydrothermal process or aforesaid any combination at concentrated sugar or before regulating pH value and saccharification; In other embodiments, carry out described step after one or more in these processes.In other embodiments, the explosion process itself changes, to avoid producing high-caliber salt unexpectedly.The suitable replacement scheme of for instance, cellulose biomass being carried out to sulfuric acid (or other acid) explosion is to make cellulose biomass can carry out the machinery pulping of enzymically hydrolyse (saccharification).In other embodiment again, use can be resisted the genetically engineered algae strain of process that the indigenous microorganisms strain of high-level salt maybe can be resisted high-level salt.

For the preparation of utilizing oleaginous microorganism to carry out a preferred embodiment of the method for the cellulose biomass through explosion that heterotrophism wood fibre oils produces.First step comprises the pH value of the resuspended cellulose biomass through explosion is adjusted in the 5.0-5.3 scope, and the washing the fibre cellulosic biomass is three times subsequently.Can complete this washing step by multiple means, described means comprise to be utilized desalination resin and ion exchange resin, reverse osmosis, hydrothermal process (as described above) or only repeats resuspended and centrifugal in deionized water.This washing step produces the cellulose flow of specific conductivity between 100 μ S/cm-300 μ S/cm, and removes a large amount of furfurals and hydroxymethylfurfural.Can retain the decant thing from this washing step, be concentrated with the five-carbon sugar to discharging from the hemicellulose component.Second step comprises that the cellulose biomass to the process washing carries out the enzymatic saccharification.In a preferred embodiment, use Accellerase (Genencor).Third step comprises by centrifugal or decant and to the biomass through saccharification and is rinsed to reclaim sugar.Resulting biomass (solid) are the components that high-energy is rich in xylogen, can be used as fuel or abandon.Be collected in the sugar stream be recovered in centrifugal/decant and flushing process.The 4th step comprises carries out microfiltration, to remove pollution solid and to reclaim penetrant.The 5th step comprises enrichment step, and described step can utilize vacuum-evaporator to complete.This step optionally can comprise and add defoamer, and such as P ' 2000 (Sigma/Fluka), this contains protein in glycogen material because of gained sometimes is essential.

In another embodiment of the inventive method, carbon source is glycerine, comprises by biofuel and carries out the acidified of transesterification generation and without superacidulated glycerin by-products.In one embodiment, carbon source comprises glycerine and at least one other carbon source.In some cases, when fermentation starts by all glycerine and at least one other fixedly carbon source offer microorganism.In some cases, by glycerine and at least one other fixedly carbon source offer microorganism with estimated rate simultaneously.In some cases, during the fermentation by glycerine and at least one other fixedly carbon source with estimated rate, deliver in microorganism.

Certain slightly algae carry out fissional speed faster than the speed (referring to PCT publication No. 2008/151149) under existing at glucose under glycerine exists.In these cases, two growth period processes (wherein at first glycerine is delivered to cell so that cell density increases fast, then send into glucose to gather lipid) can improve the efficiency of producing lipid.The glycerin by-products of utilizing the transesterification process make its get back to production process in the time significant economic advantages can be provided.Also provide other feed process, such as the mixture of glycerine and glucose.Present described mixture and also there is identical economic benefits.In addition, the invention provides and present the method to micro-algae by substituting sugar (as sucrose) with various array configurations together with glycerine.

In another embodiment of the inventive method, carbon source is Nulomoline.Nulomoline is by making sucrose decomposition become its monosaccharide component (fructose and glucose) to produce.Can produce Nulomoline via several different methods as known in the art.A kind of described method is the heating aqueous sucrose solution.Often with catalyzer, accelerate the conversion of sucrose to Nulomoline.These catalyzer can be biological catalysts, and enzyme for example, such as saccharase and sucrase being added in sucrose to the hydrolysis reaction that accelerates to produce Nulomoline.Acid is an example of non-biological catalyst, and it can accelerate hydrolysis reaction when coordinating with heat.After making Nulomoline, the crystallization proneness of described Nulomoline is less than sucrose, and therefore for storage and fed-batch type fermentation, provide advantage, in the situation that need concentrated carbon source in heterotrophism microorganisms (comprising micro-algae) in the fed-batch type fermentation.In one embodiment, carbon source is Nulomoline, preferably in incubation step (being optionally that fed-batch type is cultivated), is before concentrated form, preferably at least 800 grams per liters, at least 900 grams per liters, at least 1000 grams per liters or at least 1100 grams per liters.During the Nulomoline of passing in time the form that will preferably be concentrated at Growth of Cells and while gathering lipid is delivered to cell.

In another embodiment of the inventive method, carbon source is sucrose, comprises the compound material that contains sucrose, the dense sugar cane juice produced such as sugarcane processing.Because the density of the culture of producing for heterotrophism oils is higher, so fixedly carbon source (such as sucrose, glucose etc.) preferably was concentrated form before incubation step, the fixedly carbon source of at least 500 grams per liters, at least 600 grams per liters, at least 700 grams per liters or at least 800 grams per liters preferably, described incubation step is optionally that fed-batch type is cultivated, in wherein at Growth of Cells and while gathering lipid, passing in time described material being delivered to cell.In some cases, carbon source is sucrose, described sucrose is dense sugar cane juice form, preferably before incubation step, be concentrated form, preferably containing at least 60% solid or approximately 770 grams per liters sugar, at least 70% solid or approximately 925 grams per liter sugar, or at least 80% solid or about 1125 grams per liter sugar, described incubation step is optionally that fed-batch type is cultivated.In passing in time at Growth of Cells and while gathering lipid the dense sugar cane juice concentrated being delivered to cell.

In one embodiment, substratum further comprises that at least one sucrose utilizes enzyme.In some cases, substratum comprises invertase.In one embodiment, invertase is the invertase that can secrete, and it is by exogenous invertase gene encode (being expressed by microbial population).Therefore, in some cases, as hereinafter be described in more detail in the IV part, micro-algae utilizes enzyme through genetically engineered to express sucrose, such as sucrose transporter, invertase, hexokinase, glucokinase or fructokinase.

The compound material that contains sucrose comprises the waste molasses that sugarcane processing produces; Utilize this low price waste prods of sugarcane processing can significantly save hydrocarbon and other oils production cost.The compound material that contains sucrose for the another kind of the inventive method is Chinese sorghum, comprises sorghum molasses and pure Chinese sorghum.Sorghum molasses is produced by the juice of sweet sorghum.Its sugared kenel mainly is comprised of glucose (dextrose), fructose and sucrose.

4. oils is produced

For the method according to this invention production oils, preferred culturing cell in the dark, as for example when being used the fermentor tank of very big (40,000 liters and higher) that do not allow the rayed culture.Former Trentepohlia species in containing the substratum of fixing carbon source and in the lucifuge situation Growth and reproduction with production oils; Described growth is called as heterotrophic growth.

For instance, the inoculum that lipid is produced to oleaginous microorganism cell (preferably microalgae cell) is introduced in substratum; Cell starts to have lag phase (lag phase) before breeding.After lag phase, proliferative speed steadily increases and enters logarithmic phase or exponential phase of growth.The exponential growth after date, because nutrient substance (as nitrogen) reduces, toxicant increases and quorum sensing mechanism slows down breeding.After this slows down, breeding stops, and depends on that the specific environment provided to cell, cell enter stationary phase or steady growth conditions.In order to obtain the biomass that are rich in lipid, usually collect culture after finishing exponential phase of growth, nutrient substance (except carbon) that can be by making nitrogen or another kind of key thus depletedly force cell that the carbon source of excessive existence is changed into to lipid to make exponential phase of growth than early stopping.Can control the culture condition parameter, so that the combination of overall oils production, the lipid matter that produces and/or the production of specific oils reach best.

As described above, use bio-reactor or fermentor tank so that cell enters the stages of its growth cycle.For instance, the celliferous inoculum of lipid can be introduced in substratum, be entered lag phase subsequently (lag phase), cell starts growth afterwards.After lag phase, growth velocity steadily increases and enters logarithmic phase or exponential phase of growth.The exponential growth after date, because nutrient substance reduces and/or toxicant increases and makes decreased growth.After this slows down, growth stops, and the specific environment provided to cell is provided, cell enters stationary phase or steady state.During the lipid production of cell disclosed herein can betide logarithmic phase or afterwards, comprise stationary phase, provide in stationary phase or still can obtain nutrient substance so that cell can continue to produce lipid in nondividing situation.

Preferably, the microorganism of using condition described herein and known in the art to cultivate comprises the lipid at least about 20 % by weight, preferably at least about 40 % by weight, and more preferably at least about 50 % by weight, and most preferably at least about the lipid of 60 % by weight.Processing condition can be through adjusting productive rate and/or the Decrease production cost that is applicable to the lipid of specific end use with increase.For instance, in certain embodiments, under one or more nutrient substances (as nitrogen, phosphorus or sulphur) of restricted concentration exist, cultivate micro-algae, excessive fixed carbon energy (as glucose) is provided simultaneously.With the lipid productive rate of microorganism in the culture of excess nitrogen is provided, compare, restriction nitrogen tends to make the lipid gain in yield of microorganism.In specific embodiments, the lipid gain in yield at least about: 10%, 50%, 100%, 200% or 500%.Can be in the part of total incubation period or whole incubation period under the nutrient substance of limited volume exists culturing micro-organisms.In specific embodiments, during total incubation period, the concentration of nutrient substance is circulated at least 2 times between restricted concentration and non-limiting concentration.Can provide excessive carbon by continuing in the time extending to cultivate, but the lipid content that limits nitrogen or do not provide nitrogen to make cell increases simultaneously.

In another embodiment, for example, for example, make the lipid gain in yield by under one or more cofactors existence of lipid pathway enzyme (fatty acid synthetase), cultivating lipid generation microorganism (micro-algae).In general, the concentration of cofactor is enough to make microorganism lipid (for example lipid acid) productive rate to be compared with the microorganism lipid productive rate in the situation that does not have cofactor to some extent increases.In specific embodiments, the microorganism (for example micro-algae) of the allogenic gene by will contain the cofactor of encoding is included in culture and provides cofactor to culture.Perhaps, can for example, by the microorganism (micro-algae) of including the allogenic gene that contains the synthetic protein of coding participation cofactor in, to culture, provide cofactor.In certain embodiments, suitable cofactor comprises any VITAMIN that the lipid pathway enzyme is required, as: vitamin H, pantothenate.Coding is applicable to the gene of the cofactor in the present invention or participates in the synthetic gene of these cofactors know, and can utilize construct and technology (as above-mentioned construct and technology) for example to be incorporated into, in microorganism (micro-algae).

The particular instance of bio-reactor as herein described, culture condition and heterotrophic growth and propagation method can be combined to improve the efficiency of microorganism growth and lipid and/or protein production in any suitable manner.

Micro-algal biomass of oils/lipid accumulation (with dry weight basis) of having utilized different cultural methods to produce to have high per-cent, described cultural method is (referring to PCT publication No. 2008/151149) known in the art.Comprise the micro-algae oils with dry weight basis at least 10% by cultural method generation as herein described and micro-algal biomass used according to the invention.In some embodiments, micro-algal biomass comprises the micro-algae oils with dry weight basis at least 25%, at least 50%, at least 55% or at least 60%.In some embodiments, micro-algal biomass contains the micro-algae oils with dry weight basis 10%-90%, micro-algae oils of 25%-75%, micro-algae oils of 40%-75% or micro-algae oils of 50%-70%.

Can comprise the glyceride with one or more different fatty acid ester side chains for micro-algae oils of the biomass as herein described of method and composition of the present invention or micro-algae oils of extracting from biomass.Glyceride comprises and one, the glycerol molecule of two or three fatty acid molecule generation esterifications, and described fatty acid molecule can have different length and have different saturation ratios.As following IV part is described in more detail, can with characteristic or the ratio of the fatty acid molecule in the micro-algae oils of the present invention, be regulated via culture condition or engineered length and the saturation ratio feature of controlling fatty acid molecule (with micro-algae oils) of lipid path.Therefore, can in single algae species, by biomass or the algae oils that will derive from two or more micro-algae species, be mixed in together, or, by algae oils of the present invention and the oils blend from other source are prepared to specific algae oils blend, described other source is such as soybean, Semen Brassicae campestris, Canada's rape, palm, palm-kernel, coconut, corn, useless plant, Chinese vegetable tallow, olive, Sunflower Receptacle, cottonseed, chicken fat, tallow, pig fat, micro-algae, macro, microorganism, calyx is apart from flower, flax, peanut, selected white animal grease, lard, flax shepherd's purse, Semen Brassicae Junceae, cashew nut, oat, lupine, mestha, mary bush, hemp, coffee berry, flaxseed (linseed oil), fibert, the root of Beijing euphorbia, Semen Cucurbitae, coriandrum, camellia, sesame, safflower, rice, tung tree, cocoa, copra, poppy flower, castor seeds, pecan, jojoba, Hawaii nut, Bertholletia excelsa, avocado, any cut in oil or aforementioned oils.

Can also combine to control oils composition, the i.e. characteristic of the fatty acid component of glyceride and ratio by biomass or the oils that will derive from least two kinds of different micro-algae species.In some embodiments, at least two kinds of different micro-algae species have different glyceride kenels.Can be as described herein, preferably under the heterotrophism condition, different micro-algae species are carried out to co-cultivation or single culture, to produce oils separately.The different microalgae species can contain the different fatty acid components of different weight percentage in the glyceride of cell.

In general, almost there is no or do not have chain length be the lipid acid of C8-C14 to the strain of former Trentepohlia algae.For instance, the former algae of mulberry fruit shape (UTEX 1435), the former algae of Krueger Buddhist nun (Protothecakrugani) (UTEX 329), the stagnant former algae of harmony (UTEX 1442) and the former algae of Rao Shi (UTEX1438), containing (or can not detection limit) C8 lipid acid, do not contain C10 lipid acid, the C12 lipid acid between 0.03%-2.1% and the C14 lipid acid between 1.0%-1.7% between 0%-0.01%.

In some cases, contain genetically modified former Trentepohlia algae strain that coding is the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C8 or C8-10 to chain length have at least 1%, at least 1.5%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 12% at least 15% or more chain length be the lipid acid of C8.In other cases, contain genetically modified former Trentepohlia algae strain that coding is the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C10 to chain length have at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 24% at least 25% or more chain length be the lipid acid of C10.In other cases, contain genetically modified former Trentepohlia algae strain that coding is the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C12 to chain length have at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 34%, at least 35% at least 40% or more chain length be the lipid acid of C12.In other cases, contain genetically modified former Trentepohlia algae strain that coding is the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C14 to chain length have at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 10%, at least 15%, at least 30%, at least 43% at least 45% or more chain length be the lipid acid of C14.

[0001] in non-limiting example; the genetically modified former Trentepohlia algae strain that to contain coding be the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C8 to chain length has between 1%-25%; or, between 1%-15%, preferably the chain length of 1.8%-12.29% is the lipid acid of C8.In other non-limiting example; the genetically modified former Trentepohlia algae strain that to contain coding be the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C10 to chain length has between 1%-50%; or, between 1%-25%, preferably the chain length of 1.91%-23.97% is the lipid acid of C10.In other non-limiting example; the genetically modified former Trentepohlia algae strain that to contain coding be the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C12 to chain length has between 5%-50%; or, between 10%-40%, preferably the chain length of 13.55%-34.01% is the lipid acid of C12.In other non-limiting example; the genetically modified former Trentepohlia algae strain that to contain coding be the fatty acyl group-activated fatty acyl group of ACP substrate tool-ACP thioesterase of C14 to chain length has between 1%-60%; or, between 2%-45%, preferably the chain length of 2.59%-43.27% is the lipid acid of C14.In other non-limiting example, contain genetically modified former Trentepohlia algae strain that coding has extensive specific fatty acyl group-ACP thioesterase to fatty acyl group with different carbon chain lengths-ACP substrate have nearly 30%, nearly 35% or preferably nearly 39.45% chain length be the lipid acid of C16.In some cases; the genetically modified former Trentepohlia algae strain that contains the coding activated fatty acyl group of the fatty acyl group between C8 and C14-ACP substrate tool-ACP thioesterase to chain length has between 1%-75%; or between 2%-60%, the medium chain of 2.69%-57.98% (C8-C14) lipid acid preferably.In some cases, the genetically modified former Trentepohlia algae strain that contains the coding activated fatty acyl group of the fatty acyl group between C12 and C14-ACP substrate tool-ACP thioesterase to chain length has at least 30%, at least 40% or at least 49% C12-C14 lipid acid.In some cases, the strain of the former Trentepohlia algae of transgenosis being remained under constant and higher selective pressure can be because of desired fats acid increase with certain chain lengths but favourable to retain allogenic gene.Can also make allogenic gene keep high level by utilizing homologous recombination vector disclosed herein and method allogenic gene to be inserted in the nuclear staining body of cell.Containing the reconstitution cell that is incorporated into the allogenic gene in the nuclear staining body is one object of the present invention.

[0002] micro-algae oils can also comprise by micro-algae, produced or mix other composition micro-algae oils from substratum.These other compositions can different amounts exist, and this depends on the culture condition for cultivating micro-algae, micro-algae species, the other factors for from biomass, reclaiming the extracting method of micro-algae oils and may affect micro-algae oils composition.The limiting examples of described composition comprises carotenoid, and amount is 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, preferably 0.05 microgram to 0.244 microgram/every gram oils; Chlorophyll A, amount is 0.01mcg/g-0.5mcg/g, 0.025mcg/g-0.3mcg/g, preferably 0.045 microgram to 0.268 microgram/every gram oils; Chlorophyll, measure as being less than 0.1mcg/g, being less than 0.05mcg/g, preferably is less than 0.025 microgram/every gram oils; Gamma-Tocopherol, amount is 1mcg/g-300mcg/g, 35mcg/g-175mcg/g, preferably 38.3 micrograms-164 microgram/every gram oils; Total tocopherol, amount is 10mcg/g-500mcg/g, 50mcg/g-300mcg/g, preferably 60.8 microgram to 261.7 micrograms/every gram oils; Be less than 1%, be less than 0.5%, preferably be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol; Be less than 400mcg/g, preferably be less than total tocotrienols of 300 micrograms/every gram oils; Or total tocotrienols, amount is 100mcg/g-500mcg/g, 225mcg/g-350mcg/g, preferably 249.6 microgram to 325.3 micrograms/every gram oils.

Other composition can include but not limited to phosphatide, tocopherol, tocotrienols, carotenoid (such as alpha-carotene, β-carotene, Lyeopene etc.), xanthophyll (for example xenthophylls, zeaxanthin, α-kryptoxanthin and beta-cryptoxanthin) and various organic or inorganic compound.In some cases, the oils of extracting from former Trentepohlia species comprises between 0.001mcg/g-0.01mcg/g, between 0.0025mcg/g-0.05mcg/g, preferably the xenthophylls of 0.003 microgram to 0.039 microgram/every gram oils; Be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the Lyeopene of 0.003 microgram/every gram oils; And be less than 0.01mcg/g, be less than 0.005mcg/g, preferably be less than the β-carotene of 0.003 microgram/every gram oils.

In some embodiments, the invention provides a kind of oleaginous microorganism cell that comprises triglyceride level oils, the choosing of the lipid acid kenel of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%, at least about 2%, at least about 5%, at least about 7%, at least about 10% or at least about 15%; C10:0 accounts at least about 1%, at least about 5%, at least about 15%, at least about 20%, at least about 25% or at least about 30%; C12:0 accounts at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80%; C14:0 accounts at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C16:0 accounts at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:0 accounts at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C18:1 accounts at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:2 accounts for and is less than approximately 7%, is less than approximately 5%, is less than approximately 3%, is less than approximately 1% or approximately 0%; And saturated fatty acid accounts at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%.

[0003] in some embodiments, the oleaginous microorganism cell comprises triglyceride level oils, and described triglyceride level oils comprises the freely lipid acid kenel of the following group formed of choosing: the combination total amount of C8:0 and C10:0 is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C10:0, C12:0 and C14:0 is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; And the combination total amount of C18:1 and C18:2 is less than approximately 30%, is less than approximately 25%, is less than approximately 20%, is less than approximately 15%, is less than approximately 10%, is less than approximately 5% or approximately 0%.

In some embodiments, the oleaginous microorganism cell comprises triglyceride level oils, and described triglyceride level oils has the lipid acid kenel of the fatty acid rate that comprises the group formed below choosing freely: the ratio of C8:0 and C10:0 is at least about 5: 1, at least 6: 1, at least 7: 1, at least 8: 1, at least 9: 1 or at least 10: 1; The ratio of C10:0 and C12:0 is at least about 6: 1, at least 7: 1, at least 8: 1, at least 9: 1 or at least 10: 1; The ratio of C12:0 and C14:0 is at least about 5: 1, at least 6: 1, at least 7: 1, at least 8: 1, at least 9: 1 or at least 10: 1; The ratio of C14:0 and C12:0 is at least 7: 1, at least 8: 1, at least 9: 1 or at least 10: 1; And the ratio of C14:0 and C16:0 is at least 1: 2, at least 1: 3, at least 1: 4, at least 1: 5, at least 1: 6, at least 1: 7, at least 1: 8, at least 1: 9 or at least 1: 10.

In some embodiments, the invention provides a kind of oleaginous microorganism triglyceride oil based composition, the choosing of the lipid acid kenel of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%, at least about 2%, at least about 5%, at least about 7%, at least about 10% or at least about 15%; C10:0 accounts at least about 1%, at least about 5%, at least about 15%, at least about 20%, at least about 25% or at least about 30%; C12:0 accounts at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80%; C14:0 accounts at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C16:0 accounts at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:0 accounts at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C18:1 accounts at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:2 accounts for and is less than approximately 7%, is less than approximately 5%, is less than approximately 3%, is less than approximately 1% or approximately 0%; And saturated fatty acid accounts at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%.

In some embodiments, oleaginous microorganism triglyceride oil based composition comprises triglyceride level oils, and described triglyceride level oils comprises following lipid acid kenel: the combination total amount of C10:0, C12:0 and C14:0 is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C8:0 and C10:0 is less than approximately 50%, be less than approximately 45%, be less than approximately 40%, be less than approximately 35%, be less than approximately 30%, be less than approximately 25%, be less than approximately 20%, be less than approximately 15%, be less than approximately 10%, be less than approximately 5% or approximately 0%.

In some embodiments, oleaginous microorganism triglyceride oil based composition comprises triglyceride level oils, and described triglyceride level oils has and comprises the freely lipid acid kenel of the fatty acid rate of the following group formed of choosing: the ratio of C8:0 and C10:0 be at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C10:0 and C12:0 be at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C12:0 and C14:0 be at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C14:0 and C12:0 be at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C14:0 and C16:0 be at least about 1: 2, at least about 1: 3, at least about 1: 4, at least about 1: 5, at least about 1: 6, at least about 1: 7, at least about 1: 8, at least about 1: 9 or at least about 1: 10.

In some embodiments, the invention provides a kind of method for preparing oleaginous microorganism triglyceride oil based composition, described composition have choosing freely the lipid acid kenel of the following group formed: C8:0 account at least about 1%, at least about 2%, at least about 5%, at least about 7%, at least about 10% or at least about 15%; C10:0 accounts at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25% or at least about 30%; C12:0 accounts at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80%; C14:0 accounts at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C16:0 accounts at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:0 accounts at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% or at least about 50%; C18:1 accounts at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%; C18:2 accounts for and is less than approximately 7%, is less than approximately 5%, is less than approximately 3%, is less than approximately 1% or approximately 0%; And saturated fatty acid accounts at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90%, wherein said method comprises the following steps: (a) in substratum, cultivate the oleaginous microorganism cell colony until the dry cell weight of described oleaginous microorganism cell at least 10% be triglyceride level oils; And (b) separation of glycerin three ester oil based compositions from the oleaginous microorganism cell.

In some embodiments, the method for preparing oleaginous microorganism triglyceride oil based composition produces the triglyceride level oils comprise following lipid acid kenel: the combination total amount of C10:0, C12:0 and C14:0 is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%, at least about 70%, at least about 80%, at least about 90% or approximately 100%; The combination total amount of C8:0 and C10:0 is less than approximately 50%, be less than approximately 45%, be less than approximately 40%, be less than approximately 35%, be less than approximately 30%, be less than approximately 25%, be less than approximately 20%, be less than approximately 15%, be less than approximately 10%, be less than approximately 5% or approximately 0%.

In some embodiments, the method for preparing oleaginous microorganism triglyceride oil based composition produces triglyceride level oils, and described triglyceride level oils has and comprises the freely lipid acid kenel of the triglyceride oil class ratio of the following group formed of choosing: the ratio of C8:0 and C10:0 be at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C10:0 and C12:0 be at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C12:0 and C14:0 be at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; The ratio of C14:0 and C12:0 be at least about 7: 1, at least about 8: 1, at least about 9: 1 or at least about 10: 1; And the ratio of C14:0 and C16:0 be at least about 1: 2, at least about 1: 3, at least about 1: 4, at least about 1: 5, at least about 1: 6, at least about 1: 7, at least about 1: 8, at least about 1: 9 or at least about 1: 10.

III. genetically engineered method and material

The invention provides method and material that microorganism to using in the inventive method carries out (comprising former frustule and recombinant host cell) genetic modification, the described microorganism stagnant former algae host cell of the former algae of mulberry fruit shape, the former algae of Rao Shi, the former algae of Krueger Buddhist nun and harmony that includes but not limited to recombinate.For the ease of reading, the description of these methods and material is divided into to several small portions.In the 1st small portion, method for transformation has been described.The genetically engineered method of utilizing homologous recombination has been described in the 2nd small portion.In the 3rd small portion, expression vector and component have been described.

In certain embodiments of the invention, need to carry out genetic modification to microorganism and produce, regulate characteristic or ratio by the component of microorganisms to strengthen lipid, or improve or provide the feature that regrows based on the plurality of raw materials material.Chlorella, especially original chlorella, atomic chlorella, thermotolerance chlorella, oval chlorella, Chlorella and the chlorella that swims are the microorganisms be preferred in genetically engineered method as herein described, but the microorganism that also can use other chlorella species and other kind.

Other element of promotor, cDNA and 3 ' UTR and carrier can be via clone technology, use the fragment of separating from primary source to produce (referring to for example Molecular Cloning:ALaboratory Manual, Sambrook etc. (the 3rd edition, 2001, Cold Spring HarborPress); With United States Patent (USP) 4,683,202).Perhaps, can use currently known methods with the synthesis mode producing component (referring to Gene.1995 for example October 16; 164 (1): 49-53).

1. engineered method-conversion

Can be by any suitable technical transform cell, described technology comprises such as particle bombardment, electroporation (referring to Maruyama etc., (2004), Biotechnology Techniques8:821-826), granulated glass sphere conversion method and silicon carbide whisker conversion method.Operable another kind of method comprises the formation protoplastis and utilizes CaCl ₂and polyoxyethylene glycol (PEG) is introduced recombinant DNA in microalgae cell (referring to Kim etc., (2002), Mar.Biotechnol.4:63-73, reported and utilized this method to transform oval chlorella).Can utilize micro-algae cotransformation two kinds of different carrier molecules being introduced in cell simultaneously (referring to Protist for example in December, 2004; 155 (4): 381-93).

Can also use particle bombardment (referring to for example Sanford, Trends In Biotech. (1988) 6:299302; United States Patent (USP) the 4th, 945, No. 050); Electroporation (Fromm etc., Proc.Nat ' l.Acad.Sci. (USA) (1985) 82:5824 5828); Any other method that maybe DNA can be introduced in micro-algae with laser beam, microinjection transforms former frustule.

Can use in the present invention for transgenosis being incorporated into to any suitable technology of microorganism (such as chlorella).Dawson etc. (1997) (the same) have described the use micropellet bombardment nitrate reductase (NR) gene have been incorporated into NR defective type thermotolerance chlorella mutant from Chlorella vulgaris, thereby produce stable transformant.In brief, the tungsten pearl of 0.4 micron is coated with plasmid; Make 3 * 10 ⁷individual thermotolerance chlorella cells is applied to the zone, centre 1/3rd of non-selective agar plate and with PDS-1000/He Biolistic Particle Delivery

system (Bio-Rad) bombardment.

For the preferred method that transgenosis is incorporated into to microorganism (such as chlorella), be by Kim etc., (2002), the method that Mar.Biotechnol.4:63-73 describes.Kim has reported use CaCl ₂and polyoxyethylene glycol (PEG) transforms oval chlorella protoplastis.Specifically, by making oval chlorella cells grow into 1-2X10 ⁸the density of individual/milliliter prepares protoplastis.By within centrifugal 5 minutes, reclaiming and washed cell with 1600g, and cell is resuspended in 5 milliliters of phosphate buffered saline buffers (Ph 6.0) that contain 0.6M Sorbitol Powder, 0.6M N.F,USP MANNITOL, 4% (weight/volume) Mierocrystalline cellulose (Calbiochem), 2% (weight/volume) macerozyme (Calbiochem) and 50 unit polygalacturonases (Sigma).In the dark under mild vibration 25 ℃ of lower incubated cell suspension 16 hours.By with 400g, within centrifugal 5 minutes, reclaiming resulting protoplastis.By throw out, gently be resuspended in 5 milliliters of f/2 substratum that contain 0.6M Sorbitol Powder and 0.6M N.F,USP MANNITOL and with 400g centrifugal 5 minutes.This throw out is resuspended in to 1 milliliter and contains 50mM CaCl ₂0.6M Sorbitol Powder/mannitol solution in.Then, 5mg transgenosis DNA and 25 μ g calf thymus DNAs (Sigma) are added 0.4 milliliter 10 ⁷-10 ⁸in individual protoplastis.After at room temperature 15 minutes, add 200 μ L PNC (40% Macrogol 4000,0.8M NaCl, 50Mm CaCl ₂) and at room temperature gently mix 30 minutes.After this, add the 0.6 milliliter of f/2 substratum that is supplemented with 0.6M Sorbitol Powder/mannitol solution, 1% yeast extract and 1% glucose, and in the dark hatch cell 12 hours through transforming so that cell walls regeneration under 25 ℃.Huang etc. (2007) (the same) are used will the encode transgenosis of Mercuryreductase of a kind of similar method to be incorporated in Chlorella DT kind.

Also with electroporation, carry out microbial, such as chlorella.As by (2004) such as Maruyama, Biotechnology Techniques 8:821-826 (integral body is incorporated to this paper by reference) reports, use this technology that transgenosis is introduced and had a liking in the protoplastis of sugared chlorella c-211-1a, described protoplastis is to be prepared by the cell in stationary phase.Observe the temporary transient expression of introduced plasmid under the pulse duration of the field intensity between 600V/cm and 900V/cm and about 400ms, wherein determine the high membrane permeability to 70-kDa FITC-dextran.

In microorganism (as chlorella) example of express transgenic can see document (referring to for example Current Microbiology, the 35th volume (1997), 356-362 page; Sheng WuGong Cheng Xue Bao.2000 July; 16 (4): 443-6; Current Microbiology, the 38th volume (1999), 335-341 page; Appl Microbiol Biotechnol (2006) 72:197-205; Marine Biotechnology 4,63-73,2002; Current Genetics 39:5,365-370 (2001); Plant Cell Reports 18:9,778-780, (1999); BiologiaPlantarium 42 (2): 209-216, (1999); Plant Pathol.J 21 (1): 13-20, (2005)) in.Equally referring to this paper example.

In oleaginous yeast (such as Yarrowia lipolytica), the example of express transgenic can see in document (referring to such as Bordes etc., J Microbiol Methods, June 27 (2007)).For example, in fungi (Mortierella alpina, volume branch Mucor and brown aspergillus), the example of express transgenic also can see document (referring to for example Microbiology, July; 153 (the 7th part): 2013-25 (2007); Mol Genet Genomics, June; 271 (5): 595-602 (2004); Curr Genet, March; 21 (3): 215-23 (1992); Current Microbiology, 30 (2): 83-86 (1995); Sakuradani, NISR Research Grant, " Studies of Metabolic Engineering ofUseful Lipid-producing Microorganisms " (2004); And PCT/JP2004/012021) in.The example of in bacterium (such as intestinal bacteria), expressing allogenic gene is known; Referring to for example Molecular Cloning:A Laboratory Manual, and Sambrook etc. (the 3rd edition, 2001, Cold Spring Harbor Press.

According to the present invention can prepare by the known technology familiar by those skilled in the art by the carrier of microbial.For the nucleotide sequence of construct that transforms multiple Chlorella species corresponding to SEQ ID NO:8.In one embodiment, be designed in microorganism (as micro-algae) gene that the exemplary carrier of expressing lipase gene contains the lipase of encoding, described gene is operably connected with the activated promotor of tool in micro-algae.Perhaps, if carrier containing the promotor be operatively connected with target gene, so described gene can be transformed in cell so that it is operably connected with internal promoter when carrier is integrated.Verifiedly can in micro-algae, implement this promoterless method for transformation (referring to for example Plant Journal 14:4, (1998), 441-447 page).Carrier can also contain the second gene, and described the second genes encoding is for example given the protein for the resistance of microbiotic or weedicide, i.e. selective marker.One or both gene back are optionally to contain 3 of polyadenylation signal ' end non-translated sequence.The expression cassette of two kinds of genes of coding can physics mode be connected in carrier or on independent carrier.Can also utilize the cotransformation of micro-algae, wherein with the different carriers molecule, come transformant (referring to Protist for example in December, 2004 simultaneously; 155 (4): 381-93).Can be optionally ability based on growth under existing at microbiotic or other selective marker make to lack under the condition that the cell of resistance box can not grow and selecting the cell through transforming.

2. engineered method-homologous recombination

Homologous recombination is the ability in complementary dna sequence coupling and exchange homology zone.Transgenosis DNA (" donor ") is introduced in organism, and described DNA contains the sequence (" template ") with the genome sequence homology of institute target, then in corresponding genome homologous sequence site is recombinated genome.In most of the cases, the mechanical step of this process comprises: (1) makes the pairing of homologous dna fragment; (2) make donor dna molecule generation double-strand break; (3) free-end of donor dna is inserted in the template DNA molecule, carries out subsequently DNA and synthesize; And (4) generation double-strand break repair for event, produce final recombinant products.

The ability of carrying out homologous recombination in host's organism has many practical significances, and this is because it can carry out and can be for the preparation of the oleaginous microorganism that can produce tailor-made oil on the molecular genetics aspect.Homologous recombination is accurate gene target event in essence, and therefore, the most of transgenic lines that prepared by identical target sequence are basically identical on phenotype, needs the few transformation event of screening.Homologous recombination also is inserted into gene in host chromosome, produces fabulous genetic stability, even in the situation that do not exist heredity to select.Because different chromogene seats may affect genetic expression, or even the genetic expression of allogeneic promoter/UTR mediation, so homologous recombination can be search locus and assess the method for these environment on the impact of genetic expression in unknown gene group environment.

The useful especially genetically engineered application that utilizes homologous recombination is to select specificity host's regulatory element (as promotor/UTR) and drive heterology genetic expression in the high degree of specificity mode.For instance, but remove or knock out delta 8 desaturase genes/gene family expectability with the heterology gene of codes selection mark and can improve the percent of total of the saturated fatty acid produced in host cell.The work embodiment that embodiment 11 has described homologous recombination target construct and in the former algae of mulberry fruit shape, described delta 8 desaturase genes removed or knocked out.

Because homologous recombination is accurate gene target event, so it can be used to any Nucleotide in target gene or target area is accurately modified, as long as identified enough flank region, both can.Therefore, the means that can utilize homologous recombination to be modified as the adjusting sequence of the genetic expression on affecting RNA and/or protein.It can also be used to the modifying protein coding region to attempt regulatory enzyme activity (as substrate specificity, avidity and Km), and thereby makes the metabolism of host cell that required variation occur.Homologous recombination provides controls host genome, thereby realizes that gene target, gene conversion, genetically deficient, gene replication, gene are inverted and the effective means of exchange genetic expression regulatory element (as promotor, enhanser and 3 ' UTR).

The target construct that can contain the endogenous sequence fragment by utilization comes target gene or the target area in " target " host cell endogenous gene group to realize homologous recombination.Described target sequence can be positioned on 5 ' end of target gene or target area, side joint target gene/zone on the 3 ' end in target gene/zone or even.Described target construct can have the super spirial plasmid DNA form of other carrier framework, PCR product form or the linearizing molecular form of carrier free skeleton is transformed in host cell.In some cases, it is favourable at first utilizing the homologous sequence exposure in restriction enzyme render transgenic DNA (donor dna).This step can increase recombination efficiency and reduce the event generation do not expected to have.Other method that increases recombination efficiency comprises utilizes PCR to produce to transform transgenosis DNA, described DNA to contain the linear end with the genome sequence homology of institute target.

In order to carry out non-limitative illustration, comprise the KE858DNA zone of the former algae of mulberry fruit shape in the donor dna sequence for the zone of homologous recombination.KE858 is a 1.3kb genomic fragment, and it comprises a part that has the protein coding region of homology with transfer RNA (tRNA) (tRNA) family of protein.The southern blotting technique method has showed that the KE858 sequence exists with single copy form in the former algae of mulberry fruit shape (UTEX1435) genome.This zone and the example that uses this zone to carry out the homologous recombination target have been described in PCT and apply in No. PCT/US2009/66142.Another zone of using in donor dna is the part in 6S rRNA genome sequence.During in the former algae of mulberry fruit shape is carried out to homologous recombination, this sequence of use has been described in following examples.

3. carrier and carrier component

In view of the disclosure of this paper, can prepare by the known technology familiar by those skilled in the art the carrier of the microbial according to the present invention.Carrier contains one or more genes usually, wherein each gene is encoded so that required product (gene product) is expressed, and expresses or one or more control sequences of the specific position in gene product target reconstitution cell are operably connected with regulatory gene.For aid reading, this small portion is divided into several small portions.The A small portion has been described control sequence and the novel control sequence provided by the invention usually contained in the carrier.The B small portion has been described gene and the sub-optimization method of novel cipher provided by the invention and the gene that utilizes them to prepare usually contained in the carrier.

A. control sequence

Control sequence is to regulate the expression of encoding sequence or guide in cell by gene product or the nucleic acid of extracellular specific position.The control sequence of regulating expression comprises for example regulates the encoding sequence promotor of transcribing and the terminator that makes the encoding sequence Transcription Termination.Another control sequence be positioned at the coding polyadenylation signal the encoding sequence end on 3 ' end non-translated sequence.The control sequence that gene product is guided to specific position comprises the sequence of coded signal peptide, and the protein priming that described sequence connects them is to cell or extracellular specific position.

Therefore, be designed in micro-algae the encoding sequence that the exemplary carrier of expressing allogenic gene contains required gene product (for example selective marker, lipid path modifying enzyme or sucrose utilize enzyme), described encoding sequence is operably connected with the activated promotor of tool in micro-algae.Perhaps, if carrier does not contain the promotor be operatively connected with the target code sequence, encoding sequence can be transformed in cell so, so that it is operably connected with internal promoter when carrier is integrated.Verifiedly can in micro-algae, implement this promoterless method for transformation (referring to for example Plant Journal 14:4, (1998), 441-447 page).

Many promotors have activity in micro-algae, comprise the internal promoter of transformed micro-algae and the exogenous promotor of the algae that transforms (from the promotor of other algae, from the promotor of higher plant and from the promotor of plant virus or phycovirus).In micro-algae the exogenous and/or internal promoter (and the antibiotics resistance gene that there is function in micro-algae) of the activated illustrative of tool be described in PCT publication No. 2008/151149 and the reference wherein quoted in.

For the promotor of expressing allogenic gene, can be can be maybe the heterology gene with the natural promotor be connected of this gene.Some promotors have activity in surpassing a kind of micro-algae species.Other promotor has species specificity.The illustrative promotor comprises and shows the activated promotor of tool in a plurality of micro-algae species, such as the 'beta '-tubulin from Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) used in following embodiment, and viral promotors, such as cauliflower mosaic virus (CMV) promotor and chlorella virus prompters (referring to PlantCell Rep.2005 for example March; 23 (10-11): 727-35; J Microbiol.2005 August; 43 (4): 361-5; Mar Biotechnol (NY) .2002 January; 4 (1): 63-73).Another promotor that is applicable to expression allogenic gene in former algae is thermotolerance chlorella glutamate dehydrogenase promotor/5 ' UTR.Optionally use at least 10,20,30,40,50 or 60 or more Nucleotide containing promotor in these sequences.In listing in the application's sequence table for the illustrative promotor of expressing allogenic gene in former algae, such as promotor (SEQ ID NO:1) and the oval chlorella nitrate reductase promotor (SEQ ID NO:2) of chlorella HUPl gene.Can also utilize chlorella virus prompters expressing gene in former algae, such as United States Patent (USP) 6,395, the SEQ ID NO:1-7 in 965.In former algae, the activated other promotor of tool can see for example Biochem Biophys Res Commun.1994 October 14; 204 (1): 187-94; Plant Mol Biol.1994 October; 26 (1): 85-93; Virology.2004 August 15; 326 (1): 150-9; And Virology.2004 January 5; 318 (1): in 214-23.Other useful promotor is described in detail in following examples.

Promotor generally can be characterized by composing type or induction type.Constitutive promoter generally free (or some time in cell life cycle) all there is activity or the function that the driving of par is expressed.On the contrary, inducible promoter only has activity (or making its non-activity) in response to stimulator, or is significantly raised or lower.This promotor of two types all can be for method of the present invention.Inducible promoter for the present invention comprises the promotor that mediates the genetic transcription be operatively connected in response to stimulator, for example, lack nitrogen etc. in described stimulator such as the exogenous small molecules provided (glucose, for the promotor of SEQ ID NO:1), temperature (heat or cold), substratum.Suitable promotor can activate basically reticent genetic transcription, or preferably obviously raise low-level transcribe be operatively connected transcribing of gene.Following examples have been described the other inducible promoter for former frustule.

Optionally include the terminator control sequence in, and if use described sequence, the suitable sequence of so main selection, because terminator is relatively interchangeable.Terminator can be primary with respect to transcription initiation region (promotor), can be primary or can obtain from other source with respect to target dna sequence.Referring to for example Chen and Orozco, Nucleic Acids Res. (1988) 16:8411.

The present invention also provides control sequence and the recombination that makes the expression of target gene compartmentation and the carrier that contains them.The organoid of institute's target is chloroplast(id), plastid, plastosome and endoplasmic reticulum.In addition, the invention provides and make protein secreting to extracellular control sequence and recombination and the carrier that contains them.

Can utilize plastid target signal to make the protein target plastid of expressing in former algae nuclear gene group.Chlorella endogenous plastid target sequence is known, such as the gene of the protein of coding target plastid in chlorella nuclear gene group; Referring to for example gene pool accession number AY646197 and AF499684, and in one embodiment, in carrier of the present invention, use described control sequence so that the former phycoplast of protein expression target.

Following examples have been described and have been used algae plastid target sequence to make the correct compartment in heterologous protein target host cell.Utilize the former algae of mulberry fruit shape and original chlorella cells to prepare cDNA library, and described cDNA library is described in PCT and apply in No. PCT/US2009/066142.

In another embodiment of the invention, make the expression target endoplasmic reticulum of polypeptide in former algae.Including suitable delay or sorting signals in expression vector in does not enter in the golgi body in downstream to guarantee that protein is stranded in endoplasmic reticulum (ER).For instance, the carrier IMPACTVECTOR 1.3 from WageningenUR-Plant Research International comprises that the KDEL known is detained or sorting signals.Utilize this carrier to realize that the ER delay has real advantage, this is because reported that this can make expression level improve 5 times or more times.Major cause is seemingly compared with tenuigenin, and ER contains low concentration and/or the proteolytic enzyme of degrading after translation occurs the different responsible expressing proteins that makes.The ER delay signal that has function in green micro-algae is known.For instance, referring to Proc Natl Acad Sci U S on April 26, A.2005; 102 (17): 6225-30.

In another embodiment of the invention, target is to make polypeptide to be secreted into extracellular to enter in substratum.About can the method according to this invention for the example of the activated secretion signal of tool in chlorella of former algae, referring to Hawkins etc., Current Microbiology the 38th volume (1999), 335-341 page.

Many promotors have activity in micro-algae, comprise the internal promoter of transformed algae and the exogenous promotor of the algae that transforms (from the promotor of other algae, from the promotor of higher plant and from the promotor of plant virus or phycovirus).In micro-algae, the activated exogenous and/or internal promoter of tool and the antibiotics resistance gene that has function in micro-algae are by for example being described with Publication about Document: Curr Microbiol.1997 December; 35 (6): 356-62 (Chlorella vulgaris); Mar Biotechnol (NY) .2002 January; 4 (1): 63-73 (oval chlorella); Mol Gen Genet.1996 October 16; 252 (5): 572-9 (Phaeodactylum tricornutum (Phaeodactylum tricornutum)); Plant MolBiol.1996 April; 31 (1): 1-12 (strong volvox (Volvox carteri)); Proc Natl AcadSci U S is on November 22, A.1994; 91 (24): 11562-6 (strong volvox); Falciatore A, Casotti R, Leblanc C, Abrescia C, Bowler C, PMID:10383998, in May, 1999; 1 (3): 239-251 (Laboratory of Molecular Plant Biology, StazioneZoologica, Villa Comunale, I-80121 Naples, Italy) (Phaeodactylum tricornutum and Wei Shi hailian seaweed); Plant Physiol.2002 May; 129 (1): 7-12 (Porphyridium (Porphyridiumsp.)); Proc Natl Acad Sci U S is on January 21, A.2003; 100 (2): 438-42 (Chlamydomonas reinhardtii); Proc Natl Acad Sci U S is year February A.1990; 87 (3): 1228-32 (Chlamydomonas reinhardtii); Nucleic Acids Res.1992 June 25; 20 (12): 2959-65; MarBiotechnol (NY) .2002 January; 4 (1): 63-73 (Chlorella); Biochem Mol BiolInt.1995 August; 36 (5): 1025-35 (Chlamydomonas reinhardtii); J Microbiol.2005 August; 43 (4): 361-5 (Dunaliella); Yi Chuan Xue Bao.2005 April; 32 (4): 424-33 (Dunaliella); Mar Biotechnol (NY) .1999 May; 1 (3): 239-251 (Thalassiosira (Thalassiosira) and brown algae belong to (Phaedactylum)); Koksharova, Appl Microbiol Biotechnol in February, 2002; 58 (2): 123-37 (various species); Mol Genet Genomics.2004 February; 271 (1): 50-9 (thermophilic synechococcus (Thermosynechococcus elongates)); J.Bacteriol. (2000), 182,211-215; FEMS Microbiol Lett.2003 April 25; 221 (2): 155-9; Plant Physiol.1994 June; 105 (2): 635-41; Plant Mol Biol.1995 December; 29 (5): 897-907 (synechococcus belongs to PCC 7942); Mar Pollut Bull.2002; 45 (1-12): 163-7 (necklace Trentepohlia PCC 7120); Proc Natl Acad Sci U S is year March A.1984; 81 (5): 1561-5 (necklace Trentepohlia (various algae strain)); Proc Natl Acad Sci US is on March 27, A.2001; 98 (7): 4243-8 (synechocystis (Synechocystis)); Wirth, Mol Gen Genet in March, 1989; 216 (1): 175-7 (various species); Mol Microbiol, in June, 2002; 44 (6): 1517-31; And Plasmid, in September, 1993; 30 (2): 90-105 (two-tube Fu Shi algae (Fremyella diplosiphon)); Hall etc. (1993) Gene 124:75-81 (Chlamydomonas reinhardtii); Gruber etc. (1991) .Current Micro.22:15-20; Jarvis etc. (1991) Current Genet.19:317-322 (Chlorella); About other promotor, also referring to United States Patent (USP) 6,027, the table 1 in 900.

For the promotor of expressing allogenic gene, can be can be maybe the heterology gene with the natural promotor be connected of this gene.Some promotors have activity in surpassing a kind of micro-algae species.Other promotor has species specificity.Preferred promotor comprises and shows the activated promotor of tool in a plurality of micro-algae species, such as the promotor of the RBCS2 from Chlamydomonas reinhardtii and viral promotors (as cauliflower mosaic virus (CMV) promotor and chlorella virus) (referring to Plant Cell Rep.2005 for example March; 23 (10-11): 727-35; J Microbiol.2005 August; 43 (4): 361-5; Mar Biotechnol (NY) .2002 January; 4 (1): 63-73).In other embodiments, can use grape Trentepohlia (Botryococcus) malate dehydrogenase (malic acid dehydrogenase) promotor (as nucleic acid of the arbitrary part that comprises SEQ ID NO:150) or Chlamydomonas reinhardtii RBCS2 promotor (SEQ ID NO:151).Optionally use at least 10,20,30,40,50 or 60 or more Nucleotide containing promotor in these sequences.Preferred Chlorella species internal promoter is SEQ ID NO:1 and SEQID NO:2.

[0004] promotor that is preferred for expression allogenic gene in chlorella is listed in the application's sequence table, such as promotor (SEQ ID NO:1) and the oval chlorella nitrate reductase promotor (SEQ ID NO:2) of chlorella HUP1 gene.Can also utilize chlorella virus prompters expressing gene in chlorella, such as United States Patent (USP) 6,395, the SEQID NO:1-7 in 965.In chlorella, the activated other promotor of tool can see for example Biochem Biophys Res Commun.1994 October 14; 204 (1): 187-94; PlantMol Biol.1994 October; 26 (1): 85-93; Virology.2004 August 15; 326 (1): 150-9; And Virology.2004 January 5; 318 (1): 214-23.

B. gene and codon optimized

Gene generally includes promotor, encoding sequence and stops control sequence.When being assembled by recombinant DNA technology, gene can be called as expression cassette, and can be by the restriction site side joint so that be inserted into for recombination is introduced in the carrier of host cell.Expression cassette can be by genomic dna sequence or other nucleic acid side joint, and purpose is to facilitate expression cassette to pass through the homologous recombination stable integration in genome.Perhaps, carrier and its expression cassette can keep not integrating, and in this case, carrier generally includes the replication orgin that can make the heterology carrier DNA be copied.

The common gene existed in carrier is the gene of a kind of protein of coding, and described protein expression makes it possible to the reconstitution cell that will contain described protein and the cell differentiation of not expressing described protein and comes.Described gene and its corresponding gene product are known as selective marker.Can use any in the multiple choices mark for the transgenic constructs that transforms former algae.The example of suitable selective marker comprises G418 resistant gene, nitrate reductase gene (referring to (1997) such as Dawson, Current Microbiology 35:356-362), hygromycin phosphotransferase gene (HPT; Referring to (2002) such as Kim, Mar.Biotechnol.4:63-73), neomycin phosphotransferase gene ble gene (it gives the phleomycin resistance) (Huang etc. (2007), and aminoglycoside-3 Appl.Microbiol.Biotechnol.72:197-205), '-O-phosphotransferase (SEQ ID NO:194) (it gives kantlex (kanamycin) resistance).Measuring micro-algae knows the method for antibiotic susceptibility.For instance, Mol Gen Genet.1996 October 16; 252 (5): 572-9.

In being generally used for the transgenic constructs that transforms micro-algae (comprising former Trentepohlia species), can also use not based on antibiotic other selective marker.The gene of giving the ability that can utilize some carbon source that before can not have been utilized by micro-algae also can be used as selective marker.For instance, the strain of the former algae algae of mulberry fruit shape can not rely on sucrose growth (if growth is arranged) usually well.The construct that use contains invertase gene can be given positive transformant and usings the ability of sucrose as carbon substrate growth.About using the sucrose utilization to be discussed in following part IV as the other details of selective marker and other selective marker.

For purposes of the present invention, comprise at least 2 kinds for the preparation of the expression vector of recombinant host cell of the present invention, and generally include 3 kinds of genes, wherein a kind of gene is selective marker.For instance; can be by the genetically engineered former algae of preparation process of the present invention that is converted with carrier of the present invention; described carrier also comprises one or more allogenic genes except selective marker, such as invertase gene or acyl group ACP-thioesterase gene.Can utilize inducible promoter to make one or both genetic expression, the relative opportunity that described promotor makes it possible to control these genetic expressions is to strengthen the lipid productive rate and to the conversion of fatty acid ester.The expression of two or more allogenic genes can the control in identical inducible promoter under, or under the control in different induction types (or composing type) promotor.Under latter event, can induce the first expression of exogenous genes very first time section (during can induce or not induce the second expression of exogenous genes) and can induce for second the second time period of expression of exogenous genes (during can induce or not induce the first expression of exogenous genes).

In other embodiments, two or more allogenic genes (except any selective marker) are: fatty acyl group-ACP thioesterase and fatty acyl group-coenzyme A/aldehyde reductase, both compound actions can produce pure product.Other combination of allogenic gene further is provided, has included but not limited to fatty acyl group-ACP thioesterase and fatty acyl group-CoA-reductase, to produce aldehyde.In one embodiment, carrier provides the combination of fatty acyl group-ACP thioesterase, fatty acyl group-CoA-reductase and alkanoic decarbonylation base enzyme, to produce alkane.In each embodiment in these embodiments, can utilize inducible promoter to express one or more allogenic genes.

Other illustrative carrier of the present invention of expressing two or more allogenic genes comprises the carrier of encoding sucrose translocator and invertase and the carrier of codes selection mark and secretor type invertase.The former algae of restructuring that passes through the carrier conversion of any type can utilize sugarcane (with the sugarcane derived carbohydrate) as carbon source owing to passing through engineered, so can produce lipid with lower production cost.Inserting above-mentioned two kinds of allogenic genes can be with to destroy the polysaccharide biosynthesizing via orientation and/or random mutagenesis combined, thereby makes even more carbon flow to into lipid production.Individually with combination, utilize the nutrition conversion, change the engineered of lipid production and process to make the lipid composition by microorganisms producing to change by exogenous enzymes.One or more hydrocarbon materials that described variation can be produced lipid amount, produce are with respect to the variation of the lipid matter type aspect produced in the amount of other lipid and/or microorganism.For instance, can carry out the engineered TAG with generation higher amount and/or per-cent to micro-algae.

[0005], in order to make the recombinant protein optimum expression, it is useful using the encoding sequence of the generation mRNA with the codon preferentially used by institute's transformed host cell.Therefore, genetically modified suitable expression needs genetically modified codon use to be complementary with the sub-bias of organic specific cryptosystem of express transgenic.The accurate basic mechanism of this effect has many, comprise the proper equilibrium between protein synthetic in available amino acidylate tRNA pond and cell, and render transgenic messenger RNA(mRNA) (mRNA) is translated more effectively when addressing that need.When the codon in transgenosis uses not through optimization, available tRNA pond deficiency, so that heterology mRNA effectively translates, causes rrna termination and termination and transgenosis mRNA potentially unstable.

The invention provides the nucleic acid that codon is optimized, it can be used for making recombinant protein successful expression in former algae.The cDNA sequence of separating from the former algae of mulberry fruit shape by research is used and is analyzed the codon former Trentepohlia species.This is analyzed and is inquired about surpassing 24,000 codons, and analytical results is shown in following table 2.

Preferred codon in the strain of the former Trentepohlia algae of table 2. uses.

In other embodiments, for the micro-algae algae strain except the strain of former Trentepohlia algae, to the gene in recombinant vectors, carry out codon optimized.For instance, gene is recoded with the method for expressing, be described in United States Patent (USP) 7,135 in micro-algae, in 290.Can in the codon usage data storehouse of for example gene pool, obtain about codon optimized other information.

Other limiting examples that codon in powder core chlorella (Chlorella pyrenoidosa), Dunaliella salina and original chlorella uses is illustrated in respectively in table 28,29 and 30.

Codon in table 28. powder core chlorella uses.

Preferred codon in table 29. Dunaliella salina uses.

Preferred codon in the original chlorella of table 30. uses.

C. inducible expression

[0006] the present invention also provides with inducible promoter and has expressed target gene.Specifically, express when lipase gene allows where necessary condition to be adjusted after microorganism growth and produce lipase for example after cell rupture, to strengthen transesterification, reduce the water-content of reaction mixture and/or to add enough alcohol to drive TAG to transform to fatty acid ester with inducible promoter.

Inducible promoter for the present invention comprises the promotor that mediates the genetic transcription be operatively connected in response to stimulator, described stimulator such as the exogenous small molecules provided (for example glucose, for the promotor of SEQ ID NO:1), temperature (heat or cold), light etc.Suitable promotor can activate basically reticent genetic transcription, or preferably obviously raise low-level transcribe be operatively connected transcribing of gene.Under latter event, the level that lipase is transcribed preferably can significantly not disturbed the microbial growth of expressing described lipase.

The expression of transgenosis in chlorella can be carried out in the inducibility mode via promotor, and described promotor is such as the promotor (SEQ ID NO:1) that drives chlorella hexose transporter gene.This promotor is in the situation that exist glucose strongly to be activated in substratum.

D. the expression of two or more allogenic genes

In addition, through genetically engineered microorganism (as micro-algae), can comprise and express two or more allogenic genes, for example, as lipase gene and dissolving gene (gene of the polysaccharide degrading enzyme of encoding).Can utilize inducible promoter to make one or both genetic expression, the relative opportunity that described promotor makes it possible to control these genetic expressions is to strengthen the lipid productive rate and to the conversion of fatty acid ester.The expression of two or more allogenic genes can the control in identical inducible promoter under, or under the control in different inducible promoters.Under latter event, can induce the first expression of exogenous genes very first time section (during can induce or not induce the second expression of exogenous genes) and can induce for second the second time period of expression of exogenous genes (during can induce or not induce the first expression of exogenous genes).This paper provides for lipid being produced to microorganism and has carried out carrier and the method that engineered so that described microorganism can metabolism sucrose, can metabolism sucrose be a kind of favourable proterties, this be because this can make through engineered cell and sugarcane raw material can be changed into to lipid.

This paper also provides the process of expressing two or more allogenic genes genetically engineered microbial strain (for example micro-algae, oleaginous yeast, bacterium or fungi); described allogenic gene is fatty acyl group-ACP thioesterase and fatty acyl group-coenzyme A/aldehyde reductase for example, and these allogenic gene compound actions can produce pure product.Other combination of allogenic gene further is provided, has included but not limited to fatty acyl group-ACP thioesterase and fatty acyl group-CoA-reductase, to produce aldehyde.In addition, the application provides the combination of fatty acyl group-ACP thioesterase, fatty acyl group-CoA-reductase and alkanoic decarbonylation base enzyme, to produce alkane.Can utilize inducible promoter to express one or more allogenic genes.

The example that is applicable to the other modification in the present invention comprises and the strain of micro-algae algae carried out genetically engineered to express two or more allogenic genes, and a kind of allogenic gene coding is the translocator of carbon source (such as sucrose) and the second allogenic gene encoding sucrose saccharase fixedly.Resulting fermentable organism is produced the production cost of hydrocarbon lower than the organism that can be obtained by the biology hydrocarbon production method of previously known.Inserting above-mentioned two kinds of allogenic genes can be with to destroy the polysaccharide biosynthesizing via orientation and/or random mutagenesis combined, thereby makes even more carbon flow to into hydrocarbon production.Individually with combination, utilize the nutrition conversion, change the engineered of hydrocarbon production and process to make the compositions of hydrocarbons by microorganisms producing to change by exogenous enzymes.One or more hydrocarbon materials that described variation can be produced hydrocarbon amount, produce are with respect to the variation of the hydrocarbon materials type aspect produced in the amount of other hydrocarbon and/or microorganism.For instance, can carry out the engineered TAG with generation higher amount and/or per-cent to micro-algae.

E. compartmentation is expressed

The present invention also provides the compartmentation of target gene to express.Specifically, in specific embodiments, it is favourable making the one or more cellular compartments of expression target of lipase, wherein lipase and the isolated until transesterification of most cells lipid is started.The preferred cell device of institute's target is chloroplast(id), plastosome and endoplasmic reticulum.

(1) be expressed in chloroplast(id)

In one embodiment of the invention, make the expression target chloroplast(id) of polypeptide in microorganism.Be known and can be used to the present invention for the method for expression target chloroplast(id) that makes the heterology gene.Make the method for exogenous genes products target in chloroplast(id) be described in Shrier etc., in EMBO J. (1985) 4:25 32.About making the nuclear gene product be displaced to the use of the transit peptides in chloroplast(id), also referring to Tomai etc., No. the 4th, 940,835, Gen.Biol.Chem. (1988) 263:1510415109 and United States Patent (USP).For pilot protein matter, to the method for chloroplast transit, also summarize in Kenauf TIBTECH (1987) 5:40 47.The chloroplast targeted sequence of chlorella endogenous is known, as the gene of the protein of coding target chloroplast(id) in chlorella nuclear gene group; Referring to for example gene pool accession number AY646197 and AF499684.

Wageningen UR-Plant Research International sells the IMPACTVECTOR1.4 carrier, it uses the secretion signal of the little sub-unit protein of chrysanthemum (Chrysanthemum morifolium) that heterologous protein is delivered in chloroplast stroma (tenuigenin) environment, crosses over Bilayer Thin Films and is shuttled back and forth.Make front 11 amino acid of described protein and ripe carboxydismutase protein merge to allow signal peptide is suitably processed to (Wong etc., Plant Molecular Biology 20:81-93 (1992)).Signal peptide contains the natural intron from the RbcS gene.

In another approach, the chloroplast gene group is carried out genetically engineered so that its expressing heterologous protein.Having described the high speed tungsten micropellet bombardment recipient cell that scribbles foreign DNA by use makes the chloroplast(id) of Chlamydomonas reinhardtii (a kind of green alga) carry out stable conversion.Referring to such as Boynton etc., Science (1988) 240:1534 1538; Blowers etc., Plant Cell (1989) 1:123 132; And Debuchy etc., EMBO J. (1989) 8:28032809.The transformation technology that uses the micro-bullet of tungsten is by Klein etc., and Nature (London) (1987) 7:70 73 describes.Other method of plant and micro-algae being carried out to the chloroplast(id) conversion is known.Referring to for example United States Patent (USP) 5,693,507; 6,680,426; And Plant Physiol.2002 May; 129 (1): 7-12; And Plant Biotechnol year May J.2007; 5 (3): 402-12.

As United States Patent (USP) the 6th, (give November 20 calendar year 2001 such as Kaplan etc. 320, No. 101; It is incorporated to this paper by reference) described in, can carry out chemical treatment so that the number of chloroplast of each cell reduces to approximately 1 to cell.Then, can heterology nucleic acid be introduced in cell so that at least one heterology nucleic acid molecule is incorporated in chloroplast(id) via particle bombardment.Heterology nucleic acid is through selecting so that it can be incorporated in the chloroplast gene group via homologous recombination, and described homologous recombination can easily realize by the intrinsic enzyme of chloroplast(id).For this purpose, heterology nucleic acid also comprises at least one nucleotide sequence that stems from the chloroplast gene group except target gene.In addition, heterology nucleic acid generally includes selective marker.Other details about this technology sees United States Patent (USP) the 4th, and 945, No. 050 and the 5th, in 693, No. 507, described patent is incorporated to this paper by reference.Therefore polypeptide can be produced by the protein expression system of chloroplast(id).

United States Patent (USP) the 7th, (give Daniell etc. on November 14th, 2,006 135, No. 620; Be incorporated to by reference this paper) chloroplast expression vector and methods involving described.Expression cassette is the DNA construct that comprises encoding sequence and make the suitable control sequence that encoding sequence can suitably express in chloroplast(id).Typical case's expression cassette comprises following component: from 5 of microbial gene or chloroplast gene ' end non-translational region, as psbA, it makes to encode the DNA sequence dna of target polypeptides can be in chloroplast(id) transcription and translation; The DNA sequence dna of coding target polypeptides; And translation and transcription termination region, as 3 of chloroplast gene ' end inverted repeat district, it can make the RNA of introduced gene stable, thereby strengthens exogenous gene expression.Described box can optionally comprise antibiotics resistance gene.

Usually, expression cassette by suitable restriction site side joint can be inserted in suitable genome.Expression cassette can be by the DNA sequence dna side joint from chloroplast DNA to facilitate expression cassette especially to pass through the homologous recombination stable integration in the chloroplast gene group.Perhaps, expression cassette can keep not integrating, and in this case, expression cassette generally includes the chloroplast(id) replication orgin that can make heterology DNA be copied in chloroplast(id).

Expression cassette generally comprises the promoter region in the gene that can express in chloroplast(id).Promoter region may comprise can be available from the promotor of chloroplast gene, as the psbA gene from spinach or pea, or from rbcL and atpB promoter region and the Rrna promotor of corn.The example of promotor is described in Hanley-Bowdoin and Chua, TIBS (1987) 12:6770; Mullet etc., Plant Molec Biol. (1985) 4:3954; Hanley-Bowdoin (1986) PhD.Dissertation, the Rockefeller University; Krebbers etc., NucleicAcids Res. (1982) 10:4985 5002; Zurawaki etc., Nucleic Acids Res. (1981) 9:3251 3270; And Zurawski etc., in Proc.Nat ' l Acad Sci.U.S.A. (1982) 79:7699 7703.Can identify other promotor and by target promoter being placed in without 5 of promotor marker gene ' end and with respect to estimated the relative intensity of the promotor of so identifying by the efficiency of transcribing the described target promoter of observation for example obtained from the promotor (relatively strong chloroplast(id) promotor) of psbA gene.The efficiency of heterology genetic expression can strengthen by any in multiple technologies in addition.These technology comprise uses a plurality of promotors to be inserted in 5 of heterology gene ' end (such as dual psbA promotor), to add enhancer sequence etc. with series system.

Can use the activated multiple promotor of tool in the chlorella chloroplast(id) so that allogenic gene is expressed in the chlorella chloroplast(id), as the promotor in the middle existence of gene pool accession number NC_001865 (Chlorella vulgaris chloroplast(id), complete genome group).

In the situation that needs make the heterology gene carry out inducible expression, can comprise inducible promoter in expression cassette and/or contain transcribe and/or translation skill on provide regulating effect (on 3 ' end) sequence 5 ' end non-translational region.For instance, 5 ' end non-translational region can come from the gene that expression can be regulated by light.Equally, can use 3 ' end inverted repeat district to make the RNA of heterology gene stable.Can strengthen to some extent in response to the specific objective stimulator and bend down and express or do not express to identify inducible genes in the situation that does not have described stimulator according to the expression meeting.For instance, can be according to express to occur strengthening during rayed, and in the situation that the low light level or unglazed expressions obviously minimizing occurs or do not express to identify photoinduction type gene.From the light adjustment type promotor of green micro-algae, be known (referring to Mol Genet Genomics.2005 for example December; 274 (6): 625-36).

The terminator of using is mainly suitable terminator, and this is because terminator is seemingly relative interchangeable between chloroplast(id) and bacterium.Terminator can be primary with respect to transcription initiation region, can be primary or can obtain from other source with respect to target dna sequence.Referring to for example Chen and Orozco, Nucleic Acids Res. (1988) 16:8411.

Can expression cassette be transformed in the target plant cell by any in many methods.These methods for example comprise particle bombardment (referring to for example Sanford, Trends In Biotech. (1988) 6:299302; United States Patent (USP) the 4th, 945, No. 050); Electroporation (Fromm etc., Proc.Nat ' l.Acad.Sci. (USA) (1985) 82:5824 5828); Use laser beam, microinjection maybe DNA can be introduced to any other method in chloroplast(id).

The other description that is applicable to the chloroplast expression vector in microorganism (as micro-algae) is seen to United States Patent (USP) the 7th, 081, No. 567 (giving Xue etc. on July 25th, 2006); The 6th, 680, No. 426 (giving Daniell etc. on January 20th, 2004); And the 5th, in 693, No. 507 (giving Daniell etc. on December 2nd, 1997).

Can utilize chloroplast targeted signal to make the protein target chloroplast(id) of expressing in chlorella nuclear gene group.The chloroplast targeted sequence of chlorella endogenous is known, as the gene of the protein of coding target chloroplast(id) in chlorella nuclear gene group; Referring to for example gene pool accession number AY646197 and AF499684.Protein can also be by directly being inserted in gene in the chloroplast gene group to be expressed in the chlorella chloroplast(id).Usually carry out the chloroplast(id) conversion via homologous recombination, and chloroplast(id) transform can in the situation that known chloroplast gene group sequence can set up targeting vector, carry out (referring to the complete genome group sequence of for example chlorella chloroplast(id); Gene pool accession number NC_001865).The details transformed about chloroplast(id), referring to the former parts of this paper.

(2) be expressed in plastosome

In another embodiment of the invention, make the expression target plastosome of polypeptide in microorganism.For making the exogenous genes products target in the method (Boutry etc. of plastosome, Nature (London) (1987) 328:340 342) existing institute is described, and the method in green micro-algae of being included in is (referring to Mol Gen Genet.1993 for example January; 236 (2-3): 235-44).

For instance, the encode expression vector of suitable secretion signal can make heterologous protein target plastosome.Use yeast CoxIV secretion signal from the IMPACTVECTOR1.5 carrier of Wageningen UR-Plant Research International, showed that described secretion signal can send protein in mitochondrial matrix.Make front 4 amino acid of described protein and yeast CoxIV albumen merge to allow signal peptide is suitably processed to (Kohler etc., Plant J 11:613-621 (1997)).Other mitochondrial targeting sequence is known, is included in the target sequence that has function in green micro-algae.For instance, referring to FEBS Lett.1990 January 29; 260 (2): 165-8; With J Biol Chem.2002 February 22; 277 (8): 6051-8.

Can utilize Mitochondrially targeted signal to make the protein target plastosome of expressing in chlorella nuclear gene group.About the details of mitochondrial protein target and conversion, referring to the former parts of this paper.

(3) be expressed in endoplasmic reticulum

In another embodiment of the invention, make the expression target endoplasmic reticulum of polypeptide in microorganism.Including suitable delay or sorting signals in expression vector in does not enter in the golgi body in downstream to guarantee that protein is stranded in endoplasmic reticulum (ER).For instance, IMPACTVECTOR 1.3 carriers from Wageningen UR-Plant Research International comprise that the KDEL known is detained or sorting signals.Utilize this carrier to realize that the ER delay has real advantage, this is because reported that this can make expression level improve 5 times or more times.Major cause is seemingly compared with tenuigenin, and ER contains low concentration and/or the proteolytic enzyme of degrading after translation occurs the different responsible expressing proteins that makes.The ER delay signal that has function in green micro-algae is known.For instance, referring to Proc Natl Acad Sci U S on April 26, A.2005; 102 (17): 6225-30.

For example any allogenic gene can be incorporated into, in microorganism (former algae) although method of the present invention and material make, as discussed in following components, especially pay close attention to and modify relevant gene to sucrose utilization and lipid path.

IV. selective marker

1. sucrose utilizes

In embodiments, the former frustule of restructuring of the present invention further contains one or more ectogenic sucrose and utilizes gene.In various embodiments, described one or more albumen of one or more genes encodings, the group that described albumen selects free fructokinase, glucokinase, hexokinase, invertase, sucrose transporter to form.For instance, the expression of sucrose transporter and invertase make former algae by sucrose from the substratum transporte to cells and by sucrose hydrolysis, to produce glucose and fructose.Optionally, in the situation that the activity of endogenous hexokinase is not enough to farthest make the fructose phosphorylation, can also express fructokinase.The example of suitable sucrose transporter is gene pool accession number CAD91334, CAB92307 and CAA53390.The example of suitable fructokinase is gene pool accession number P26984, P26420 and CAA43322.

In one embodiment, the invention provides the former algae host cell of secretion invertase.The secretion of invertase makes that do not need to express can be by the translocator in the sucrose transporte to cells.This is because the saccharase catalysis sucrose molecules of secretion changes into glucose molecule and fructose molecule, and both all can and utilize by microorganism transhipment provided by the invention afterwards.For instance, the expression that has an invertase (as SEQ ID NO:3) of secretion signal (as SEQ ID NO:4 (from yeast), SEQ ID NO:5 (from higher plant), SEQ ID NO:6 (eukaryotic cell has secretion signal) and SEQ ID NO:7 (from the signal sequence of higher plant and the combination of eukaryotic cell shared signal sequence)) makes and produces invertase activity in extracellular.Described protein expression (can make its expression by genetically engineered method disclosed herein) makes cell can utilize extracellular glucose to using and utilize sucrose as extracellular energy derive as energy derive.

The former Trentepohlia species of expressing saccharase in containing the substratum of sucrose are preferred micro-algae species of production oils.This protein expression and extracellular target with complete activity makes resulting host cell can utilize the sucrose growth, and their counterpart that process transforms can not.Therefore, the invention provides the former algae reconstitution cell of the invertase gene with codon optimization, described invertase gene includes but not limited to the yeast invertase gene, and it is integrated in cellular genome so that invertase gene is expressed (as assessed by invertase activity and sucrose hydrolysis).The present invention also provide the invertase gene that is used as selective marker in former algae reconstitution cell (this is because these cells can utilize the sucrose growth, they not through the counterpart that conversion can not); And the method for utilizing saccharase as effective selective marker of algae molecular genetics, recombinant host cell to be selected.

Invertase successful expression in former algae has also illustrated another aspect of the present invention, because this shows allos (restructuring), protein can be expressed in alga cells, and outer and enter in substratum by successful transporte to cells with form with complete activity and function.Therefore, the invention provides in micro-algae, expressing multiple different heterologous protein and they are secreted into to method and the reagent outside host cell.Described protein comprises that for example industrial enzyme is (as lipase, proteolytic enzyme, cellulase, polygalacturonase, amylase (for example SEQ ID NO:190-191), esterase, oxydo-reductase, transferring enzyme, Sumylact L, isomerase and saccharase) and human cytokines (as somatomedin, cytokine, the full length antibody that comprises two light chains and two heavy chains, Fab, scFv (single chain variable fragment), camel type antibody, antibody fragment, the antibody fragment fusion rotein, the antibody receptor fusion rotein, Regular Insulin, Interferon, rabbit and rhIGF-1).

The successful expression of invertase in former algae also illustrated another aspect of the present invention, because this provides method and the reagent that utilizes the fungi transit peptides to guide protein secreting in former algae in algae; And definite peptide whether can in former frustule, serve as transit peptides with and serve as method and the reagent of the ability of transit peptides.Method of the present invention and reagent can be used as evaluation and can successfully albumen be transported to extracellular and make yeast invertase obtain greatly instrument and the platform of other transit peptides of utilization in these methods.As indicated in the present embodiment, remove endogenous yeast invertase transit peptides and it is replaced with to other transit peptides (host algae endogenic or from (eukaryotic cell, prokaryotic cell prokaryocyte and the virus) in other source) and can identify whether any target peptide can serve as the transit peptides that pilot protein matter is discharged from cell.

The example of suitable invertase comprises the invertase indicated by gene pool accession number CAB95010, NP_012104 and CAA06839.The limiting examples of suitable saccharase is listed in the table below in 3.Following sequence table comprises the aminoacid sequence of each listed saccharase.In some cases, being applicable to exogenous sucrose in method of the present invention and carrier utilizes genes encoding and the invertase that is selected from table 3 to have at least 40%, 50%, 60%, 75% or 90% or the conforming invertase of homoamino acid more.

Table 3. invertase.

By former algae, saccharase is secreted in substratum to the waste molasses growth that makes cell can utilize equally sugarcane processing to produce, as it utilizes the growth of pure reagent level glucose; Utilize this low price waste prods of sugarcane processing can significantly save lipid and other oils production cost.Therefore, the invention provides a kind of microorganisms cultures, described culture contains former algae microbial population and comprises (i) sucrose and (ii) substratum of invertase.In various embodiments, the sucrose in culture derives from the cellulosic material (it may optionally contain xylogen) of Chinese sorghum, sugar beet, sugarcane, molasses or process depolymerization.In yet another aspect, method of the present invention and reagent can significantly increase number and the type of the raw material that can be reorganized former algae utilizes.Although the microorganism of this paper example is through changing so that they can utilize sucrose, but can utilize method of the present invention and reagent so that raw material (as Mierocrystalline cellulose) can by can eccrine fiber the present invention of element enzyme, polygalacturonase, isomerase etc. through engineered host microorganism utilization, thereby make the degradation production of enzymatic reaction no longer only merely by host's tolerance, utilized by the host but can be used as carbon source.The example of this respect is described in hereinafter and in embodiment, in described embodiment, microorganism is through the engineered alpha-galactosidase that can secrete with expression, thereby give the ability of the alpha galactosides key in the hydrolysis oligosaccharides, described alpha galactosides key is such as contained alpha galactosides key in raffinose and stachyose (for being present in two kinds of oligosaccharides in agricultural waste stream).

2. the alpha galactosides expression of enzymes

Although the expression of invertase as described above can be given former frustule, can utilize more efficiently sucrose as the ability of carbon source (via making the α-key between fructose molecule and glucose molecule in disaccharides sucrose carry out enzymic hydrolysis), the expression of other enzyme of the α-key of other type in the hydrolysis oligosaccharides also can be given the ability that former frustule utilizes other carbon source.The expression of these enzymes (and ability of the carbon source that can utilize former algae and other microalgae cell usually can not utilize produced) can utilize the positive colony of these carbon source for growth to be used as the selective marker for the former frustule of these transgenosiss by making it possible to selection.

In one embodiment, the former frustule of restructuring of the present invention further contains the allogenic gene of one or more coding polysaccharide degrading enzymes.In various embodiments, the gene of one or more coding polysaccharide degrading enzymes is genes of coding secretor type alpha-galactosidase.The ability of described sugar (carbon source) growth that contains D-semi-lactosi glycosidic bond (as the α-key between semi-lactosi monosaccharide units and glucose monosaccharide units) through the algae strain utilization transformed is given in the expression of exogenous secretor type alpha-galactosidase in former frustule.The former Trentepohlia algae strain of expressing exogenous secretor type alpha-galactosidase can utilize disaccharides, as melibiose (by the disaccharides that α-D-semi-lactosi-glucose forms).

Sugar, as raffinose (trisaccharide that comprises α-connecting-type semi-lactosi-glucose-fructose) and stachyose (by two α-connecting-type D-galactose unit, the tetrose that back has α-connecting-type glucose and fructose to form) with sizable ratio, be present in agricultural waste stream, described agricultural waste stream is as beet pulp (raffinose) and soyflour (stachyose).Described agricultural residue has represented and can have been changed into by the microorganism that can utilize them (comprising former algae) the important undeveloped carbon source of oils.

The strain of former Trentepohlia algae can not utilize the oligosaccharides of any significant quantity, or can not utilize oligosaccharides at all, and described oligosaccharides is as raffinose and stachyose.In the situation that raffinose and stachyose, although the transgenic alga strain (as described above) of expressing invertase can the alpha galactosides derivative of sucrose hydrolysis in α-key between fructose and glucose, but still can not utilize all the other oligosaccharides because invertase can not the described sugar of cracking in remaining α-key and the disaccharides of gained can not be utilized.The allogenic gene of the allogenic gene that in another embodiment, the former frustule of restructuring of the present invention comprises the encoding sucrose saccharase and coding alpha-galactosidase.Therefore, the algae strain of expressing invertase and alpha-galactosidase can the complete hydrolysis oligosaccharides, as raffinose and stachyose, thereby can consume constituent monomers.In addition, the alpha galactosides enzyme coding gene can be used as the selective marker transformed.The clone who contains exogenous alpha-galactosidase gene will have the ability of utilizing the melibiose growth.The example that is applicable to the alpha-galactosidase gene in the strain of former Trentepohlia algae comprises MEL1 gene from saccharomyces carlsbergensis (Saccharomyces carlbergensis), from the AglC gene of aspergillus niger (Aspergilus niger).What is interesting is, even use gene is optimized according to the preferred codon in the strain of former Trentepohlia algae, alpha-galactosidase gene that neither be all has function in former Trentepohlia species.Following examples show when the former frustule of transgenosis is transformed at the gene of the MEL1 from saccharomyces carlsbergensis that uses codon to optimize with from the AglC gene of aspergillus niger but not from the alpha galactosides enzyme coding gene of higher plant guar-bean (Cyamopsis tetragonobola/Guarbean) to utilize the melibiose growth.

3. the VitB1 auxotrophy supplements

Knownly comprise that the former Trentepohlia algae strain of the former algae of mulberry fruit shape is that the strain of VitB1 auxotrophy algae is (referring to for example Ciferri, O. (1956) Nature, the 178th volume, the 1475-1476 page), the meaning is that these algae strains need the VitB1 in nutritional medium to grow.The VitB1 auxotrophy is the enzyme mutant in the VitB1 biosynthesis pathway or expresses due to deficiency.Through the transgenic alga strain of the enzyme that lacks in supplementary expression VitB1 biosynthesis pathway, can in the situation that not add VitB1 growth, therefore reduce the cost of nutritional medium and make resulting micro-algal biomass more cater to the need from the animal nutrition viewpoint.Supplement and also can be used as selective marker with VitB1 biosynthesis pathway enzyme, this is can utilize because transgenosis is given the ability that culture plate/substratum is grown that does not contain VitB1.

In one embodiment, the former frustule of restructuring of the present invention further contains the allogenic gene of one or more coding VitB1 biosynthesis pathway enzymes.In another embodiment, the former frustule of restructuring of the present invention comprises for example, allogenic gene from the oxymethylpyrimidine phosphate synthase (SEQ ID NO:192) in algae, plant or cyanobacteria source of coding.In other embodiment again, the oxymethylpyrimidine phosphate synthase is by the THIC genes encoding.In other embodiment again, the THIC gene is glueballs algae (Coccomyxa) C-169THIC, Arabidopis thaliana (Arabidopsis thaliana) THIC, synechocystis PCC 6803 THIC or Salmonella enteritidis (Salmonella enterica subsp.enterica serovar Typhimuriumstr.) THIC (SEQ ID NO:193).Following examples describe in detail carries out engineered and makes it have the VitB1 prototrophy through over recovery the former algae UTEX1435 of mulberry fruit shape.

4. other selective marker

Can use any in the multiple choices mark for the transgenic constructs of microbial (as chlorella).The example of suitable selective marker comprises nitrate reductase gene, hygromycin phosphotransferase gene (HPT), neomycin phosphotransferase gene and ble gene (giving the phleomycin resistance).Measuring micro-algae knows the method for antibiotic susceptibility.For instance, Mol Gen Genet.1996 October 16; 252 (5): 572-9.

More particularly, Dawson etc. (1997), Current Microbiology35:356-362 (integral body is incorporated to this paper by reference) has described for NR defective type thermotolerance chlorella mutant and has used nitrate reductase (NR) gene from Chlorella vulgaris as selective marker.Kim etc. (2002), Mar.Biotechnol.4:63-73 (integral body is incorporated to this paper by reference) disclose use HPT gene as selective marker for oval chlorella is transformed.Huang etc. (2007), Appl.Microbiol.Biotechnol.72:197-205 (integral body is incorporated to this paper by reference) has reported for Chlorella DT kind and has used Sh ble as selective marker.

V. the lipid path is engineered

For example, except changing microorganism (micro-algae, oleaginous yeast, fungi or bacterium, as former algae) utilize beyond the ability of raw material (as the raw material that contains sucrose), the present invention also provides through for example modifying, so that the recombinant microorganism that the characteristic of the lipid of producing and/or ratio change (former algae).Can further or alternatively to this path, be modified, to change via the lipid in the lipid acid path and intermediate, be carried out enzymatic processing and characteristic and/or the ratio of the various lipid molecules that produce.In various embodiments, recombinant microorganism of the present invention (for example former frustule) with respect to it for example, through the lipid productive rate that can optimize per unit volume and/or time per unit the counterpart transformed, carbon chain lengths (for renewable diesel production or need the industrial chemical application of lipid feedstocks), make two keys or triple bond reduced number (optionally being reduced to zero), and the hydrogen that increases specific lipid material or different lipid colony: carbon ratio.In addition, the microorganism that produces desirable hydrocarbon can pass through the engineered described component with the generation higher amount or produce described component with larger specificity.

In the situation that micro-algae, some wild-type cells have had good growth characteristics, but do not produce the lipid of required type or amount.Example includes but not limited to mulberry fruit Trentepohlia, Phormidium, Ah lattice's Trentepohlia, blocks special Trentepohlia, Lepocinclis, mulberry fruit Trentepohlia, Nitzschia, Lepocinclis, necklace Trentepohlia, Euglena, Spirogyra, Chlorococcum, four Ceratiums, Oscillatoria, Phacus and green shuttle Trentepohlia, and they have the desirable growth characteristics that can grow in municipal effluent or waste water.The species of described cell and Chlorella, former Trentepohlia and other microorganism can through engineered and have obtain the improvement the lipid production feature.Required feature comprises the lipid productive rate of optimizing per unit volume and/or time per unit, carbon chain lengths (for example for production of biodiesel or need the industrial application of hydrocarbon feed), makes two keys or triple bond reduced number (optionally being reduced to zero), removes or eliminate ring and ring texture, and the hydrogen that increases specific lipid material or different lipid colony: carbon ratio.In addition, producing micro-algae of suitable hydrocarbon can also be through engineered and have an even more desirable hydrocarbon work output.The example of described micro-algae comprises the species of Chlorella and former Trentepohlia.

In specific embodiments, the tapping point of controlling in metabolism is upward or downward to synthetic one or more key enzymes that carry out of lipid acid, to promote lipid production.Can be for example raise the enhancer element that for example utilizes strong promoter and/or make to transcribe increase in described expression construct make the to encode genetic expression of target enzyme by realizing with the expression construct transformant.Described construct can comprise selective marker, can transformant being selected, makes the expression level increase of construct amplification and coded enzyme.The example that is suitable for the enzyme that the method according to this invention raises comprises pyruvic oxidase, and at pyruvic acid, to playing a role during acetyl-CoA transforms, (example that derives from some enzymes of micro-algae comprises gene pool accession number NP_415392 for it; AAA53047; Q1XDM1; And CAF05587).The rise of pyruvic oxidase can increase the generation of acetyl-CoA, thereby and to increase lipid acid synthetic.The initial step that acetyl-CoA carboxylase catalysis lipid acid is synthetic.Therefore, can make this kind of enzyme raise, with the generation that increases lipid acid, (example that derives from some enzymes of micro-algae comprises gene pool accession number BAA94752; AAA75528; AAA81471; YP_537052; YP_536879; NP_045833; And BAA57908).Can also increase the generation of lipid acid by raising acyl carrier protein (ACP), described ACP delivers the acyl chain increased between synthesis phase (example that derives from some ACP of micro-algae comprises gene pool accession number A0T0F8 at lipid acid; P51280; NP_849041; YP_874433).The rate-limiting step that GPAT catalysis lipid acid is synthetic.(example that derives from some enzymes of micro-algae comprises gene pool accession number AAA74319 to make this kind of enzyme raise the generation that can increase lipid acid; AAA33122; AAA37647; P44857; And ABO94442).

The rise of gene and/or downward can be applied to controlling global regulation's factor that fatty acid biological synthesizes the genetic expression of path.Therefore, one or more global regulation's factors during lipid acid is synthetic can be upward or downward in due course, to suppress respectively or to strengthen expression the final generation that increases lipid of multiple lipid acid synthetic gene.Example comprises that the sterol regulatory element is in conjunction with albumen (SREBP), as SREBP-1a and SREBP-1c (for example, referring to gene pool accession number NP_035610 and Q9WTN3).

The present invention also provides recombinant microorganism (for example former frustule), described microorganism has contained the allogenic gene of one or more coding lipid-modified enzymes through modifying, described lipid-modified enzyme for example, as fatty acyl group-ACP thioesterase (U.S. leaf eucalyptus (C.callophylla) (SEQ ID NO:145 and SEQ ID NO:146; Also referring to table 4)), fatty acyl group-coenzyme A/aldehyde reductase (referring to table 6), fatty acyl group-CoA-reductase (referring to table 7), alkanoic decarbonylation base enzyme (referring to table 8), alkanoic reductase enzyme, desaturase be (for example, as stearyl--ACP desaturase (codon is optimized common species castor-oil plant (R.communis) SAD, SEQ ID NO:147 and SEQ ID NO:148) and fatty acyl group desaturase and squalene synthase (referring to gene pool accession number AF205791).In some embodiments, the gene of the acyl carrier protein of coding fatty acyl group-ACP thioesterase and natural coexpression optionally is transformed in former frustule together with one or more genes of other lipid-modified enzyme of coding.In other embodiments, ACP and fatty acyl group-ACP thioesterase has avidity mutually, this both one be used from microorganism of the present invention and method in the time give advantage, with them, in particular organization or organism, whether natural coexpression is irrelevant.Therefore, the natural coexpression pair of these enzymes has been contained in the present invention, and has avidity and interact with each other to facilitate from those enzymes of ACP cracking length specificity carbochain.

In other embodiment again, one or more genes of other lipid-modified enzyme that the allogenic gene of coding desaturase is modified the lipid saturation ratio together with coding for example are transformed into, in microorganism (former frustule).In other embodiments, the endogenous delta 8 desaturase genes for example, is crossed in microorganism (former frustule) and expressed (for example, via the other copy of introducing described gene).For example stearyl--ACP desaturase is (referring to for example gene pool accession number AAF15308; ABM45911; And AAY86086) catalysis stearyl--ACP changes into oleoyl-ACP.This gene is raised can increase the ratio of the monounsaturated fatty acids of cell generation; And downward can reduce the ratio of cholesterol material.For purposes of illustration, stearyl--ACP desaturase (SAD) is responsible for by the synthetic C18:1 lipid acid of C18:0 precursor.Another desaturase family is fatty acyl group desaturase (FAD), comprises δ-12 fatty acid desaturase (Δ 12FAD).These desaturases are also modified the lipid saturation ratio.For purposes of illustration, δ-12 fatty acid desaturase is responsible for by the synthetic C18:2 lipid acid of C18:1 precursor.Equally, can control the expression of one or more glyceride desaturases to change the ratio of unsaturated fatty acids and saturated fatty acid, described desaturase such as ω-6-fatty acid desaturase, omega-3-fatty acid desaturase or ω-6-oleate desaturase.In some embodiments, can select desaturase for required carbon chain lengths, so that desaturase can be in the substrate of specifying carbon chain lengths or had in the substrate of the carbon chain lengths in stated limit and carry out the location specific modification.In another embodiment; if required lipid acid kenel is cholesterol grease (as C16:1 and/or C18:1), increase, can make so SAD cross to express or heterology SAD express combine make fatty acyl group desaturase (FAD) silence or inactivation (such as via sudden change, RNAi, knock out endogenous delta 8 desaturase genes etc.).

In other embodiments, microorganism (for example former frustule) has saltant type endogenous delta 8 desaturase genes through modifying, and wherein said sudden change makes described gene or desaturase non-activity.In some cases, described saltant type endogenous delta 8 desaturase genes is fatty acid desaturase (FAD).In other cases, described saltant type endogenous delta 8 desaturase genes is stearyl-acyl carrier protein desaturase (SAD).Following examples 11 have been described target and have been removed or knocked out stearyl--ACP desaturase and δ-12 fatty acid desaturase.

In some cases, one or more genetically engineered technology cooperations are favourable in order to obtain the transgenic cell that produces required lipid kenel.In one embodiment, microorganism (for example former frustule) comprises saltant type endogenous delta 8 desaturase genes and one or more allogenic genes.In non-limiting example, the former frustule with saltant type endogenous delta 8 desaturase genes can also be expressed ectogenous fat fatty acyl-acp thioesterase gene and/or invertase gene.Following examples 11 have been described endogenous SAD and through target, have been removed or knocked out and express the former frustule of transgenosis of camphor tree C14 type of priority thioesterase and invertase.In this case, the lipid kenel that the former frustule of described transgenosis produces is very approaching with the lipid kenel arrived seen in Tallow, beef.Tallow, beef stems from beef fat or the suet fat refined usually, is at room temperature solid and is used in the multiple application of food, makeup and chemical industry aspect.The lipid acid kenel of Tallow, beef is: C14:0 accounts for 4%; C16:0 accounts for 26%; C16:1 accounts for 3%; C18:0 accounts for 14%; C18:1 accounts for 41%; C18:2 accounts for 3%; And C18:3 accounts for 1%.As shown in following examples 11, endogenous SAD had removed or knocked out and express the former frustule of transgenosis of camphor tree C14 type of priority thioesterase clone through target has following lipid kenel: the shorter lipid acid of C12 and carbon chain lengths accounts for and is less than 1%; C14:0 accounts for 2.74% to 6.13%; C16:0 accounts for 23.07% to 25.69%; C18:0 accounts for 7.02% to 11.08%; C18:1 accounts for 42.03% to 51.21%; And C18:2 accounted for for 9.37% to 13.45% (meaning with the area percentage form).In some cases, the former frustule of transgenosis has following lipid kenel: C14:0 accounts for 3%-5%; C16:0 accounts for 25%-27%; C18:0 accounts for 10%-15%; And C18:1 accounts for 40%-45%.

Therefore; in specific embodiments; to microorganism of the present invention, carry out genetically engineered so that it expresses one or more allogenic genes, described allogenic gene is selected from the acyl carrier protein of fatty acyl-acp thioesterase, acyl group-coenzyme A/aldehyde reductase, fatty acyl group-CoA-reductase, alkanoic reductase enzyme, alkanoic decarbonylation base enzyme or natural coexpression.Suitable expression method is described in above about the expression of lipase gene, and described method especially comprises inducible expression and compartmentation expression.Fatty acyl group-ACP thioesterase during lipid synthesis from acyl carrier protein (ACP) cracking lipid acid.By further enzymatic processing, then the lipid acid of institute's cracking combine with coenzyme, to produce acyl group-coenzyme A molecule.This acyl group-coenzyme A is the substrate (generation aldehyde) of the enzymic activity of fatty acyl group-CoA-reductase and the substrate of fatty acyl group-coenzyme A/aldehyde reductase (producing alcohol).The aldehyde that the fatty acyl group of above identifying-CoA-reductase effect produces is further substrate (producing alcohol) or the substrate of the enzymic activity of alkanoic decarbonylation base enzyme (producing alkane or alkene) of the enzymic activity of alkanoic reductase enzyme.

In some embodiments, the lipid acid produced by method as herein described, glyceride or corresponding primary alconol, aldehyde, alkane or alkene contain 8,10,12 or 14 carbon atoms.The corresponding primary alconol, aldehyde, alkane and the alkene that are preferred for producing the lipid acid of diesel oil, biofuel, renewable diesel or rocket engine fuel or are applied in industry contain 8 to 14 carbon atoms.In certain embodiments, above-mentioned lipid acid and other corresponding hydrocarbon molecule are saturated (there is no carbon-to-carbon double bond or triple bond); Monounsaturated (single pair of key); Polyunsaturated (two or more pair of key); Straight chain (not being ring-type) or side chain.For fuel production, preferred larger saturation ratio.

Enzyme mentioned above has the specificity of the substrate of the carbon atom that selective hydrolysis contains given number.For instance, fatty acyl group-ACP thioesterase can have the lipid acid of 12 carbon atoms from the preferential cracking of ACP.In some embodiments, ACP and length specificity thioesterase have avidity mutually, make them be particularly suitable for using (for example exogenous ACP and thioesterase gene can in the particular organization that produces them or organism natural coexpression) with array configuration.Therefore; in various embodiments; the former frustule of restructuring of the present invention can contain allogenic gene; described allogenic gene coding have for contained carbon atom number katalaze enzyme in substrate active (for example from the ACP cracking lipid acid, acyl group-coenzyme A reductase is become to aldehyde or alcohol, or aldehyde is changed into to alkane) specific protein.In various embodiments, enzyme spcificity can be for having 8 to 34 carbon atoms, 8 to 18 carbon atoms preferably, and 8 substrates to 14 carbon atoms more preferably.Preferably specificity is for having the still less substrate of (12) rather than more (18) carbon atom.

Be applicable to other fatty acyl group in microorganism of the present invention and method-ACP thioesterase and include but not limited to list in the thioesterase in table 4.

Table 4. fatty acyl group-ACP thioesterase and gene pool accession number.

Following examples have been described from the spire calyx apart from flower, California bay, camphor tree, wetland calyx apart from flower, the lanceolata calyx is apart from the allos fatty acyl group of flower, Iris germanica, Semen Myristicae and white elm-successful target and the expression of ACP thioesterase in former Trentepohlia species.In addition, in the host cell of these allos fatty acyl group-ACP thioesterases of confirmation expression, the lipid acid kenel changes.Owing in general between algae thioesterase and higher plant thioesterase and between the former algae fatty acyl group of mulberry fruit shape-ACP thioesterase and allos fatty acyl group listed above-ACP thioesterase, lacking sequence identity, so these results are very unexpected.As shown in embodiment, these heterology thioesterase expression in former algae can produce the Transgenic Microalgae that can produce oils/lipid, oils/the lipid produced has in fact unique lipid acid kenel, described lipid acid kenel fails, by commercially available seed crop, even via blend multiple seed crop oils, to obtain at present.Table 5 has been showed the lipid acid kenel of common commercially available seed oils.Below the data of all commercially available seed oils all collect from American Pharmacopeia food and chemical code (USPharmacopeias Food and Chemicals Codes, 2010-2011 the 7th edition).The Tallow, beef data come from national research council: the lipid content of animal product and composition (National Research Council:Fat Content and Composition of AnimalProducts) (1976).

The lipid kenel (per-cent) of the commercially available seed oils of table 5..

For instance, there is no a kind of C8 that contains higher amount or C10 lipid acid in the middle of these common seed oils, wherein Oleum Cocois and palm-kernel oil are maximum sources, but the ratio that both have is 1: 1 (C8: C10 lipid acid).As shown in embodiment, the former algae transformed apart from flower C:8 type of priority thioesterase through the over-wet land calyx not only can reach the C8 fatty acid levels that surpasses 12%, and can also reach the approximately C8 of 5: 1: the C10 fatty acid rate.The change of fatty acid levels aspect can be for the production of the oils for multiple commercial applications that contains the tailored fatty acid kenel.In addition, the change of the ratio between different fatty acid chain lengths can not commercially obtain in the oils of not passing through further expensive chemical process (as esterification, distillation, fractionation and resterification).As another example, plam oil is the oils of the C16:0 lipid acid (32% to 47%) that contains high-content, but plam oil is hardly containing C14:0 lipid acid.The former algae that contains the white elm thioesterase reaches approximately 33% to 38% C16:0 lipid acid and about 10% to 16% C14:0 lipid acid (ratio of C16:0 and C14:0 is approximately 2: 1).This lipid acid kenel is to reach via the existing oils of blend on business level, and this is usually to contain less 14:0 lipid acid because be rich in the seed oils of 16:0 lipid acid.

Following examples have also been described at least two kinds of fatty acyl group-ACP thioesterase successful target and expression in a clone first.Determine the variation of lipid acid kenel in these clones and depend on which two kinds of thioesterase coexpression, in a clone, affects the lipid acid kenel in a different manner.For instance, from see in table 5, the C12 of Oleum Cocois and palm-kernel oil: the C14 ratio is about 3: 1.Described in following examples, the former algae transformant that contains two kinds of heterology thioesterase genes can produce the C12 that ratio is about 5: 1: the C14 fatty acid levels.This C12: up to the present the C14 fatty acid rate can not (via the blend seed oils) reach on business level.

Another novel aspect of the oils produced by Transgenic Microalgae is the saturation ratio of lipid acid.Plam oil is the largest source of saturated oil at present, wherein total saturate: unsaturated materials is 52%: 48%.As shown in following examples, have in the oils that the former algae from the heterology thioesterase of white elm and camphor tree produces at it and reach the total saturation ratio that surpasses 60%.Same as following examples as shown in, have in the oils that the former algae from the heterology thioesterase of white elm produces at it and reach the total saturation ratio over 86%.

Be applicable to the fatty acyl group-coenzyme A of microorganism of the present invention and method/aldehyde reductase and include but not limited to list in the enzyme in table 6.

Fatty acyl group-coenzyme A that table 6. is listed with the gene pool accession number/aldehyde reductase.

Fatty acyl group-the CoA-reductase that is applicable to microorganism of the present invention and method includes but not limited to list in the enzyme in table 7.

Fatty acyl group-CoA-reductase that table 7. is listed with the gene pool accession number.

The alkanoic decarbonylation base enzyme that is applicable to microorganism of the present invention and method includes but not limited to list in the enzyme in table 8.

The alkanoic decarbonylation base enzyme that table 8. is listed with the gene pool accession number.

The combination of the fatty acyl group of natural coexpression-ACP thioesterase and acyl carrier protein is applicable to microorganism of the present invention and method.

The other example of hydrocarbon or lipid-modified enzyme comprises aminoacid sequence contained in following any United States Patent (USP), the aminoacid sequence of quoting, or in following any United States Patent (USP) the aminoacid sequence of the contained or nucleic acid sequence encoding quoted: 6,610,527; 6,451,576; 6,429,014; 6,342,380; 6,265,639; 6,194,185; 6,114,160; 6,083,731; 6,043,072; 5,994,114; 5,891,697; 5,871,988; 6,265,639, and be further described in following gene pool accession number: AAO18435; ZP_00513891; Q38710; AAK60613; AAK60610; AAK60611; NP_113747; CAB75874; AAK60612; AAF20201; BAA11024; AF205791; And CAA03710.

Other enzyme in the lipid biosynthesis pathway also is applicable to microorganism of the present invention and method.For instance, ketone acyl-acp synthase (Kas) together with some above listed enzyme in the lipid biosynthesis pathway, work.Have different classes of Kas enzyme: Kas I participates in the continuous condensating step between ever-increasing acyl group ACP chain and malonyl-ACP.Kas II participates in being produced by C16:0-ACP the final condensation step of the C18:0-ACP that is incorporated to malonyl-ACP usually.Thereby, the higher plant and of main synthetic C16-C18:0 lipid acid (and their unsaturated derivative) slightly in algae species/algae strain, Kas II enzyme and FatA gene product (fatty acyl-acp thioesterase) interaction.

Fatty acyl-acp thioesterase is higher plant (and algae species) the slightly synthetic termination thing of fatty acid biological; and in the majority of plant species; this is that member by the FatA gene family carries out, and described member's effect is to make to extend the stage that C16:0 transforms to C18:0 that ends at.In the species (as sepal distance flower spp (Cuphea), oil palm belong to (Elaeis), nux moschata (Myristica) or California bay, belonging to (Umbellularia)) of synthetic short chain fatty acid; a different set of fatty acyl-acp thioesterase by the FatB genes encoding carries out this termination step (coding region of optimizing referring to the codon of for example coconut palm (Cocos nucifera) FatB3-B, SEQID NO:189).It is important that interaction between Kas II enzyme and acyl group-Acp thioesterase extends for correct termination fatty acid chain.Therefore, at the FatB gene, through evolving, in can carrying out the biosynthetic higher plant species of short chain lipid (and micro-algae species), corresponding coevolution appears in the Kas gene of the another kind of Kas of being called IV gene.Kas IV gene is responsible for that the chain length of lipid acid is extended in certain size range (length of 4-14 carbon).

Other enzyme that is applicable to microorganism of the present invention and method comprise there is at least 70% amino acid consistence with a kind of protein listed in table 4,6-8 and represent corresponding required enzymic activity (for example from the acyl carrier protein cracking lipid acid, by acyl group-coenzyme A reductase become aldehyde alcohol or aldehyde is changed into to alkane) enzyme.In other embodiments, with an above-mentioned sequence, have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or have enzymic activity at least about 99% conforming sequence, all these sequences are incorporated to this paper by reference at this, as they are fully set forth.

The required combination of allogenic gene to be expressed is arranged by selection, can the special product by microorganisms, then described product can be extracted out from the water-based biomass.For instance, described microorganism can contain: (i) allogenic gene of coding fatty acyl group-ACP thioesterase; And the acyl carrier protein (or contrary) that optionally contains the acyl carrier protein of (ii) natural coexpression or otherwise for fatty acyl group-ACP thioesterase, there is avidity; And the allogenic gene that optionally contains (iii) coding fatty acyl group-coenzyme A/aldehyde reductase or fatty acyl group-CoA-reductase; And the allogenic gene that optionally contains (iv) coding alkanoic reductase enzyme or alkanoic decarbonylation base enzyme.Under culture condition as herein described, the synthetic lipid acid be connected with ACP of described microorganism, and fatty acyl group-ACP thioesterase catalysis lipid acid from the ACP cracking, to produce fatty acyl group-coenzyme A molecule by further enzymatic processing.Fatty acyl group-coenzyme A/aldehyde reductase catalyzing acyl-coenzyme A reductase when existing becomes alcohol.Equally, fatty acyl group-CoA-reductase catalyzing acyl-coenzyme A reductase when existing becomes aldehyde.At the allogenic gene that has coding fatty acyl group-CoA-reductase and make during it expresses to produce those embodiments of aldehyde product, by the alkanoic reductase enzyme catalysis aldehyde of the 3rd allogenic gene coding, be reduced into alcohol.Equally, alkanoic decarbonylation base enzyme catalysis aldehyde when existing changes into alkane or alkene.

In another embodiment, microorganism can contain: (i) allogenic gene of coding fatty acyl group-ACP thioesterase; (ii) optionally contain the acyl carrier protein of natural coexpression or there is the acyl carrier protein of avidity for fatty acid acyl-ACP thioesterase; (iii) saltant type endogenous delta 8 desaturase genes, wherein said sudden change makes delta 8 desaturase genes or desaturase albumen non-activity, as desaturase knocks out; (iv) endogenous stearyl-acyl carrier protein desaturase is crossed and is expressed or heterology SAD expression; And (v) above-mentioned any combination.

Can produce in a large number the gene that obtains encoding such enzymes (as fatty acyl group-ACP thioesterase) seviparous cell (as original chlorella) from known.For example, the known gene played a role (coding makes the gene of the enzyme that two keys are saturated) individually can be transformed into to recipient cell in lipid produces in.Yet, in order to carry out the present invention, do not need needed gene is supposed in advance.For the identification of the method that can change the gene that in (improvement) micro-algae, lipid produces, be described in PCT publication No. 2008/151149.

Therefore, for example the invention provides, through genetically engineered and express the microorganism (former frustule) of lipid pathway enzyme, the expression level of described lipid pathway enzyme is compared and is changed with the wild-type cell of same species.In some cases, when two kinds of cells are grown under the same conditions, described cell is compared with wild-type cell and can be produced more lipid.In some cases, cell is carried out genetically engineered and/or selects so that it is with the horizontal expression lipid pathway enzyme higher than wild-type cell.In some cases, the lipid pathway enzyme selects the group that free pyruvic oxidase, acetyl-CoA carboxylase, acyl carrier protein and GPAT form.In some cases, cell is carried out genetically engineered and/or selects so that it is with the horizontal expression lipid pathway enzyme lower than wild-type cell.In cell is expressed at least one embodiment of lipid pathway enzyme with lower level, described lipid pathway enzyme comprises Oxalacetic transacetase.

In some embodiments, cell is carried out genetically engineered and/or selects so that it expresses the global regulation factor of lipid acid in synthetic, the expression level of the described global regulation factor is compared and is changed with wild-type cell, and the expression level of multiple whereby lipid acid synthetic gene is compared and changed with wild-type cell.In some cases, the lipid pathway enzyme comprises the enzyme that lipid acid is modified.In some cases, the lipid pathway enzyme is selected from stearyl--ACP desaturase and glyceride desaturase.In some cases, cell is carried out genetically engineered and/or selects so that it is expressed the lipid pathway enzyme of lower level or does not express specific lipid pathway enzyme (wherein the lipid pathway enzyme has been knocked or has been replaced by allogenic gene) fully.

One slightly algae produce a large amount of non-lipid metabolism things, as polysaccharide.Due to polysaccharide biosynthesizing meeting utilization can be in the total metabolism energy that cell obtains the remarkable energy of ratio, so being produced to cell, lipid carries out mutagenesis, then produce and reduce or eliminate to be screened for polysaccharide, thereby produce the novel algae strain that can produce higher lipid productive rate.

In other embodiments; the present invention relates to the oleaginous microorganism that contains one or more allogenic genes, the protein in the group that wherein said allogenic gene coding selects free fatty acyl group-ACP thioesterase, fatty acyl group-CoA-reductase, alkanoic reductase enzyme, fatty acyl group-coenzyme A/aldehyde reductase, alkanoic decarbonylation base enzyme, desaturase and acyl carrier protein to form.In another embodiment, the endogenous delta 8 desaturase genes is crossed and is expressed in one or more the microorganism contained in above-mentioned allogenic gene.In one embodiment, allogenic gene is operatively connected with the promotor that can be induced in response to stimulator maybe can be thwarted.In some cases, the free group of restriction nitrogen or nonnitrogenous composition in the exogenous small molecules provided, heat, cold and substratum of described stimulator choosing.In some cases, allogenic gene is expressed in cellular compartment.In some embodiments, cellular compartment selects the group that free chloroplast(id), plastid and plastosome form.In some embodiments, described microorganism is the former algae of mulberry fruit shape, the former algae of Krueger Buddhist nun, the stagnant former algae of harmony or the former algae of Rao Shi.

In one embodiment, allogenic gene coding fatty acid acyl-ACP thioesterase.In some cases, the thioesterase catalysis by the allogenic gene coding has 8 lipid acid to 18 carbon from acyl carrier protein (ACP) cracking.In some cases, the thioesterase catalysis by the allogenic gene coding has 10 lipid acid to 14 carbon from the ACP cracking.In one embodiment, the thioesterase catalysis by the allogenic gene coding has the lipid acid of 12 carbon from the ACP cracking.

In one embodiment, allogenic gene coding fatty acyl group-coenzyme A/aldehyde reductase.The reductase enzyme catalysis of being encoded by allogenic gene in some cases, has 8 fatty acyl group-coenzyme A reductases to 18 carbon and becomes corresponding primary alconol.The reductase enzyme catalysis of being encoded by allogenic gene in some cases, has 10 fatty acyl group-coenzyme A reductases to 14 carbon and becomes corresponding primary alconol.Fatty acyl group-coenzyme A reductase that the reductase enzyme catalysis of being encoded by allogenic gene in one embodiment, has 12 carbon becomes lauryl alcohol.

The present invention also provides the restructuring that contains two kinds of allogenic genes former frustule; protein in the group that wherein first allogenic gene coding fatty acyl group-ACP thioesterase, and the second allogenic gene coding selects free fatty acyl group-CoA-reductase, fatty acyl group-coenzyme A/aldehyde reductase and acyl carrier protein to form.In some cases, two kinds of allogenic genes all with in response to stimulator can derivative promotor be operatively connected separately.In some cases, each promotor all can be induced in response to identical stimulator, and described stimulator is such as restriction nitrogen or nonnitrogenous in substratum.Limiting nitrogen in substratum or lacking nitrogen fully to stimulate some microorganisms (such as former Trentepohlia species) to produce oils, and can be used as releaser to induce high-caliber oils production.When using with genetically engineered Combination of Methods disclosed herein, can impel lipid (to account for the per-cent of dry cell weight) to reach high level, such as at least 30%, at least 40%, at least 50%, at least 60%, at least 70% and at least 75%; Method disclosed herein makes the lipid in cell reach these levels, and wherein said lipid is 1%-5% at least, preferably at least 4% C8-C14; 0.25%-1% at least, preferably at least 0.3% C8; 1%-5% at least, preferably at least 2% C10; 1%-5% at least, preferably at least 2% C12; And 1%-5% at least, preferably at least 2% C14.In some embodiments, cell contains in dry cell weight and surpasses 10%, surpasses 15%, surpasses 20% or to surpass 25% lipid and contained lipid be at least 5%, at least 10% or at least 15% C8-C14; At least 10%, at least 15%, at least 20%, at least 25% or at least 30% C8-C14; At least 20%, at least 25%, at least 30%, at least 35% or at least 40% C8-C14; 5%-40%, the preferably C8-C14 of 10%-30%; And 10%-40%, the preferably C8-C14 of 20%-30%.

Novel oils disclosed herein is different from the naturally occurring oils (such as plam oil, palm-kernel oil and Oleum Cocois) that other is rich in medium chain fatty acid.For instance, in plam oil and palm-kernel oil the level of pollutent (such as carotenoid) far away higher than oils of the present invention.The amount of the alpha-carotene that plam oil and palm-kernel oil are contained and β-carotene and Lyeopene is especially far away higher than oils of the present invention.In addition, found to surpass 20 kinds of different carotenoid in plam oil and palm-kernel oil, and embodiment shows that carotenoid kind that oils of the present invention contains is few and level is very low.In addition, in plam oil, palm-kernel oil and Oleum Cocois the level of vitamin-E compound (such as tocotrienols) far away higher than oils of the present invention.

In one embodiment, the thioesterase catalysis by the first allogenic gene coding has 8 lipid acid to 18 carbon from the ACP cracking.In some embodiments, second allogenic gene coding fatty acyl group-coenzyme A/aldehyde reductase, its catalysis has 8 fatty acyl group-coenzyme A reductases to 18 carbon and becomes corresponding primary alconol.In some cases; thioesterase catalysis by the first allogenic gene coding has 10 lipid acid to 14 carbon from the ACP cracking; and the reductase enzyme catalysis of being encoded by the second allogenic gene has 10 fatty acyl group-coenzyme A reductases to 14 carbon and becomes corresponding primary alconol, and wherein thioesterase and reductase enzyme act on identical carbon chain lengths.In one embodiment, by the thioesterase catalysis of the first allogenic gene coding, there is the lipid acid of 12 carbon from the ACP cracking, and become lauryl alcohol by fatty acyl group-coenzyme A reductase that the reductase enzyme catalysis of the second allogenic gene coding has 12 carbon.In some embodiments, second allogenic gene coding fatty acyl group-CoA-reductase, its catalysis has 8 fatty acyl group-coenzyme A reductases to 18 carbon and becomes corresponding aldehyde.In some embodiments, the acyl carrier protein of the second allogenic gene coding and fatty acyl group-natural coexpression of ACP thioesterase.

In some embodiments, second allogenic gene coding fatty acyl group-CoA-reductase, and microorganism further contains the 3rd allogenic gene of coding alkanoic decarbonylation base enzyme.In some cases; thioesterase catalysis by the first allogenic gene coding has 8 lipid acid to 18 carbon from the ACP cracking; the reductase enzyme catalysis of being encoded by the second allogenic gene has 8 fatty acyl group-coenzyme A reductases to 18 carbon and becomes corresponding alkanoic; and the decarbonylation base enzyme catalysis of being encoded by the 3rd allogenic gene has 8 alkanoics to 18 carbon and changes into corresponding alkane, and wherein thioesterase, reductase enzyme and decarbonylation base enzyme act on identical carbon chain lengths.

In some embodiments; the second allogenic gene coding acyl carrier protein; and microorganism further contains the 3rd allogenic gene, the protein in the group that its coding selects free fatty acyl group-CoA-reductase and fatty acyl group-coenzyme A/aldehyde reductase to form.In some cases, the 3rd allogenic gene coding fatty acyl group-CoA-reductase, and microorganism further contains the 4th allogenic gene of coding alkanoic decarbonylation base enzyme.

The present invention also provides the pure method of producing, it is included in substratum cultivates recombinant microorganism (for example former frustule) colony, wherein said cell contains: (i) the first allogenic gene of coding fatty acyl group-ACP thioesterase and (ii) the second allogenic gene of coding fatty acyl group-coenzyme A/aldehyde reductase, and the synthetic lipid acid be connected with acyl carrier protein (ACP) of described cell, fatty acyl group-ACP thioesterase catalysis lipid acid from the ACP cracking, by further processing, to produce fatty acyl group-coenzyme A, and fatty acyl group-coenzyme A/aldehyde reductase catalyzing acyl-coenzyme A reductase becomes alcohol.

The present invention also provides the method for for example, producing lipid molecule in microorganism (former frustule).In one embodiment; the method is included in the former frustule of cultivation colony in substratum; wherein said cell contains: (i) the first allogenic gene of coding fatty acyl group-ACP thioesterase and (ii) the second allogenic gene of coding fatty acyl group-CoA-reductase; and the synthetic lipid acid be connected with acyl carrier protein (ACP) of wherein said microorganism; fatty acyl group-ACP thioesterase catalysis lipid acid from the ACP cracking; by further processing, to produce fatty acyl group-coenzyme A, and fatty acyl group-CoA-reductase catalyzing acyl-coenzyme A reductase becomes aldehyde.

The present invention also provides and for example, produced the method with the fatty acid molecule of specifying carbon chain lengths in microorganism (former frustule).In one embodiment; the method is included in substratum cultivates lipid and produces former frustule colony; the allogenic gene that wherein said microorganism contains coding fatty acyl group-ACP thioesterase; described fatty acyl group-ACP thioesterase specificity or preferentially a certain carbon chain lengths (such as 8,10,12 or 14 carbon atoms) is had to activity; and the synthetic lipid acid be connected with acyl carrier protein (ACP) of wherein said microorganism; and, when lipid acid is synthesized when having the particular carbon chain length, thioesterase catalysis is lipid acid from the ACP cracking.

In above-mentioned various embodiments, microorganism (for example former frustule) can contain at least one allogenic gene of coding lipid pathway enzyme.In some cases, the lipid pathway enzyme selects the group that free stearyl--ACP desaturase, glyceride desaturase, pyruvic oxidase, acetyl-CoA carboxylase, acyl carrier protein and GPAT form.In other cases; microorganism (for example former frustule) contains lipid-modified enzyme, the group that it selects free fatty acyl group-ACP thioesterase, fatty acyl group-coenzyme A/aldehyde reductase, fatty acyl group-CoA-reductase, alkanoic reductase enzyme, alkanoic decarbonylation base enzyme and/or acyl carrier protein to form.

Be presented in embodiment for expressing multiple lipid pathway enzyme that this paper discusses and many exemplary conversion box or the construct of lipid-modified enzyme.Other useful construct is listed in but is not limited in following table 37.

Coding region and enzyme that the exemplary transformation construct of table 37., codon are optimized.

VI. fuels and chemicals production

For according to the inventive method, carrying out fuel production, by any suitable means, obtain or otherwise collect the lipid produced by cell of the present invention.Can separate lipid by full cell extraction.At first make cell rupture, then can be such as by utilize centrifugal lipid and the extracellular hydrocarbon be connected with cytolemma/cell walls in cell of isolating as described above from cellular material.In some embodiments, make microbial cell dissolve the rear lipid within endothelial cells produced in microorganism of extracting.After extraction, lipid is further refined, to produce oils, fuel or grease chemical article.

After completing cultivation, can be from fermented liquid separate microorganism.Optionally by centrifugal realization, separate, produce concentrated mashed prod.Centrifugally can not from microorganism, remove a large amount of ICWs, and not be drying step.Then optionally use washing soln (for example deionized water) to be washed biomass, to remove fermented liquid and fragment.Optionally can also before cell rupture, make the microbial biomass dry (oven dry, freeze-drying etc.) through washing.Perhaps, when fermentation completes, cell is without from some or all of fermented liquids, separating and just can be dissolved.For instance, when dissolved cell, the v of cell and extracellular liquid: the v ratio can be less than 1: 1.

Can make the biosolubilization that contains lipid, produce molten born of the same parents' thing.As described in detail as this paper, can complete microbivorous step (also referred to as cytolysis) by any suitable means, comprise thermoinducible dissolving, add alkali, add acid, utilize enzyme (as proteolytic enzyme and polysaccharide degrading enzyme (as amylase)), use ultrasonic wave, mechanical lysis, utilize osmotic shock, infect and/or express one or more with lytic virus and dissolve gene.Dissolved to discharge by molecule in the cell of microorganisms.Can be used as single method for each of microbivorous these methods and use, or simultaneously or be used in combination successively.The degree that can come observation of cell to break by microscopical analysis.Utilize one or more methods as herein described, usually can observe the cell rupture that surpasses 70%.Cell rupture preferably surpasses 80%, more preferably surpasses 90% and most preferably from about 100%.

In specific embodiments, microorganism is dissolved after growth, for example with increase cytolipin and/or hydrocarbon be exposed to extracted or further processing.Can adjust lipase expression (for example passing through inducible promoter) or cytolytic opportunity to optimize the productive rate of lipid and/or hydrocarbon.Multiple dissolving technology is described below.These technology can individually be used or be used in combination.

In one embodiment of the invention, microbivorous step comprises and being heated containing microbial cell suspension.In this embodiment, the fermented liquid that contains microorganism (or from fermented liquid isolated microbial suspension) is heated until microorganism (being microbial cell wall and cytolemma) degraded or decompose.Normally at least 50 ℃ of the temperature of using.Use comparatively high temps so that cytolysis is more efficient, such as at least 30 ℃, at least 60 ℃, at least 70 ℃, at least 80 ℃, at least 90 ℃, at least 100 ℃, at least 110 ℃, at least 120 ℃, at least 130 ℃ or higher temperature.Can be by boiling microorganism by thermal treatment, cell is dissolved.Perhaps, can in autoclave, heat-treat (not boiling).Can be by cooling through heat treated molten born of the same parents' thing, with for further processing.Can also make cell rupture by steam treatment (by adding steam under pressure).Make the steam treatment that microalgae cell breaks be described in for example United States Patent (USP) the 6th, in 750, No. 048.In some embodiments, can and make fermented liquid in temperature required lower maintenance approximately in 90 minutes by uperize in fermentor tank, preferably approximately in 60 minutes, and more preferably from about 30 minutes with the interior steam treatment of carrying out.

In another embodiment of the invention, microbivorous step comprises to containing in microbial cell suspension and adds alkali.Described alkali should be enough strong, so that the hydrolysis of at least a portion protein compound of microorganism used therefor.It is known being applicable to proteolytic alkali in chemical field.Oxyhydroxide, carbonate and the supercarbonate that includes but not limited to lithium, sodium, potassium, calcium for the exemplary alkali of the inventive method with and composition thereof.Preferred alkali is KOH.Make the alkaline purification that microalgae cell breaks be described in for example United States Patent (USP) the 6th, in 750, No. 048.

In another embodiment of the invention, microbivorous step comprises to containing in microbial cell suspension and adds acid.Can utilize concentration for 10mN-500mN or the preferably acid realization acid dissolving of 40nM-160nM.Preferably at the temperature higher than room temperature, (for example 40 ℃-160 ℃, and preferably the temperature of 50 ℃-130 ℃) carry out acid and dissolve.For example, for moderate temperature (room temperature to 100 ℃, and especially room temperature to 65 ℃), acid treatment can be used with sonic treatment or other cell rupture Combination of Methods.

In another embodiment of the invention, microbivorous step comprises utilizes enzyme to make biosolubilization.Being preferred for microbivorous enzyme is proteolytic enzyme and polysaccharide degrading enzyme, such as hemicellulase (for example, from the hemicellulase of aspergillus niger; Sigma Aldrich, St.Louis, MO; Numbering H2125), the polygalacturonase (polygalacturonase that for example comes from Rhizopus (Rhizopus sp.); Sigma Aldrich, St.Louis, MO; Numbering P2401), magic prestige enzyme (Mannaway) 4.0L (Novozymes), the cellulase (cellulase that for example comes from viride (Trichoderma viride); Sigma Aldrich, St.Louis, MO; Number C9422) and the driselase (driselase that for example comes from Basidiomycotina (Basidiomycetes sp.); Sigma Aldrich, St.Louis, MO; Numbering D9515).

In other embodiments of the present invention, utilize enzyme to complete dissolving, described enzyme such as cellulase (such as the polysaccharide degrading enzyme that optionally comes from chlorella or chlorella virus), or proteolytic enzyme is (such as streptomyces griseus (Streptomyces griseus) proteolytic enzyme, Quimotrase, Proteinase K, list in Degradation of Polylactide by Commercial Proteases, Oda Y etc., Journal of Polymers and the Environment, the 8th volume, the 1st phase, in January, 2000, proteolytic enzyme in 29-32 page (4), alkalescence enzyme 2.4FG (Novozymes) and flavor protease (Flavourzyme) 100L (Novozymes)).Can also use any combination of proteolytic enzyme and polysaccharide degrading enzyme, comprise any combination of above-mentioned proteolytic enzyme and polysaccharide degrading enzyme.

In another embodiment, can utilize squeezing machine to be dissolved.In this method, under high pressure force biomass by a kind of screw type devices, so that cytolysis lipid within endothelial cells is discharged and separate with fiber (and other component) with the albumen in cell.

In another embodiment of the invention, by utilizing ultrasonic wave (being sonic treatment), carry out microbivorous step.Therefore, can also utilize high frequency sound wave dissolved cell.Sound wave can the electronics mode produce, and is passed to through in suitably concentrated cell suspending liquid by metal tip.This sonic treatment (or supersound process) is destroyed the integrity of cell based in cell suspending liquid, producing bubble.

In another embodiment of the invention, by mechanical lysis, carry out microbivorous step.Dissolved cell mechanically, and optionally homogenized, for example, to facilitate hydrocarbon (lipid), collect.For instance, can will contain the slurry pumping of cell by restricted orifice valve by the working pressure destroyer.Apply high pressure (up to 1500 bar), then diffuse through immediately discharge nozzle.Complete cell rupture by three kinds of different mechanism: pressure descends suddenly to the high liquid shear power of the impact of valve, damper hole and while discharging, and this makes the cell explosion.Described method discharges molecule in cell.Perhaps, can use ball mill.In ball mill, with little abrasive grains (such as bead), stir cell in suspension.Cell breaks because of the grinding between shearing force, bead and with the bead collision.Bead makes cell rupture with the release cells content.Can also make cell rupture by shearing force, such as by means of blend (such as by high-speed or Wei Lin Shi blender (Waring blender)), French press (french press), or the centrifugal cell rupture that makes of use when cell walls is fragile even.

In another embodiment of the invention, by using osmotic shock, carry out microbivorous step.

In another embodiment of the invention, microbivorous step comprises uses the lytic virus microbial infection.Known multiple virus can be used for dissolving and is applicable to the microorganism in the present invention, and, for specific microorganism, selects and utilize specific lytic virus in the state of the art of this area.For instance, Paramecium bursaria (paramecium bursaria) chlorella virus (PBCV-1) is large-scale icosahedron spotting double-stranded DNA virus class (algae DNA virus section (Phycodnaviridae), Chlorovirus (Chlorovirus)) prototype, these viruses can copy and make described green alga to dissolve in some unicellular eucaryon chlorella sample green alga.Therefore, can infect micro-algae that culture dissolves any susceptible by the chlorella virus with suitable.The method that infects the Chlorella species with chlorella virus is known.Referring to for example Adv.Virus Res.2006; 66:293-336; Virology, on April 25th, 1999; 257 (1): 15-23; Virology, on January 5th, 2004; 318 (1): 214-23; Nucleic Acids Symp.Ser.2000; (44): 161-2; J.Virol.2006 March; 80 (5): 2437-44; And Annu.Rev.Microbiol.1999; 53:447-94.

In another embodiment of the invention, microbivorous step comprises self-dissolving.In this embodiment, microorganism according to the present invention is through genetically engineered, to produce microbivorous soluble protein.Can utilize inducible promoter to make to dissolve genetic expression so that at first cell can grow to desirable density in fermentor tank, subsequently evoked promoter so that dissolve genetic expression dissolved cell.In one embodiment, dissolve the genes encoding polysaccharide degrading enzyme.At some, in other embodiment, dissolving gene is the gene that derives from lytic virus.Therefore, for example can make the dissolving gene that derives from chlorella virus express in alga cells, referring to Virology 260,308-315 (1999); FEMS Microbiology Letters180 (1999) 45-53; Virology 263,376-387 (1999); And Virology 230,361-368 (1997).Preferably utilize inducible promoter to make to dissolve genetic expression, described inducible promoter is such as the promotor that has activity and can be induced by stimulator (such as micromolecular existence, light, heat and other stimulator) in micro-algae.

Can make in all sorts of ways lipid is separated from the molten born of the same parents' thing of cell produced by aforesaid method.For instance, can use hydrophobic solvent (such as hexane) to extract lipid and lipid derivate, such as alkanoic, fatty alcohol and hydrocarbon (such as alkane) (referring to Frenz etc., 1989, Enzyme Microb.Technol., 11:717).Can also utilize liquefaction (referring to such as Sawayama etc., 1999, Biomass and Bioenergy 17:33-39 and Inoue etc., 1993, Biomass Bioenergy 6 (4): 269-274); (referring to such as Minowa etc., 1995, Fuel 74 (12): 1735-1738) for oils liquefaction; And supercritical CO ₂extraction method (referring to such as Mendes etc., 2003, Inorganica Chimica Acta 356:328-334) is extracted lipid and lipid derivate.Miao and Wu have described the scheme that reclaims micro-algae lipid from original chlorella culture, wherein, by centrifugal collecting cell, with distilled water wash and by lyophilize, make its drying.Grind resulting cell powder in mortar, then extracted with normal hexane.Miao and Wu, Biosource Technology (2006) 97:841-846.

Therefore, can be by be extracted to reclaim lipid, lipid derivate and the hydrocarbon by microorganisms of the present invention with organic solvent.In some cases, preferred organic solvent is hexane.Usually organic solvent directly joined in molten born of the same parents' thing and do not need to divide in advance exsolution born of the same parents thing component.In one embodiment, make to contact for some time and be enough to make lipid and/or hydrocarbon component and organic solvent to form solution with organic solvent by molten born of the same parents' thing of above-mentioned one or more methods generations.In some cases, then can further refine solution, to reclaim specific required lipid or hydrocarbon component.The hexane extraction method is known in the art.

Can utilize one or more enzymes (comprising lipase) as described above to be modified the lipid and the lipid derivate (such as alkanoic, fatty alcohol and hydrocarbon (such as alkane)) that are produced by cell as herein described.In the time of in the extracellular environment of hydrocarbon in cell, can under certain condition one or more enzymes be joined in this environment, in described certain condition, enzyme can be modified hydrocarbon, or is completed by the hydrocarbon precursor that it is synthetic.Perhaps, adding one or more catalyzer (such as enzyme) before, hydrocarbon partially or even wholly can be isolated from cellular material.Described catalyzer is exogenous adding, and their activity is present in extracellular or external.

Therefore, can be optionally by conventional means to as herein described that produced in vivo by cell or further process through lipid and the hydrocarbon of external enzymatically modifying.Described processing can comprise that " cracking " is with reduced-size, thereby increases the hydrogen of hydrocarbon molecule: carbon ratio.Conventional catalysis and the method for thermal cracking of using in hydrocarbon and the processing of triglyceride level oils.Catalysis process comprises and utilizes catalyzer, as solid acid catalyst.Catalyzer can be silica-alumina or zeolite, and it causes C-C generation heterolytic fission or asymmetric fracture, produces carbocation and hydride ion.These reactive intermediates then reset or with another kind of hydrocarbon generation hydride transfer.Therefore described reaction makes intermediate regeneration, produces growing chain mechanism voluntarily.Can also be processed so that the reduced number of carbon-to-carbon double bond or triple bond wherein optionally is reduced to zero hydrocarbon.Can also be processed hydrocarbon, to remove or to eliminate ring or ring texture wherein.Can also be processed hydrocarbon, to increase hydrogen: carbon ratio.This comprises and adds hydrogen (" hydrogenation ") and/or make hydrocarbon " cracking " become less hydrocarbon.

Thermology method comprises and utilizes high temperature and high pressure, with the size of reduction hydrocarbon.Can use the approximately high temperature of 800 ℃ and the high pressure of about 700kPa.These conditions produce " gently " hydrocarbon, and this term is used in reference to the hydrocarbon molecule (different from photon flux) that is rich in hydrogen sometimes, and these conditions can also produce the larger hydrocarbon molecule that hydrogen richness reduces relatively by condensation.Described method provides homolysis or symmetrical fracture and generation alkene, and described alkene optionally can be saturated through enzymatic as described above.

Catalysis process and thermology method are the standard methods of carrying out hydrocarbon processing and oils refinement in plant.Therefore, can be collected and be processed or be refined the hydrocarbon produced by cell as herein described by conventional means.The report that carries out hydrocracking about the hydrocarbon that micro-algae is produced, referring to (Biotechnology and Bioengineering, XXIV volumes: 193-205 (1982)) such as Hillen.In alternate embodiment, by another kind of catalyst treatment component, described catalyzer is as organic compound, heat and/or mineral compound.For lipid is processed into to biofuel, as hereinafter described the use transesterification method in this part.

The hydrocarbon produced by method of the present invention can be for multiple industrial application.For instance, the production utilization of linear alkylbenzene sulfonate (LAS) (a kind of for the sanitising agent of nearly all type and the anion surfactant of clean prepared product) generally comprises the hydrocarbon of the chain with 10-14 carbon atoms.Referring to for example United States Patent (USP) the 6th, 946, No. 430, the 5th, 506, No. 201, the 6th, 692, No. 730, the 6th, 268, No. 517, the 6th, 020, No. 509, the 6th, 140, No. 302, the 5th, 080, No. 848 and the 5th, 567, No. 359.Tensio-active agent (as LAS) can be for the production of personal care composition and sanitising agent, composition and sanitising agent described in following United States Patent (USP): the 5th, and 942, No. 479, the 6th, 086, No. 903, the 5th, 833, No. 999, the 6th, 468, No. 955 and the 6th, 407, No. 044.

Owing to can obtaining recyclable organism initial substance and its purposes that can replace the initial substance that is derived from fossil oil, be desirable, so growing interest is to the purposes of hydrocarbon component in fuel (as biofuel, renewable diesel and rocket engine fuel) of biogenetic derivation.In the urgent need to produced the method for hydrocarbon component by biomaterial.The present invention has met this needs, and it is to utilize the lipid that produced by method as herein described to produce thing diesel oil, renewable diesel and rocket engine fuel next life as biomaterial to realize with the method for production biofuel, renewable diesel and rocket engine fuel by providing.

Traditional diesel oil fuel is the petroleum distillate that is rich in paraffinic hydrocarbon.They have the wide boiling spread of 370 ℉ to 780 ℉, are applicable to burning in self-igniton engine (as diesel-engine vehicles).U.S.'s test has been set up the diesel oil rank with materialogy meeting (American Society of Testing and Materials, ASTM) according to the tolerable limit of boiling spread and other fuel characteristic (as cetane value, cloud point, burning-point, viscosity, aniline point, sulphur content, water-content, ash content, copper strip corrosion degree and breeze).Meet suitable ASTM standard and derive from biomass or any hydrocarbon overhead product material of other material academicly can be defined as diesel oil fuel (ASTM D975), rocket engine fuel (ASTM D1655), or biofuel (ASTMD6751) (if it is fatty acid methyl ester).

After extraction, can carry out chemical treatment to the lipid and/or the hydrocarbon component that reclaim from microbial biomass as herein described, to produce the fuel for diesel vehicle and jet engine.

Biofuel is the liquid that a kind of color changes between gold and dark-brown, and this depends on raw materials for production.It in fact with the water unmixing, there is high boiling point and low-vapor pressure.Biofuel refers to the fabricate fuel be equal to diesel oil, can be for diesel-engine vehicles.Biofuel is biodegradable and nontoxic.The other benefit that biofuel is better than conventional diesel oil fuel is that engine scuffing is lower.Biofuel comprises the C14-C18 alkyl ester usually.The whole bag of tricks makes the biomass of generation as described herein separation or lipid change into diesel oil fuel.The preferred method of production biofuel is by lipid as herein described is carried out to transesterification.Preferred alkyl ester as biofuel is methyl esters or ethyl ester.

The biofuel of being produced by method as herein described can be used separately with any concentration or use with conventional diesel oil fuel blend in most of modern diesel engines vehicles.When with conventional diesel oil fuel (petrifaction diesel) blend, biofuel can exist has an appointment 0.1% to approximately 99.9%.Most places is used the system that is called " B " factor to mean the amount of biofuel in any fuel mixture in the world.The fuel that for instance, will contain 20% biofuel is labeled as B20.Pure biofuel is called as B100.

Biofuel can also be used as heating fuel in family expenses and commercial boiler.Existing oil-firing boiler may contain rubber components, and may need to be changed so that it utilizes the biofuel running.This switching process is usually relatively simple, comprises and changes rubber components into compound component, because biofuel is strong solvent.Due to the strong solvent effect of biofuel, so the burning biofuel will increase the efficiency of boiler.Biofuel can be used as the additive of diesel formulation, and to increase the oilness of pure ultra-low-sulphur diesel (ULSD) fuel, this is favourable, because biofuel sulfur-bearing hardly.With petrifaction diesel, compare, biofuel is solvent preferably, and can be used to decompose the resistates settling in the motor vehicle fuel pipe that had before utilized the petrifaction diesel running.

Can be by the transesterification production biofuel of the triglyceride level that contains in the biomass that are rich in oils.Therefore, in another aspect of the present invention, provide the method for production biofuel.The method of production biofuel in a preferred embodiment, comprises the following steps: (a) utilize method disclosed herein to cultivate the microorganism that contains lipid; (b) make the biosolubilization that contains lipid, to produce molten born of the same parents' thing; (c) separate lipid from the microorganism of having dissolved; And (d) make lipid composition carry out transesterify, thereby produce biofuel.The method that makes microorganism growth has above been described, make biosolubilization with the method that produces molten born of the same parents' thing, process molten born of the same parents' thing with the method that forms heterogeneous mixture in comprising the medium of organic solvent and make treated molten born of the same parents' thing be separated into the method for lipid composition, and these methods also can the method for the production of biofuel in.

The lipid kenel of biofuel is common and lipid kenel height raw material oils is similar.Can carry out transesterification to other oils provided by method and composition of the present invention, to produce biofuel, the lipid kenel of described biofuel comprises: (a) C8-C14 accounts at least 1%-5%, preferably accounts at least 4%; (b) C8 accounts at least 0.25%-1%, preferably accounts at least 0.3%; (c) C10 accounts at least 1%-5%, preferably accounts at least 2%; (d) C12 accounts at least 1%-5%, preferably accounts at least 2%; And (3) C8-C14 accounts at least 20%-40%, preferably account at least 30%.

Can carry out transesterification to lipid composition, to produce the long chain fatty acid ester as biofuel.Preferred transesterification is summarized in hereinafter, and comprises the transesterification of base catalysis and the transesterification that utilizes recombination lipoidase to carry out.In the transesterification method of base catalysis, under basic catalyst (normally potassium hydroxide) exists, the triacylglycerol ester is reacted with alcohol (as methyl alcohol or ethanol).This reaction forms methyl esters or ethyl ester, and as the glycerol (glycerine) of by product.

Animal oil and vegetables oil are made by triglyceride level usually, and described triglyceride level is the ester that free fatty acids and trivalent alcohol (glycerine) form.In transesterification, the glycerine in triacylglycerol ester (TAG) is replaced by short chain alcohol (as methyl alcohol or ethanol).Typical reaction scheme is as follows:

In this reaction, make pure deprotonation with alkali, so that it becomes stronger nucleophilic reagent.Usually excessive (up to 50 times) are used ethanol or methyl alcohol.What general this reaction was carried out does not carry out very slowly or fully.Can use heat and acid or alkali to help reaction carries out quickly.Transesterification can consumption acids or alkali, so they are not reactant but catalyzer.Nearly all biofuel all utilizes the base catalysis technology to produce, because this technology only needs low temperature and low pressure, and can produce the conversion yield (condition is that moisture and the free fatty acids in initial oils is less) that surpasses 98%.

As described above, can also utilize enzyme (as lipase) but not alkali carries out transesterification.For example can be at the temperature between room temperature and 80 ℃ and be greater than 1: 1 in the mol ratio of TAG and lower alcohol, preferably approximately carry out the transesterification of Lipase catalysis in the situation of 3: 1.The lipase that is applicable to transesterification includes but not limited to list in the lipase in table 9.Other lipase example that is applicable to transesterification sees for example United States Patent (USP) the 4th, and 798, No. 793, the 4th, 940, No. 845, the 5th, 156, No. 963, the 5th, 342, No. 768, the 5th, 776, No. 741 and No. WO89/01032.These lipase include but not limited to lipase and the steapsin by the microorganisms of Rhizopus (Rhizopus), Aspergillus (Aspergillus), mycocandida (Candida), Mucor (Mucor), Rhodopseudomonas (Pseudomonas), Rhizomucor (Rhizomucor), mycocandida (Candida) and humic Pseudomonas (Humicola).

Table 9. is applicable to the lipase of transesterification.

The price that a challenge that utilizes lipase production to be applicable to the fatty acid ester in biofuel is lipase is far away higher than the price of the sodium hydroxide used in strong alkali method (NaOH).Utilized can recirculation immobilized lipase deal with this challenge.Yet the necessary activity that keeps immobilized lipase after the recovery circulation of carrying out minimum number, so that the method based on lipase can be competed with strong alkali method aspect production cost.The lower alcohol be generally used in transesterification is harmful to immobilized lipase.United States Patent (USP) the 6th, 398, No. 707 (giving Wu etc. on June 4th, 2002) described the method for the immobilized lipase regeneration that strengthens the active of immobilized lipase and make activity decreased.Some suitable methods comprise soaks for some time by immobilized lipase in carbonatoms is no less than 3 alcohol, and preferably 0.5 hour-48 hours, and more preferably 0.5 hour-1.5 hours.Some suitable methods also comprise that being no less than 3 alcohol with carbonatoms is washed the immobilized lipase of inactivation, then soaks the immobilized lipase of inactivation 0.5 hour-48 hours in vegetables oil.

In specific embodiments, recombination lipoidase is expressed in the same microorganism of the lipid that produces the lipase effect.Suitable recombination lipoidase comprises the lipase of listing in the lipase in table 9 and/or having listed gene pool accession number in upper table 9, or with upper table 9 in a kind of lipase of listing there is at least 70% amino acid consistence and represent the polypeptide of lipase activity.In other embodiments, with an above-mentioned sequence, have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or have enzymic activity at least about 99% conforming sequence, all these sequences are incorporated to this paper by reference at this, as they are fully set forth.The DNA of coding lipase and the selective marker cDNA that preferably codon is optimized.The recodification gene is so that its method of expressing in micro-algae is described in United States Patent (USP) 7,135, in 290.

The general international standard of biofuel is EN 14214.ASTM D6751 is the most frequently used Biodiesel Standards of America & Canada reference.Germany is used DIN EN 14214, and Britain requires to meet BS EN 14214.Determine that the key industry test whether product meets these standards generally includes gas-chromatography, HPLC and other test.The biofuel that meets quality standard is nontoxic, its toxicity rating (LD ₅₀) be greater than 50mL/kg.

Although it should be nontoxic meeting the biofuel of ASTM standard, but still has pollutent, described pollutent may crystallization and/or precipitation and is broken away from solution as settling.When using biofuel at a lower temperature, sedimental formation especially becomes a difficult problem.Settling or throw out may cause a lot of problems, as reduced fuel flow, stopping up fuel tube, blocking filter etc.Be specifically designed to and remove these pollutents and settling in biofuel and know in the art with the method that produces the product that quality is higher.The example of described method includes but not limited to oils is carried out to pre-treatment to remove pollutent (as phosphatide and free fatty acids) (for example, except glue, alkali purification and silica adsorption filtration) and cold filtration.Cold filtration is that special exploitation is in order to remove any particulate and the sedimental method existed in artifact diesel oil of producing.This method makes biofuel cooling and filter out any settling or the throw out that may form while using fuel at a lower temperature.This method is known in the art, and is described in U.S. Patent Application Publication No. 2007-0175091.Suitable square work can comprise is cooled to lower than the about temperature of 38 ℃, so that impurity and pollutent are settled out with particulate form in biofuel liquid biofuel.Then diatomite or other filtering material are joined in overcooled biofuel, to form slurry, then the strainer by pressurization blade or other type is filtered slurry, to remove particulate.Then make the biofuel through filtering pass through accurate filter, to remove any residual settling and diatomite, produce final biofuel product.

Embodiment 13 has described the triglyceride level oils production biofuel that is used to come from the former algae of mulberry fruit shape.By ASTM D6751 A1 method, measure, the low-temperature adaptation filterableness of the biofuel of producing in embodiment 13 is 120 seconds (for the 300ml volume).This test comprises the B100 of filter 23 00ml, is cooled to 40 ℉, continues 16 hours, is warming up to room temperature, and utilizes 0.7 micron glass fibre filter with stainless steel upholder to be filtered under vacuum.Can carry out transesterification to oils of the present invention, with produce the low-temperature adaptation time be shorter than 120 seconds, the biofuel that is shorter than 100 seconds and is shorter than 90 seconds.

If use biofuel at low especially temperature, can also use subsequent technique so.Described technique comprises antifreeze processing and fractionation.These two kinds of techniques are through designing with cold flow and antifreeze usefulness by reduction cloud point (biofuel starts the temperature of crystallization) improvement fuel.Several antifreeze methods of biofuel that make are arranged.A kind of method is by biofuel and petrifaction diesel blend.Another kind method is to use the additive that can make the biofuel cloud point reduce.Another kind method is at random by sneaking into additive and making the saturate crystallization, then filters out crystal and comes except the desaturation methyl esters.Fractionation optionally is separated into methyl esters single component or part, makes it possible to remove or include in specific methyl esters.Fractionating method comprises urea fractionation, solvent fractionation and thermal distillation.

The valuable fuel of the another kind provided by the inventive method is renewable diesel, and it comprises alkane, as C10:0, C12:0, C14:0, C16:0 and C18:0, therefore is different from biofuel.High-quality renewable diesel meets ASTM D975 standard.The lipid produced by method of the present invention can be used as the raw material of production renewable diesel.Therefore, in another aspect of the present invention, provide the method for production renewable diesel.Can pass through at least 3 kinds of method production renewable diesel: hydrothermal process (hydrogen treatment); Hydrotreatment; And indirect liquefaction.These methods produce non-ester overhead product.During these methods, the triacylglycerol ester of generation as described herein separation is converted to alkane.

In one embodiment, the method of production renewable diesel comprises that (a) utilizes method disclosed herein to cultivate the microorganism that contains lipid, (b) make biosolubilization, to produce molten born of the same parents' thing, (c) separate lipid from the microorganism of having dissolved, and (d) lipid is carried out to deoxidation and hydrogen treatment, to produce alkane, production renewable diesel whereby.Can be by utilizing organic solvent (as hexane) to be extracted from microbial biomass or obtaining by other method (as being described in United States Patent (USP) 5,928, the method in 696) lipid that is suitable for the production renewable diesel.Some suitable methods can comprise machinery pressurization and centrifugal.

In certain methods, at first make the cracking of microorganism lipid and carry out hydrogen treatment, to shorten respectively carbon chain lengths and to make two keys saturated.Then make the material isomerization, carry out hydrogen treatment simultaneously.Then can remove the petroleum naphtha component by distillation method, by distillation, make the required component in diesel oil fuel vaporize and distill again subsequently, so that it meets ASTM D975 standard, and stay than the heavy component of required component that meets the D975 standard.Oils (comprising triglyceride level oils) through chemically modified is carried out to hydrogen treatment, hydrocracking, deoxidation and isomerized method to be known in the art.Referring to for example European patent application EP 1741768 (A1); EP1741767 (A1); EP1682466 (A1); EP1640437 (A1); EP1681337 (A1); EP1795576 (A1); And United States Patent (USP) 7,238,277; 6,630,066; 6,596,155; 6,977,322; 7,041,866; 6,217,746; 5,885,440; 6,881,873.

In an embodiment of the method for production renewable diesel, by lipid composition is carried out to hydrogen treatment, lipid is processed, to produce alkane.In hydrothermal process, usually make biomass react in water under high temperature and high pressure, to form oils and residual solid.Invert point is 300 ℉ to 660 ℉ normally, and pressure is that 100 standard atmospheres are depressed into 170 standard atmospheric pressures (atm), and it is enough to make water basically to keep liquid.Reaction times is about 15 to 30 minutes.After having reacted, separation of organic substances from water.Thereby produce the overhead product that is applicable to diesel oil.

In the certain methods of preparation renewable diesel, the first step that triglyceride level is processed is to carry out hydrotreatment so that two key is saturated, carries out deoxidation under high temperature subsequently under hydrogen and catalyzer existence.In certain methods, carry out hydrogenation and deoxidation in same reaction.In other method, carried out deoxidation before hydrogenation.Then optionally carry out isomerization equally under hydrogen and catalyzer existence.Preferably by distillation, remove the petroleum naphtha component.For instance, referring to United States Patent (USP) 5,475,160 (hydrogenations of triglyceride level); 5,091,116 (deoxidation, hydrogenation and degasification); 6,391,815 (hydrogenations); And 5,888,947 (isomerization).

A kind of suitable method of triglyceride level hydrogenation is comprised to the aqueous solution and another kind of alkali metal soln or the preferred sal volatile for preparing copper, zinc, magnesium and lanthanum salt.These two kinds of solution can be heated to approximately to 20 ℃ to the about temperature of 85 ℃, and mix in precipitation vessel with certain ratio, thereby the pH value in precipitation vessel is remained between 5.5 and 7.5, with the formation catalyzer.Can use at first other water or add other water with salts solution and precipitation solution simultaneously in precipitation vessel.Then to the throw out of gained fully wash, dry, in approximately under 300 ℃ the calcining and approximately 100 ℃ to the temperature in about 400 ℃ of scopes, in hydrogen, activate.Then in reactor, under existing, above-mentioned catalyzer make one or more triglyceride level contact with hydrogen and react.Reactor can be trickle-bed reactor, fixed bed gas solid reactor, packing bubbling column reactor, continuously stirred tank reactor (CSTR), slurry phase reactor or any other suitable type of reactor as known in the art.The method can batch-type or is carried out in a continuous manner.Temperature of reaction usually approximately 170 ℃ to the about scope of 250 ℃, and reaction pressure usually at about 300psig to the scope of about 2000psig.In addition, in the method for the invention, the mol ratio of hydrogen and triglyceride level is usually in the scope of approximately 20: 1 to approximately 700: 1.The method is usually with about 0.1hr ^-1to about 5hr ^-1weight hourly space velocity (WHSV) in scope is carried out.Those skilled in the art know reaction and the required time will change according to mol ratio and the hydrogen dividing potential drop of used temperature, hydrogen and triglyceride level.The product produced by described method for hydrogenation comprises paraffin and the unreacted triglyceride level of fatty alcohol, glycerine, trace.Usually separate these products by ordinary method, described ordinary method is as distillation, extraction, filtration, crystallization etc.

Petroleum refining utilizes hydrotreatment with by with hydrogen, charging being processed to remove impurity.The invert point of hydrotreatment is 300 ℉ to 700 ℉ normally.Pressure is 40atm to 100atm normally.Reaction times is about 10 to 60 minutes usually.Use solid catalyst to increase some speed of reaction, to improve the selectivity to some product, and the consumption of optimizing hydrogen.

The suitable method of oils deoxidation is comprised oils is heated to about 350 ℉ to the temperature in about 550 ℉ scopes, and at least about normal atmosphere to making under the pressure in above-mentioned scope through the oils of heating and nitrogen Continuous Contact at least about 5 minutes.

Comprise for isomerized suitable method isomerization and other oils isomerization as known in the art that utilizes alkali.

Hydrogen treatment and hydrotreatment finally make the molecular weight of triglyceride level charging reduce.Be reduced into 4 hydrocarbon molecules at the next triglyceride level molecule of hydroprocessing condition: 1 propane molecule and 3 heavier hydrocarbon molecules, usually in C8 to C18 scope.

Therefore, in one embodiment, the product of one or more chemical reactions that lipid composition of the present invention is carried out is paraffins mixtures, and it comprises ASTM D975 renewable diesel.The hydrocarbon production of microorganism is by Metzger etc., Appl Microbiol Biotechnol (2005) 66:486-496; And A Look Back at the U.S.Department of Energy ' s AquaticSpecies Program:Biodiesel from Algae, NREL/TP-580-24190, JohnSheehan, Terri Dunahay, John Benemann and Paul Roessler (1998) summary.

The distillation characteristics of diesel oil fuel be take T10-T90 and is described (referring to respectively the distillation volume as 10% the time and the temperature 90% time).Renewable diesel is produced and is described in embodiment 13 by the former algae triglyceride level of mulberry fruit shape oils.The T10-T90 of the material produced in embodiment 13 is 57.9 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the triglyceride level oils that the method for other covalent modification and distillation disclosed herein and the utilization of fractionation (as cold filtration) method produce according to method disclosed herein produce the renewable diesel composition with other T10-T90 scope (as 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 60 ℃ and 65 ℃).

The T10 of the material produced in embodiment 13 is 242.1 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other T10 value, such as the T10 value between 180 and 295, between 190 and 270, between 210 and 250, between 225 and 245 and be at least 290.

The T90 of the material produced in embodiment 13 is 300 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other T90 value, such as the T90 value between 280 and 380, between 290 and 360, between 300 and 350, between 310 and 340 and be at least 290.

The FBP of the material produced in embodiment 13 is 300 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other FBP value, such as the FBP value between 290 and 400, between 300 and 385, between 310 and 370, between 315 and 360 and be at least 300.

The combination of hydrogen treatment, isomerization and other covalent modification can be provided other oils provided by method and composition of the present invention, described other oils comprises that the lipid kenel comprises following oils: (a) C8-C14 accounts at least 1%-5%, preferably accounts at least 4%; (b) C8 accounts at least 0.25%-1%, preferably accounts at least 0.3%; (c) C10 accounts at least 1%-5%, preferably accounts at least 2%; (d) C12 accounts at least 1%-5%, preferably accounts at least 2%; And (3) C8-C14 accounts at least 20%-40%, preferably account at least 30%.

Can produce traditional ultra-low-sulphur diesel by any type of biomass by two-stage process.At first, Wood Adhesives from Biomass is become to synthetic gas (a kind of gaseous mixture that is rich in hydrogen and carbon monoxide).Then syngas catalytic conversion is become to liquid.Usually utilize Fisher-Tropsch (FT) synthesis method to produce liquid.This technology can be applied to coal, Sweet natural gas and heavy oil.Therefore, in another preferred embodiment again of the method for production renewable diesel, by making the lipid composition indirect liquefaction, lipid composition is processed to produce alkane.

The present invention also provides the method for producing rocket engine fuel.Rocket engine fuel be clear to flaxen.The most frequently used fuel is not leaded/fuel based on paraffin oil, and it is classified as aircraft-level A-1, according to one group of International standardization standard, produces.Rocket engine fuel is the mixture of multiple different hydrocarbon, may reach thousands of kinds or more kinds of hydrocarbon.Their size (molecular weight or carbon number) scope is subject to the restriction of product requirement, for example zero pour or smoke point.The carbon number distribution of kerosene type aircraft-level fuel (comprising Jet A and Jet A-1) is between about 8 carbon numbers and 16 carbon numbers.Wide fraction or petroleum naphtha type aircraft-level fuel (comprising Jet B) have approximately the carbon number distribution between 5 carbon and 15 carbon usually.

Two kinds of aircraft-level fuel (Jet A and Jet B) can contain multiple additives.Available additive comprises but is not limited to antioxidant, static inhibitor, stopping agent and fuel system deicing agent (FSII).Antioxidant prevents gum deposit, and usually for example, based on process alkylating phenol, AO-30, AO-31 or AO-37.Static inhibitor is eliminated static and is prevented spark.The dinonylnaphthalene sulfonic acid (DINNSA) of usining is an example as the Stadis 450 of activeconstituents.Stopping agent, for example DCI-4A is used to civil and military fuel, and DCI-6A is used to military fuel.The FSII agent comprises for example Di-EGME.

In one embodiment of the invention, by algae fuel and existing rocket engine fuel blend are produced to rocket engine fuel.The lipid produced by method of the present invention can be used as producing the raw material of rocket engine fuel.Therefore, in another aspect of the present invention, provide the method for producing rocket engine fuel.Two kinds of methods from the lipid production rocket engine fuel by method generation of the present invention are provided at this: fluid catalytic cracking (FCC) and hydrogenation deoxidation (HDO).

Fluid catalytic cracking (FCC) is a kind of method for the production of alkene, particularly from the heavy crude component, produces propylene.The lipid produced by method of the present invention can be converted to alkene.Described method comprises makes the lipid stream produced cross the FCC district and collect the product stream that comprises alkene, and described product stream can be used as rocket engine fuel.Produced lipid is contacted under cracking conditions, so that the product stream that comprises alkene and hydrocarbon that can be used as rocket engine fuel to be provided with cracking catalyst.

In one embodiment, the method for production rocket engine fuel comprises that (a) utilizes method disclosed herein to cultivate the microorganism that contains lipid; (b) make the biosolubilization that contains lipid, to produce molten born of the same parents' thing; (c) separate lipid from molten born of the same parents' thing; And (d) process lipid composition, produce whereby rocket engine fuel.In an embodiment of the method for producing rocket engine fuel, can make lipid composition flow through the fluid catalytic cracking district, in one embodiment, it can comprise contacts lipid composition under cracking conditions with cracking catalyst, to provide, comprise C ₂-C ₅the product stream of alkene.

In some embodiment of this method, may need to remove any pollutent existed in lipid composition.Therefore, make before lipid composition flows through the fluid catalytic cracking district, lipid composition to be carried out to pre-treatment.Pre-treatment can comprise makes lipid composition contact with ion exchange resin.Ion exchange resin is that acidic ion exchange resin is (such as Amberlyst ^tM-15) and be used as a body in the reactor that can flow through up or down at lipid composition.Other pre-treatment can comprise by making lipid composition contact and carry out the weak acid washing with acid (such as sulfuric acid, acetic acid, nitric acid or hydrochloric acid).Generally in envrionment temperature, with under normal atmosphere, with dilute acid soln, contacted.

Make optionally through pretreated lipid composition, to flow to the FCC district, make herein the hydrocarbon component be cracked into alkene.By making lipid composition contact catalytic cracking with the catalyzer formed by the subparticle material in reaction zone.Described reaction is catalytic cracking, and itself and hydrocracking compare, in the situation that do not add hydrogen or do not consume hydrogen, carries out.Along with cracking reaction is carried out, a large amount of sedimentation of coke are on catalyzer.By making the coke on catalyzer burn at high temperature to make catalyst regeneration in breeding blanket.The catalyzer that contains coke (being called as " carbon deposited catalyst " at this paper) is transported to breeding blanket from reaction zone constantly, so that its regeneration the regenerated catalyst that is substantially free of coke in breeding blanket are replaced.By various air-flows, granules of catalyst being carried out to fluidisation makes it possible to transport catalyzer between reaction zone and breeding blanket.In the fluidization flow of catalyzer, make hydrocarbon (hydrocarbon in all lipid compositions as described herein) cracking method, transport the method for catalyzer between reaction zone and breeding blanket and in revivifier the method for combustion of coke be for the technician in FCC method field known.Exemplary FCC application and for making the lipid composition cracking be described in United States Patent (USP) the 6th with the catalyzer that produces C2-C5 alkene, 538, No. 169, the 7th, in 288, No. 685, described patent integral body by reference is incorporated to this paper.

Suitable FCC catalyzer generally comprise in or at least two kinds of components on same matrix not.In some embodiments, two kinds of components all circulate in whole reaction vessel.The first component generally comprises any catalyzer of knowing for the fluid catalytic cracking field, such as active amorphous clays type catalyzer and/or high activity, crystalline molecular sieve.Molecular sieve catalyst is better than amorphous catalyst, because molecular sieve catalyst has improved the selectivity to required product greatly.In some preferred embodiments, in the FCC method, can use zeolite as molecular sieve.The first catalyst component preferably comprises wide-aperture zeolite (such as y-type zeolite), activated alumina material, the jointing material that comprises silica or aluminum oxide and inert filler (such as kaolin).

In one embodiment, the cracking of lipid composition of the present invention occurs in the raising section in FCC district or in the ascent stage.By nozzle, lipid composition is introduced in raising section, so that the lipid composition fast vaporizing.With before catalyzer contacts, lipid composition has the approximately temperature of 149 ℃ to approximately 316 ℃ (300 ℉ to 600 ℉) usually.Catalyzer is from the blend container flow to raising section, and it contacts approximately 2 seconds or shorter time with lipid composition herein.

Then by outlet, the catalyzer of blend and the lipid composition steam that reacted are discharged from the top, raising section, and be separated into the crackate steam flow that comprises alkene and be coated with a large amount of coke and be commonly referred to as the granules of catalyst gleanings of " carbon deposited catalyst ".In reducing to the shortest trial the duration of contact that makes lipid composition and catalyzer (may promote required product further to change into undesirable other product), can use any separator arrangement (such as the pivot arm arrangement), to remove fast carbon deposited catalyst from product stream.Separator (for example pivot arm separator) is positioned at the top of chamber, and wherein stripping zone is positioned at the bottom of described chamber.The catalyst drops of being separated by the pivot arm arrangement falls into stripping zone.The crackate steam flow that comprises the hydrocarbon (comprising light olefin) through cracking is discharged chamber with some catalyzer by the pipeline be connected with swirler.Swirler is removed the residual catalyst particle in the product steam flow, granule density is down to extremely low-level.Then the product steam flow is discharged from the separation vessel top.The catalyzer separated by swirler is back in separation vessel, then enters stripping zone.Stripping zone is by contacting the hydrocarbon of removing catalyst surface absorption with steam counter-flow.

Low hydrocarbon partial pressure is in order to be conducive to the generation of light olefin.Therefore, by the raising section pressure setting, be about 172kPa to 241kPa (25psia to 35psia), wherein hydrocarbon partial pressure is about 35kPa to 172kPa (5psia to 25psia), and preferred hydrocarbon partial pressure is about 69kPa to 138kPa (10psia to 20psia).By utilizing steam to reach as thinner the 10wt% to 55wt% that thinner accounts for lipid composition, and the degree that preferably accounts for the approximately 15wt% of lipid composition reaches this relatively low hydrocarbon partial pressure.Can use other thinner (such as dry gas) to reach the hydrocarbon partial pressure be equal to.

The cracked stream temperature in exit, raising section is approximately 510 ℃ to 621 ℃ (950 ℉ to 1150 ℉).Yet the raising section temperature out can produce more dry gas and polyene hydrocarbon more higher than 566 ℃ (1050 ℉).And the raising section temperature out can produce less ethene and propylene lower than 566 ℃ (1050 ℉).Therefore, preferably approximately 566 ℃ to approximately the preferred temperature, about 138kPa of 630 ℃ are carried out the FCC method to the preferred pressure of about 240kPa (20psia to 35psia).Another condition of described method is the ratio of catalyzer and lipid composition, can be approximately 5 to approximately changing between 20, and preferably approximately 10 to approximately 15.

In an embodiment of the method for producing rocket engine fuel, the ascent stage of lipid composition being introduced to the FCC reactor.Temperature in ascent stage is very high, and at approximately 700 ℃ (1292 ℉) to approximately 760 ℃ (1400 ℉) scopes, wherein the ratio of catalyzer and lipid composition is approximately 100 to approximately 150.Can expect lipid composition is introduced in the ascent stage and can be produced a large amount of propylene and ethene.

In another embodiment of the method for the lipid composition that utilizes generation as described herein or lipid production rocket engine fuel, the structure of lipid composition or lipid is destroyed by the method that is called as hydrogenation deoxidation (HDO).The HDO meaning is to remove deoxidation by means of hydrogen, destroys the structure of material in the time of except deoxidation.Make olefinic double bond hydrogenation, and remove any sulphur and nitrogen compound.Removing of sulphur is called as hydrogenating desulfurization (HDS).Starting material (lipid composition or lipid) are carried out to the work-ing life that pre-treatment and purifying contribute to extending catalyst.

Generally, in the HDO/HDS step, hydrogen is mixed with raw material (lipid composition or lipid), then make mixture pass through catalyst bed with single-phase raw material or the following current of two-phase raw material form.After the HDO/MDS step, the separated product component, and it is led in independent isomerization reactor.Isomerization reactor for biological initial substance is described in document (FI 100 248) (concurrent flow reactor).

Can also be by making lipid composition or lipid and hydrogen following current by the first hydrogenation zone, and by hydrogen is led to the second hydrogenation zone with respect to hydrocarbon ejecta adverse current, in the second hydrogenation zone, the hydrocarbon ejecta is carried out to further hydrogenation, for example carry out, by making hydrocarbon charging (lipid composition or lipid) herein hydrogenation produce the method for fuel subsequently.Exemplary HDO application and for making the lipid composition cracking to produce C ₂-C ₅the catalyzer of alkene is described in United States Patent (USP) the 7th, and in 232, No. 935, described patent integral body by reference is incorporated to this paper.

Usually in the hydrogenation deoxidation step, make the STRUCTURE DECOMPOSITION of biological components (as lipid composition or lipid herein), except deoxidation, nitrogen, phosphorus and sulphur compound and lighter hydrocarbons (as gas), and make ethylene linkage hydrogenation.In the second step of described method, in so-called isomerization steps, carry out isomerization so that hydrocarbon chain branch, and the performance of paraffin under improvement low temperature.

First step at cracking process is in the HDO step, by hydrogen with need the lipid composition herein of hydrogenation or lipid following current or adverse current are led in the HDO catalyst bed system, described catalyst bed system comprises one or more catalyst beds, preferably 1-3 catalyst bed.Usually carry out the HDO step with concurrent.In the situation that the HDO catalyst bed system comprises two or more catalyst beds, utilize counter-current principle to be operated one or more catalyst beds.In the HDO step, pressure changes between 20 bar and 150 bar, and preferably between 50 bar and 100 bar, and temperature changes between 200 ℃ and 500 ℃, preferably in the scope of 300 ℃-400 ℃.In the HDO step, can use the known hydrogenation catalyst that contains VII family in the periodic table of elements and/or group vib metal.Hydrogenation catalyst is loading type Pd, Pt, Ni, NiMo or CoMo catalyzer preferably, and wherein carrier is aluminum oxide and/or silica.Usually use NiMo/Al ₂o ₃and CoMo/Al ₂o ₃catalyzer.

Before the HDO step, optionally by than carrying out pre-hydrogenation under mild conditions, lipid composition or lipid herein being processed, thereby avoid the side reaction of two keys.Under pre-hydrogenation catalyst exists, under the hydrogen pressure of the temperature of 50 ℃-400 ℃ and 1-200 bar, preferably in the temperature between 150 ℃ and 250 ℃ with under the hydrogen pressure between 10 bar and 100 bar, carry out described pre-hydrogenation.Catalyzer can contain the metal of group VIII in the periodic table of elements and/or group vib.Pre-hydrogenation catalyst is loading type Pd, Pt, Ni, NiMo or CoMo catalyzer preferably, and wherein carrier is aluminum oxide and/or silica.

The air-flow that makes to contain hydrogen in the HDO step is cooling, then therefrom removes carbon monoxide, carbonic acid gas, nitrogen, p and s compound, gaseous state lighter hydrocarbons and other impurity.After compression, the hydrogen of purified hydrogen or process recirculation is back between the first catalyst bed and/or catalyst bed, the air-flow of discharging with compensation.Remove and anhydrate from concentrated liquid.Liquid is led between the first catalyst bed or catalyst bed.

After the HDO step, make product carry out isomerization steps.At hydrocarbon, with as far as possible fully removing impurity before isomerization catalyst contacts, for this process, be important.Isomerization steps comprises optional stripping step, wherein by with water vapour or suitable gas (such as lighter hydrocarbons, nitrogen or hydrogen) stripping, the reaction product from the HDO step being carried out to purifying.Carry out optional stripping step in the upstream units of isomerization catalyst with reflux type, wherein gas and liquid are in contact with one another, or utilize counter-current principle to carry out optional elution step before actual isomerization reactor in independent steam stripping unit.

After stripping step, by hydrogen and through the lipid composition herein of over hydrogenation or lipid and optionally the N PARAFFIN & HEAVY NORMAL PARAFFIN hydrocarbon mixture lead in the isomerization reaction unit that comprises or several catalyst beds.The catalyst bed of isomerization steps can following current or reflux type operation.

In isomerization steps, the application counter-current principle is important for this process.In isomerization steps, this is by carrying out optional stripping step or isomerization reaction step with reflux type or the two carries out.In isomerization steps, pressure changes in the scope of 20 bar-150 bar, and preferably, in 20 bar-100 bar scope, temperature is between 200 ℃ and 500 ℃, preferably between 300 ℃ and 400 ℃.In isomerization steps, can use isomerization catalyst as known in the art.Metal and/or carrier that suitable isomerization catalyst contains molecular sieve and/or VII family.Isomerization catalyst preferably contains SAPO-11 or SAPO41 or ZSM-22 or ZSM-23 or ferrierite and Pt, Pd or Ni and Al ₂o ₃or SiO ₂.Typical isomerization catalyst is Pt/SAPO-11/Al for example ₂o ₃, Pt/ZSM-22/Al ₂o ₃, Pt/ZSM-23/Al ₂o ₃and Pt/SAPO-11/SiO ₂.Can in identical pressurized vessel or independent pressurized vessel, carry out isomerization steps and HDO step.Carry out optional pre-hydrogenation in independent pressurized vessel or in the pressurized vessel identical with HDO and isomerization steps.

Therefore, in one embodiment, the product of one or more chemical reactions is the paraffins mixtures that comprise HRJ-5.In another embodiment, the product of one or more chemical reactions is the paraffins mixtures that comprise ASTM D1655 rocket engine fuel.In some embodiments, the composition that meets ASTM 1655 rocket engine fuel standards has the sulphur content that is less than 10ppm.In other embodiments, the composition that meets ASTM 1655 rocket engine fuel standards has the T10 value lower than the distillation curve of 205 ℃.In another embodiment, the composition that meets ASTM1655 rocket engine fuel standard has the full boiling point (FBP) lower than 300 ℃.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards has the burning-point of at least 38 ℃.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards has 775K/M ³with 840K/M ³between density.In another embodiment again, the composition that meets ASTM 1655 rocket engine fuel standards has the zero pour lower than-47 ℃.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards has at least net heat of combustion of 42.8MJ/K.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards has the hydrogen richness of at least 13.4 quality %.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards have as by the quantitative JFTOT of weight in 260 ℃ of lower tests the thermostability lower than 3mm Hg.In another embodiment, the composition that meets ASTM 1655 rocket engine fuel standards has the existent gum lower than 7mg/dl.

Therefore, the invention discloses several different methods, wherein micro-algae lipid is carried out to chemically modified, to produce the product for multiple industry and other application.The example of the method that the oils produced by method disclosed herein is modified includes but not limited to oils is hydrolyzed to, oils is carried out hydrotreatment and oils is carried out to esterification.Other chemically modified that micro-algae lipid is carried out includes but not limited to epoxidation, oxidation, hydrolysis, sulfation, sulfonation, ethoxylation, propoxylation, amidation and saponification.Micro-algae oils is carried out to modification and can produce basic grease chemical article, it can further be modified into selected derivative grease chemical article to have required function.To be similar to above for the described mode of biofuel production process, can also carry out these chemically modifieds to the oils by microorganism culturing deposits yields as herein described.The example of basic grease chemical article includes but not limited to soap, lipid acid, fatty acid ester, fatty alcohol, aliphatics nitrogen compound, fatty acid methyl ester and glycerine.The example of derivative grease chemical article includes but not limited to aliphatic nitrile, ester, dimeracid, quaternary ammonium salt, tensio-active agent, Marlamid, fatty alcohol sulfate, resin, emulsifying agent, fatty alcohol, alkene, drilling mud, polyvalent alcohol, polyurethane(s), polyacrylic ester, rubber, candle, makeup, metallic soap, soap, α-sulfonated formate, fatty alcohol sulfate, fatty alcohol ethoxylate, fatty alcohol ether sulfate, tetrahydroglyoxaline, tensio-active agent, sanitising agent, ester, quaternary ammonium salt, the ozone decomposed product, fatty amine, Marlamid, the oxyethyl group sulfuric ester, monoglyceride, triglyceride, triglyceride level (comprising medium chain triglyceride), lubricant, hydraulic liquid, lubricating oil, dielectric fluid, releasing agent, metal working fluid, heat-transfer fluid, other functional liquid, industrial chemical (clean-out system for example, the textile process auxiliary agent, softening agent, stablizer, additive), topcoating, paint and varnish, wire insulator and higher alkane.

Fatty acid component hydrolysis in the glyceride that makes to produce by the inventive method produces free fatty acids, can make described free fatty acids derivatize to produce other useful chemical.Under water and catalyzer (can be acid or alkali) existence, be hydrolyzed.Can make the free fatty acids derivatize discharged, to produce the multiple product as following patent report: United States Patent (USP) the 5th, 304, No. 664 (highly Sulfated lipid acid); The 7th, 262, No. 158 (cleaning compositions); The 7th, 115, No. 173 (fabric softener composition); The 6th, 342, No. 208 (for the emulsion of nursing skin); The 7th, 264, No. 886 (water-proofing composition); The 6th, 924, No. 333 (oil paint additive); The 6th, 596, No. 768 (being rich in the ruminating animal raw material of lipid); And the 6th, 380, No. 410 (for the tensio-active agent of sanitising agent and clean-out system).

For hydrolysis, in one embodiment of the invention, optionally at first in liquid medium (such as water or sodium hydroxide), make the hydrolysis of triglyceride level oils, to obtain glycerine and soap.There are various suitable triglyceride hydrolysis methods, include but not limited to saponification, acid hydrolysis, basic hydrolysis, enzymically hydrolyse (this paper is called decomposition) and the hydrolysis that utilizes hot pressurized water.Those skilled in the art should know in order to produce grease chemical article, do not need triglyceride level oils is hydrolyzed; But method that can be known by other directly changes into required grease chemical article by oils.For instance, can triglyceride level oils directly be changed into to fatty acid methyl ester by esterification.

In some embodiments, by oils being resolved into to glycerine and lipid acid, the oils produced by method disclosed herein is carried out to catalytic hydrolysis.As described above, then by several other modifications, lipid acid is further processed, to obtain derivative grease chemical article.For instance, in one embodiment, make lipid acid carry out amination reaction, to produce the aliphatics nitrogen compound.In another embodiment, make lipid acid carry out ozone decomposed, to produce monoprotic acid and diprotic acid.

In other embodiments, by the oils that makes to produce herein, decompose to be hydrolyzed, to produce grease chemical article.In preferred embodiments more of the present invention, before carrying out other method, make triglyceride level oils decompose.Those skilled in the art should know the appropriate method that much makes triglyceride level decompose, and includes but not limited to that enzymatic decomposition and pressure decompose.

Enzymatic oils decomposition method is generally used enzyme, lipase as the biological catalyst that acts on water/oil mixt.Then enzymatic decomposition makes oils or fat resolve into respectively glycerine and free fatty acids.Then glycerine migrate in water, and organic phase is rich in free fatty acids.

Enzymatic decomposition reaction generally occurs in the phase border between organic phase and water, and wherein enzyme exists only in the phase border.Then the triglyceride level that arrives the phase border carries out or participates in decomposition reaction.Along with the carrying out of reaction, with free fatty acids, to compare, the phase boundary still reduces with occupation density or the concentration of the chemically combined lipid acid of glyceride form, so that reaction is slowed down.In certain embodiments, at room temperature carry out enzymatic decomposition.Those skilled in the art should know makes oils resolve into the conditions suitable of desired fats acid.

For instance, can speed of response be accelerated by increasing the interfacial boundary surface.After having reacted, separation of free fatty acids from the organic phase of removing enzyme then, and will still contain with the resistates of the chemically combined lipid acid of glyceride form and send back to or recirculation, and mix with the fresh oils that is about to be decomposed or fat.In such a way, then make the glyceryl ester of recirculation carry out further enzymatic decomposition process.In some embodiments, extract free fatty acids by this way from the oils of decomposed or fat.By that way, if chemically combined lipid acid (triglyceride level) is returned or returns in decomposition course, can make the consumption of enzyme significantly reduce.

Degree of decomposition is confirmed as using measured acid number divided by the possible resulting ratio of acid number in theory of calculating for given oils or buttermeter.Preferably according to the common method of standard, pass through the titrimetry acid number.Perhaps, can regard the density of glycerine water as degree of decomposition measure.

In one embodiment, the monoglyceride, triglyceride and the triglyceride level that in the so-called soap stock that decomposition method as herein described also is applicable to make the alkali process for extracting by produced oils to produce, contain decompose.In such a way, can make the soap stock Quantitative yield and before not needing, neutral oils is saponified into to lipid acid.For this purpose, preferably before decomposing by adding acid that chemically combined lipid acid in soap is discharged.In certain embodiments, except water and enzyme, also can use buffered soln to carry out decomposition method.

The oils that can also produce the method according to this invention in one embodiment, is carried out saponification (a kind of method for hydrolysis).Animal oil and vegetables oil are comprised of triacylglycerol (TAG) usually, and it is the ester that lipid acid and trivalent alcohol (glycerine) form.In macromolecule alkali for hydrolysis, the glycerine in TAG is removed, and stays 3 carboxylate anions, and these negatively charged ion can associate with alkali metal cation (such as sodium or potassium), produce soap.In this scheme, carboxylic acid composition from the cracking of glycerine part, and replaced by hydroxyl.Determine the amount of the alkali (for example KOH) used in reaction by required saponification degree.If purpose is for example to produce to comprise the soap products that is present at first some oils in the TAG composition, so by not enough so that all TAG change into the alkali of the amount of soap is incorporated in reaction mixture.Usually carry out this reaction in the aqueous solution, and sluggish carries out, but can make its quickening by heating.Can impel soap to be settled out by add salt (for example, such as water-soluble alkali halogenide (NaCl or KCl)) in reaction mixture.Alkali is alkali metal hydroxide preferably, such as NaOH or KOH.Perhaps, in reaction scheme, other alkali be can use, such as alkanolamine, for example trolamine and aminomethyl propanol comprised.In some cases, preferably use these substitutes to produce the transparent soap product.In one embodiment, the lipid composition that carries out saponification is the Tallow, beef stand-in (being similar to the lipid composition of Tallow, beef) of generation as described herein, or the blend of Tallow, beef stand-in and another kind of triglyceride level oils.

In certain methods, first step of chemically modified can be hydrotreatment so that two key is saturated, carry out deoxidation under high temperature subsequently under hydrogen and catalyzer exist.In other method, carry out hydrogenation and deoxidation in same reaction.In other method again, carried out deoxidation before hydrogenation.Then optionally carry out isomerization equally under hydrogen and catalyzer existence.Finally, in case of necessity, can remove gas and petroleum naphtha component.For instance, referring to United States Patent (USP) 5,475,160 (hydrogenations of triglyceride level); 5,091,116 (deoxidation, hydrogenation and degasification); 6,391,815 (hydrogenations); And 5,888,947 (isomerization).

In some embodiments of the present invention, make the partially or completely deoxidation of triglyceride level oils.Deoxygenation forms required product, includes but not limited to lipid acid, fatty alcohol, polyvalent alcohol, ketone and aldehyde.In general, in the situation that be not bound by any particular theory, deoxygenation comprises the combination of various differential responses paths, include but not limited to: hydrogenolysis, hydrogenation, continuous hydrogenation-hydrogenolysis, continuous hydrogenolysis-hydrogenation and associating hydrogenation-hydrogenolysis, make and remove at least in part oxygen from lipid acid or fatty acid ester, to produce reaction product, such as fatty alcohol, described reaction product can easily change into required chemical by further processing.For instance, in one embodiment, fatty alcohol can be reacted and changes into alkene or change into higher alkane by condensation reaction by FCC.

A kind of described chemically modified is hydrogenation, and it is that hydrogen is added on the two keys in the fatty acid component of glyceride or free fatty acids.Method for hydrogenation makes and liquid oils can be changed into to semisolid or solid fat, and described fat is more suitable in application-specific.

The hydrogenation of the oils produced by method as herein described can be combined and carry out with one or more method that provide herein and/or material, as reported in following patent: United States Patent (USP) the 7th, 288, No. 278 (foodstuff additive or medicament); The 5th, 346, No. 724 (lubricated product); The 5th, 475, No. 160 (fatty alcohol); The 5th, 091, No. 116 (edible oil); The 6th, 808, No. 737 (for the structural fatty of oleomargarine and spread food); The 5th, 298, No. 637 (low calory fat-replacer); The 6th, 391, No. 815 (hydrogenation catalyst and sulfur absorbent); The 5th, 233, No. 099 and the 5th, 233, No. 100 (fatty alcohol); The 4th, 584, No. 139 (hydrogenation catalyst); The 6th, 057, No. 375 (suds suppressor); And the 7th, 118, No. 773 (edible emulsions spread food).

Those skilled in the art should know that can make ins all sorts of ways makes carbohydrate hydrogenation.A kind of suitable method is included in hydrogenation reactor under the condition that is enough to form hydrogenated products the hydrogen and the catalyzer that make carbohydrate and hydrogen or mix with suitable gas and contacts.Hydrogenation catalyst generally can comprise Cu, Re, Ni, Fe, Co, Ru, Pd, Rh, Pt, Os, Ir with and alloy or any combination, its separately or use together with promotor, described promotor such as W, Mo, Au, Ag, Cr, Zn, Mn, Sn, B, P, Bi with and alloy or any combination.Other effective hydrogenation catalyst material comprises the ruthenium of load-type nickel or process rhenium upgrading.In one embodiment, hydrogenation catalyst also comprises any carrier, and this depends on the function that catalyzer is required.Can prepare hydrogenation catalyst by method known to those skilled in the art.

In some embodiments, hydrogenation catalyst comprises loading type group VIII metal catalyst and metal sponge material (for example sponge nickel catalyst).An example that is applicable to the sponge nickel catalyst through overactivation of the present invention is Buddhist nun's Ruan nickel (Raney nickel).In other embodiments, utilize the catalyzer of the nickel catalyzator that comprises nickel-rhenium catalyst or process tungsten upgrading to carry out the hydrogenation in the present invention.An example that is used for the suitable catalyst of hydrogenation of the present invention is carbon-supported nickel-rhenium catalyst.

In one embodiment, can be by for example, with alkali aqueous solution (sodium hydroxide that contains 25 % by weight of having an appointment) nickel of about equal weight and the alloy of aluminium being processed to prepare suitable Buddhist nun's Ruan nickel catalyzator.Aluminium is optionally dissolved by alkali aqueous solution, produces the spongiform material, mainly comprises nickel and a small amount of aluminium.Initial alloy comprises promoter metals (being molybdenum or chromium), and its amount makes it retain approximately 1 % by weight to 2 % by weight in formed sponge nickel catalyst.In another embodiment, flood suitable propping material by the aqueous solution that uses nitrosyl nitric acid ruthenium (III), ruthenium chloride (III) and prepare hydrogenation catalyst.Then make the solution drying, form water-content and be less than the approximately solid of 1 % by weight.Then in the rotating spherical stove in hydrogen stream under normal atmosphere under 300 ℃ (not calcination) or 400 ℃ (calcination) by solid reduction 4 hours.Cooling and make catalyzer Sui with nitrogen after, make containing the nitrogen of 5 volume % oxygen by catalyzer 2 hours.

In certain embodiments, described catalyzer comprises support of the catalyst.Described support of the catalyst makes catalyzer stablize and provide support.The type of the support of the catalyst of using depends on selected catalyzer and reaction conditions.For suitable carrier of the present invention include but not limited to carbon, silica, silica-alumina, zirconium white, titanium dioxide, cerium dioxide, vanadium oxide, nitride, boron nitride, heteropolyacid, hydroxylapatite, zinc oxide, chromic oxide, zeolite, carbon nanometer tube, carbon fullerene with and any combination.

Can utilize ordinary method well known by persons skilled in the art for the preparation of catalyzer of the present invention.Suitable method can include but not limited to incipient wetness, steam-type injection, chemical vapour deposition, water-proof coating, magnetron sputtering technique etc.

The type of the condition of carrying out hydrogenation based on initial substance and required product and changing.Those skilled in the art should know suitable reaction conditions under rights and interests of the present invention.In general, at the temperature of 80 ℃ to 250 ℃, and preferably at 90 ℃ under 200 ℃, and most preferably under 100 ℃ to 150 ℃, carry out hydrogenation.In some embodiments, carry out hydrogenation under the pressure of 500KPa to 14000KPa.

The hydrogen used in hydrogenolysis of the present invention can comprise hydrogen that external hydrogen, recycled hydrogen, original position produce with and any combination.Term used herein " external hydrogen " refers to and is not to derive from biomass reaction itself but joins the hydrogen system from another kind source.

In some embodiments of the present invention, need to make initial carbohydrate change into than small molecules, describedly than small molecules, be easier to be converted to required higher hydrocarbon.A kind of suitable method for this conversion is to pass through hydrogenolysis.Known the whole bag of tricks can carry out the hydrogenolysis of carbohydrate.A kind of suitable method is included in the hydrogenolysis device, under being enough to form and comprising than the condition of the reaction product of small molecules or polyvalent alcohol, carbohydrate is contacted with hydrogen or with hydrogen and the hydrogenolysis catalyst of suitable gas mixing.Term used herein " than small molecules or polyvalent alcohol " comprises having than small molecules amount any molecule of (carbonatoms or oxygen atomicity are less than initial carbohydrate).In one embodiment, reaction product comprises than small molecules, describedly than small molecules, comprises polyvalent alcohol and alcohol.Those skilled in the art can select appropriate means to carry out hydrogenolysis.

In some embodiments, can utilize hydrogenolysis catalyst that 5 carbon and/or 6 carbon sugar or sugar alcohol are changed into to propylene glycol, ethylene glycol and glycerine.Hydrogenolysis catalyst can comprise Cr, Mo, W, Re, Mn, Cu, Cd, Fe, Co, Ni, Pt, Pd, Rh, Ru, Ir, Os with and alloy or any combination, its separately or use together with promotor, described promotor such as Au, Ag, Cr, Zn, Mn, Sn, Bi, B, O with and alloy or any combination.Hydrogenolysis catalyst can also comprise the carbon pyropolymer catalyzer that contains transition metal (for example chromium, molybdenum, tungsten, rhenium, manganese, copper, cadmium) or group VIII metal (for example iron, cobalt, nickel, platinum, palladium, rhodium, ruthenium, iridium and osmium).In certain embodiments, hydrogenolysis catalyst can comprise the above-mentioned any metal on the carrier that combines or be attached to the tool catalytic activity with alkaline earth metal oxide.In certain embodiments, the catalyzer described in hydrogenolysis can comprise as above for the described support of the catalyst of hydrogenation.

The type of the condition of carrying out hydrogenolysis based on initial substance and required product and changing.Those skilled in the art should know for carrying out the suitable condition of this reaction under rights and interests of the present invention.In general, at the temperature of 110 ℃ to 300 ℃, and preferably at 170 ℃ under 220 ℃, and most preferably under 200 ℃ to 225 ℃, carry out its hydrogenolysis.In some embodiments, under alkaline condition, preferably under 8 to 13 pH value, and more preferably under 10 to 12 pH value, carry out hydrogenolysis.In some embodiments, under the pressure between 60Kpa and 16500Kpa in scope, and preferably between 1700Kpa and 14000Kpa in scope, and more preferably between 4800Kpa and 11000Kpa, under the pressure in scope, carry out hydrogenolysis.

The hydrogen used in hydrogenolysis of the present invention can comprise hydrogen that external hydrogen, recycled hydrogen, original position produce with and any combination.

In some embodiments, can in condensation reactor, by condensation reaction, above-mentioned reaction product be changed into to higher hydrocarbon.In described embodiment, under the catalyzer that can form higher hydrocarbon exists, reaction product is carried out to condensation.In the situation that be not intended to bound by theory, it is believed that by addition reaction progressively and produce higher hydrocarbon, described reaction comprises the formation of C-C or carbon-oxygen bond.Resulting reaction product comprises the multiple compound that contains these parts, as hereinafter be described in more detail.

In certain embodiments, suitable condensation catalyst comprises acid catalyst, alkaline catalysts or acid/alkaline catalysts.Term used herein " acid/alkaline catalysts " refers to the catalyzer that simultaneously has acid function and alkali function.In some embodiments, condensation catalyst can include but not limited to zeolite, carbide, nitride, zirconium white, aluminum oxide, silica, aluminosilicate, phosphoric acid salt, titanium oxide, zinc oxide, vanadium oxide, lanthanum trioxide, yttrium oxide, Scium trioxide, magnesium oxide, cerium oxide, barium oxide, calcium oxide, oxyhydroxide, heteropolyacid, mineral acid, sour upgrading resin, alkali upgrading resin with and any combination.In some embodiments, condensation catalyst can also comprise modification agent.Suitable modification agent comprise La, Y, Sc, P, B, Bi, Li, Na, K, Rb, Cs, Mg, Ca, Sr, Ba with and any combination.In some embodiments, condensation catalyst can also comprise metal.Suitable metal comprises Cu, Ag, Au, Pt, Ni, Fe, Co, Ru, Zn, Cd, Ga, In, Rh, Pd, Ir, Re, Mn, Cr, Mo, W, Sn, Os, its alloy and any combination.

In certain embodiments, the catalyzer described in condensation reaction can comprise as above for the described support of the catalyst of hydrogenation.In certain embodiments, condensation catalyst is from load.Term used herein " from the load " meaning is that catalyzer does not need other material as carrier.In other embodiments, condensation catalyst is combined with the independent carrier that is suitable for support catalyst.In one embodiment, the carrier of condensation catalyst is silica.

The type of the condition of carrying out condensation reaction based on initial substance and required product and changing.Those skilled in the art should know for carrying out the suitable condition of this reaction under rights and interests of the present invention.In some embodiments, carry out condensation reaction at the thermodynamics of the reaction that plan is carried out at favourable temperature.The temperature of condensation reaction depend on specific initial polyvalent alcohol or alcohol and change.In some embodiments, the temperature of condensation reaction is in the scope of 80 ℃ to 500 ℃, and preferably in 125 ℃ to 450 ℃ scopes, and most preferably in 125 ℃ to 250 ℃ scopes.In some embodiments, under the pressure between 0Kpa to 9000Kpa in scope, and preferably between 0Kpa and 7000Kpa in scope, and more preferably between 0Kpa and 5000Kpa, under the pressure in scope, carry out condensation reaction.

The higher alkane formed by the present invention includes but not limited to have side chain or the straight-chain paraffin of 4 to 30 carbon atoms, side chain or normal olefine with 4 to 30 carbon atoms, the naphthenic hydrocarbon with 5 to 30 carbon atoms, the cycloolefin with 5 to 30 carbon atoms, aryl compound, fused-aryl compound, alcohol and ketone.Suitable alkane includes but not limited to butane, pentane, amylene, the 2-methylbutane, hexane, hexene, the 2-methylpentane, the 3-methylpentane, 2, the 2-dimethylbutane, 2, the 3-dimethylbutane, heptane, heptene, octane, octene, 2, 2, the 4-trimethylpentane, 2, the 3-dimethylhexane, 2, 3, the 4-trimethylpentane, 2, the 3-dimethylpentane, nonane, nonene, decane, decene, undecane, undecylene, dodecane, dodecylene, tridecane, tridecylene, the tetradecane, tetradecene, pentadecane, 15 carbenes, nonadecane, 19 carbenes, eicosane, eicosylene, heneicosane, heneicosene, docosane, two dodecylenes, tricosane, tricosene, tetracosane, tetracosene with and isomer.The applicable fuel of doing of some in these products.

In some embodiments, naphthenic hydrocarbon and cycloolefin are unsubstituted.In other embodiments, naphthenic hydrocarbon and cycloolefin are mono-substituted.In other embodiment again, naphthenic hydrocarbon and cycloolefin are polysubstituted.In the embodiment of the naphthenic hydrocarbon that comprises replacement and cycloolefin, substituted radical include but not limited to have the branched-chain or straight-chain alkyl of 1 to 12 carbon atom, the side chain with 1 to 12 carbon atom or straight-chain alkyl-sub-, phenyl with and any combination.Suitable naphthenic hydrocarbon and cycloolefin include but not limited to pentamethylene, cyclopentenes, hexanaphthene, tetrahydrobenzene, methyl-pentamethylene, methyl-cyclopentenes, ethyl-pentamethylene, ethyl-cyclopentenes, ethyl-hexanaphthene, ethyl-tetrahydrobenzene, its isomer and any combination.

In some embodiments, formed aryl compound is unsubstituted.In another embodiment, formed aryl compound is mono-substituted.In the embodiment of the aryl compound that comprises replacement, substituted radical include but not limited to have the branched-chain or straight-chain alkyl of 1 to 12 carbon atom, the side chain with 1 to 12 carbon atom or straight-chain alkyl-sub-, phenyl with and any combination.For suitable aryl compound of the present invention include but not limited to benzene,toluene,xylene, ethylbenzene, p-Xylol, m-xylene with and any combination.

The alcohol produced in the present invention has 4 to 30 carbon atoms.In some embodiments, alcohol is ring-type.In other embodiments, alcohol is side chain.In another embodiment, alcohol is straight chain.For suitable alcohol of the present invention include but not limited to butanols, amylalcohol, hexanol, enanthol, octanol, nonyl alcohol, decyl alcohol, undecyl alcohol, lauryl alcohol, tridecanol, tetradecyl alcohol, pentadecanol, hexadecanol, heptadecyl alcohol, stearyl alcohol, nonadecanol, eicosanol, two undecyl alcohols, behenyl alcohol, tricosanol, tetracosanol with and isomer.

The ketone produced in the present invention has 4 to 30 carbon atoms.In one embodiment, ketone is ring-type.In another embodiment, ketone is side chain.In another embodiment, ketone is straight chain.For suitable ketone of the present invention include but not limited to butanone, pentanone, hexanone, heptanone, octanone, nonanone, decanone, undecyl ketone, ten diketone, ten triketones, ten tetraketones, 15 ketone, 16 ketone, margarone, 18 ketone, 19 ketone, 20 ketone, two undecyl ketones, 20 diketone, tricosanone, 20 tetraketones with and isomer.

Another kind of this chemically modified is transesterify.Fatty acid component skewness in the glyceride of natural generation.For oils, transesterify refers between two ester groups of different glyceride carries out the acyl group exchange.Ester exchange method provides a kind of mechanism, and wherein the fatty acid component in the glyceride mixture can be through resetting, so that distribution pattern is adjusted.Transesterify is the chemical process of knowing, and for example generally comprises under catalyzer (for example, such as basic metal or alkali metal alkyl compound (sodium methylate)) exists, by oils mixture heating (to approximately 200 ℃) for some time (30 minutes).This method can be for making the distribution pattern randomization of oils mixture fatty acid component, or can be for generation of required distribution pattern.Can carry out this method of lipid being carried out to chemically modified to the material that provides (microbial biomass such as lipid per-cent (take dry cell weight) as at least 20%) herein.

Can get off to carry out take the directed inter-esterification that the specific distribution pattern of lipid acid is purpose by the temperature below the fusing point that the oils mixture is maintained to some TAG that may exist.This makes these TAG selective crystallizations, because the TAG crystallization is removed effectively from reaction mixture.This process can continue until for example the most of lipid acid in oils be settled out.The directed inter-esterification method can be used to for example by with short chain fatty acid, replacing longer chain fatty acid, produce the product had than calorie contents.Directed inter-esterification can also be used to produce the product with fats mixt, and described fats mixt can be provided in the required pre-arcing characterisitics of for example, seeking in foodstuff additive or product (oleomargarine) and constitutional features and without the hydrogenation of understand the trans-isomer(ide) that generation do not expect.

The transesterify of the oils produced by method as herein described can be combined and carry out with one or more methods and/or material, or for the production of product, as reported in following patent: United States Patent (USP) the 6th, 080, No. 853 (substitute of Nondigestible fat); The 4th, 288, No. 378 (peanut butter stablizer); The 5th, 391, No. 383 (edible spray oil); The 6th, 022, No. 577 (for the edible-fat of food); The 5th, 434, No. 278 (for the edible-fat of food); The 5th, 268, No. 192 (nut products of low calory); The 5th, 258, No. 197 (calorie edible composition reduced); The 4th, 335, No. 156 (edible-fat product); The 7th, 288, No. 278 (foodstuff additive or medicament); The 7th, 115, No. 760 (fractionating method); The 6th, 808, No. 737 (structural fatty); 5,888, No. 947 (engine lubricant); The 5th, 686, No. 131 (edible oil mixture); And the 4th, 603, No. 188 (curable carbamate composition).

According in one embodiment of the invention, after oils transesterification as described above, make to react through product and the polyvalent alcohol of transesterification, as United States Patent (USP) the 6th, institute reports in 465, No. 642, to produce polyol fatty acid polyester.This esterification and separation method can comprise the following steps: to make lower alkyl esters and polyol reaction under soap exists; Remove remaining soap from product mixtures; Product mixtures is carried out water washing and makes its drying to remove impurity; By product mixtures bleaching with for refining; Polyol fatty acid polyester in product mixtures and the unreacted lower alkyl esters of at least a portion are separated; And make the unreacted lower alkyl esters through separating carry out recirculation.

Can also carry out transesterification to the microbial biomass with short-chain aliphatic ester, as United States Patent (USP) 6,278, institute reports in 006.In general, short-chain aliphatic ester is joined to oils under can existing by the catalyzer suitable in and mixture is heated to carry out transesterification.In some embodiments, approximately 5 % by weight that oils accounts for reaction mixture are to about 90 % by weight.In some embodiments, approximately 10 % by weight that short-chain aliphatic ester can account for reaction mixture are to about 50 % by weight.The limiting examples of catalyzer comprises that alkaline catalysts, sodium methylate, acid catalyst (comprise mineral acid, such as sulfuric acid and acidified clay, organic acid, such as methanesulfonic, Phenylsulfonic acid and toluenesulphonic acids) and acidic resins (such as Amberlyst 15).Metal (such as sodium and magnesium) and metal hydride are also useful catalyzer.

Another kind of this chemically modified is hydroxylation, comprises water is added on two keys, so that its saturated and introducing hydroxylic moiety.Hydroxylacion method provides the mechanism that one or more fatty acid components of glyceride is changed into to hydroxy fatty acid.For example can pass through United States Patent (USP) the 5th, the method for report is carried out hydroxylation in 576, No. 027.Through hydroxylated lipid acid, comprise Viscotrol C and its derivative, can be as the component in multiple industrial application, comprise foodstuff additive, tensio-active agent, pigment wetting agent, foam killer, waterproof additive, softening agent, cosmetic emulsifier and/or reodorant, and the component in electricity, pharmacy, paint, ink, tackiness agent and lubricant.An example that glyceryl ester is carried out to hydroxylated mode is as follows: fat can be heated together with heptane, preferably be heated to approximately 30 ℃-50 ℃, and keep 30 minutes at described temperature or the longer time; Then acetic acid is joined in mixture, add subsequently aqueous sulfuric acid, in 1 hour, aqueous hydrogen peroxide solution is joined to mixture with less increment subsequently; After adding aqueous hydrogen peroxide solution, then temperature be increased at least about 60 ℃ and stir at least 6 hours; After stirring, make mixture standing, and remove the bottom water layer that dereaction forms, be that the top heptane layer that approximately hot water of 60 ℃ forms reaction is washed by temperature simultaneously; Heptane layer to the pH value of then having washed with potassium hydroxide aqueous solution neutralization is approximately 5 to 7, then by distilling and remove in a vacuum; Then make the reaction product drying under vacuum, and by dry product steam deodorizing under vacuum condition under 100 ℃, and utilize diatomite in approximately being filtered under 50 ℃ to 60 ℃.

The hydroxylation of the microorganism oils produced by method as herein described can be combined and carry out with one or more methods and/or material, or for the production of product, as reported in following patent: United States Patent (USP) the 6th, 590, No. 113 (oil-based paint and ink); The 4th, 049, No. 724 (hydroxylacion method); The 6th, 113, No. 971 (olive grease); The 4th, 992, No. 189 (lubricant and lubricating substance additive); The 5th, 576, No. 027 (through hydroxylated milk); And the 6th, 869, No. 597 (makeup).

Can be converted to estolide through hydroxylated glyceride.Estolide is comprised of glyceride, in described glyceride, through another fatty acid molecule of the esterified one-tenth of hydroxylated fatty acid component.Can be by glyceride being heated up with the mixture of lipid acid and making this mixture contact to make with mineral acid to change into estolide through hydroxylated glyceride, as Isbell etc., JAOCS71 (2): 169-174 (1994) is described.Estolide can, for multiple application, include but not limited to the application of reporting in following patent: United States Patent (USP) the 7th, 196,124 (elastomer material and floor covers); 5,458,795 (for the thickened oilss of high temperature application); 5,451,332 (for the fluids of industrial application); 5,427,704 (fuel dopes); And 5,380,894 (lubricant, grease, softening agent and printing ink).

Another kind of this chemically modified is olefin metathesis.In olefin metathesis, catalyzer cuts off alkylidene carbon in alkene (alkene) and by making it match to form new alkene from different alkylidene carbon separately.Olefin metathesis reaction provides the mechanism of following process, described process such as by vinyl alcohol, decompose by the unsaturated fatty acids alkyl chain at the alkene place, block, by from metathesis, by the alkene key, making lipid acid crosslinked, and by with derivatize alkene, being intersected metathesis, new functional group is incorporated on lipid acid.

In conjunction with other reaction (such as transesterification and hydrogenation), olefin metathesis can make unsaturated glyceride change into different final products.These products comprise glyceride oligomer (for wax); Short chain glyceride (for lubricant); Homotype difunctionality and special-shaped difunctionality alkyl chain (for chemical and polymkeric substance); Short-chain ester (for biofuel); And short hydrocarbon (for rocket engine fuel).Can for example use United States Patent (USP) the 7th, the Catalyst And Method of reporting in No. 2010/0145086th, 119, No. 216, No. 2010/0160506th, U.S. Patent Publication and U.S. Patent Publication carries out olefin metathesis to triacylglycerol and derivative of fatty acid.

During the olefin metathesis of biological oils generally comprises and has (intersection metathesis) at other alkene or do not exist under (from metathesis) the Ru catalyst solution is joined to unsaturated fatty acid ester with the charge capacity of about 10ppm to 250ppm under inert conditions.Usually the distribution that makes reaction carry out several hours to several days and finally produce olefin product.Can carry out the example of mode of olefin metathesis to derivative of fatty acid as follows: can be by first-generation Ge Labu catalyzer (GrubbsCatalyst) (dichloro-[2 (1-methyl ethoxy-α-O) phenyl] methylene radical-α-C] (thricyclohexyl-phosphine)) solution in toluene with the catalyst loadings of 222ppm, join in the container held through degassed and dry Witconol 2301.Then with the ethylene gas of about 60psig by the container pressurization and at approximately 30 ℃ or lower than approximately keeping 3 hours under 30 ℃, can produce whereby the approximately 9-decylenic acid methyl esters of 50% productive rate.

The olefin metathesis of the oils produced by method as herein described can be combined and carry out with one or more methods and/or material, or for the production of product, as reported in following patent: patent application PCT/US07/081427 (alpha-olefin lipid acid) and U.S. Patent application the 12/281st, No. 938 (oil emulsifiable paste), the 12/281st, No. 931 (paintball gun capsule), the 12/653rd, No. 742 (softening agent and lubricant), the 12/422nd, No. 096 (difunctionality organic compound), and the 11/795th, No. 052 (candle wax).

Other chemical reaction that can carry out microorganism oils comprises makes triacylglycerol react to increase mobility and/or oxidative stability with cyclopropanation reagents, and as United States Patent (USP) 6,051, institute reports in 539; Produce wax from triacylglycerol, as United States Patent (USP) 6,770, institute reports in 104; And the epoxidation of triacylglycerol; as at " The effect of fatty acidcomposition on the acrylation kinetics of epoxidized triacylglycerols "; Journal of the American Oil Chemists ' Society; 79:1; 59-63; and Free Radical Biology and Medicine (2001), 37:1, in 104-114 (2004), institute reports.

Generation for the oleaginous microorganism biomass of fuel and chemical products makes it possible to produce the degreasing biomass powder as described above.Spent meal is the by product in preparation algae oils, and can be used as the animal-feed of farming animals (for example ruminating animal, poultry, pig and aquatic animal).Although resulting powder oil-contg reduces, other nutrient substance that still contains high-quality protein, carbohydrate, fiber, ash, irreducible oil and be applicable to animal-feed.Owing to making the cell overwhelming majority dissolve by the oils separation method, so spent meal is easy to by these animal digestions.Optionally can be in animal-feed, by spent meal and other composition (such as cereal) combination.Because spent meal has pulverous denseness, so can utilize the extrusion machine of commercially available acquisition or the machine of spreader or another kind of type that it is squeezed into to the ball shape.

The present invention to above-detailed in the following example carries out example, and described embodiment is only for the present invention is described, and claimed the present invention is not construed as limiting.

VII. embodiment

Embodiment 1: the method for cultivating former algae

The strain of former Trentepohlia algae is cultivated, to produce the oils of high per-cent (with dry cell weight).The cell of cryopreservation is melted under room temperature, and 500 μ l cells are joined to 4.5ml substratum (4.2g/L K ₂hPO ₄, 3.1g/L NaH ₂pO ₄, 0.24g/L MgSO ₄7H ₂o, 0.25g/L citric acid monohydrate compound, 0.025g/L CaCl ₂2H ₂o, 2g/L yeast extract)+2% glucose in, and make cell in 6 well culture plates under 28 ℃ the lower growth of vibration (200rpm) 7 days.By the 1ml culture is measured to dry cell weight in centrifugal 5 minutes with 14,000rpm in preweighted Eppendorf tube.Discard culture supernatants, and with the resulting cell precipitation thing of 1ml deionized water wash.Again that culture is centrifugal, abandoning supernatant, and the cell precipitation thing is placed under-80 ℃ until freezing.Then make sample freeze-drying 24 hours and calculate dry cell weight.In order to measure the lipid total amount in culture, take out the 3ml culture and utilize Ankom system (Ankom Inc., Macedon, NY) to be analyzed according to the scheme of manufacturers.Utilize Amkom XT10 extractor, according to the scheme of manufacturers, sample is carried out to solvent extraction.The lipid total amount is measured as through acid-hydrolyzed dry sample and through the mass discrepancy between the dry sample of solvent extraction.The measuring result that oils accounts for the per-cent of dry cell weight is showed in table 10.

Table 10. is in the oils per-cent of dry cell weight

Species	The algae strain	% oils
			The stagnant former algae of harmony	UTEX?327	13.14
The former algae of mulberry fruit shape	UTEX?1441	18.02
			The former algae of mulberry fruit shape	UTEX?1435	27.17

Micro-algae sample to the multiple algae strain that derives from former Trentepohlia carries out gene type assay.Isolation of genomic DNA from algae bio matter as follows.From liquid culture by cell (about 200mg) with 14,000 * g centrifugal 5 minutes.Then re-suspended cell in sterile distilled water, with centrifugal 5 minutes of 14,000 * g abandoning supernatant.The single granulated glass sphere of diameter 2mm is joined in biomass, and test tube is placed at least 15 minutes under-80 ℃.Shift out sample, and add 150 μ l grinding buffer solutions (1% sarcosyl, 0.25M sucrose, 50mM NaCl, 20mM EDTA, 100mM Tris-HCl (pH 8.0), ribonuclease A 0.5 μ g/ μ l).Revolve and make throw out resuspended by Duan Zan Vortex, add subsequently 40 μ l 5M NaCl.Short temporary Vortex revolves sample, adds subsequently 66 μ l 5%CTAB (cetyl trimethylammonium bromide) and carry out final short temporary Vortex to revolve.Then sample is hatched 10 minutes under 65 ℃ to 14,000 * g centrifugal 10 minutes afterwards.Supernatant liquor is transferred in new test tube and with the 300 μ l phenol of 12: 12: 1: chloroform: primary isoamyl alcohol extracts once, with 14,000 * g centrifugal 5 minutes subsequently.Resulting water is transferred in the new test tube that contains 0.7 volume Virahol (approximately 190 μ l), puts upside down mixed being incorporated under room temperature and hatch 30 minutes or hatch whole night under 4 ℃.By with 14,000 * g, within centrifugal 10 minutes, reclaiming DNA.Then use the resulting throw out twice of 70% washing with alcohol, carry out last washing with 100% ethanol subsequently.By throw out dry air 20 minutes to 30 minutes at room temperature, be resuspended in subsequently in 50 μ l10mM TrisCl, 1mM EDTA (pH 8.0).

By the total algae DNA of 5 μ l of preparation as described above dilution in 1: 50 in 10mM Tris (pH 8.0).The following setting of PCR reaction that final volume is 20 μ l.By 10 μ l 2 * iProofHF masterbatches (BIO-RAD) join 0.4 μ l primer SZ02613 (5 '-TGTTGAAGAATGAGCCGGCGAC-3 ' (SEQ ID NO:9), stock concentrations is 10mM) in.This primer sequence is from the position 567-588 in gene pool accession number L43357 and conservative higher plant and algae plastom camber.Add subsequently 0.4 μ l primer SZ02615 (5 '-CAGTGAGCTATTACGCACTC-3 ' (SEQ ID NO:10), stock concentrations is 10mM).The position 1112-1093 complementation of this primer sequence and gene pool accession number L43357, and conservative higher plant and algae plastom camber.Then add total DNA and the 3.2 μ l dH of 5 μ l through dilution ₂o.The PCR reaction is carried out as follows: 98 ℃, and 45 "; 98 ℃, 8 "; 53 ℃, 12 "; 72 ℃, 20 ", carry out 35 circulations, 72 ℃ continue 1 minute and remain on 25 ℃ subsequently.For purified pcr product, add 20 μ l 10mM Tris (pH 8.0) in each reactant, use subsequently the 40 μ l phenol of 12: 12: 1: chloroform: primary isoamyl alcohol is extracted that ， Vortex revolves and with 14,000 * g centrifugal 5 minutes.The PCR reactant is put on to S-400 post (GE Healthcare), and with 3,000 * g centrifugal 2 minutes.Subsequently purified PCR product TOPO is cloned into to PCR8/GW/TOPO, and select positive colony on the LB/Spec culture plate.Utilize M13 forward and reverse primer to carry out two-way order-checking to purified plasmid DNA.Altogether the strain of 12 kinds of former Trentepohlia algaes is selected to its 23SrRNA DNA is checked order, and these sequences are listed in sequence table.Hereinafter comprise the general introduction of algae strain and sequence table numbering.Total difference to these sequences and UTEX 1435 (SEQ ID NO:15) sequence is analyzed.The sequence (UTEX 329/UTEX1533 and UTEX 329/UTEX 1440) that two pairs of difference maximums occurred.In both cases, the result of comparing in pairs is 75.0% paired sequence identity.Hereinafter also comprise the sequence identity per-cent with UTEX 1435:

Utilize HPLC to carry out the analysis of lipid kenel to the lipid sample of the subset of above listed algae strain.The results are shown in following table 11.

The diversity of lipid chain in the former Trentepohlia species of table 11.

Carotenoid, chlorophyll, tocopherol, other sterol and the tocotrienols in the oils of (by solvent extraction or use squeezing machine) extracted in analysis from the former algae UTEX 1435 of mulberry fruit shape.The results are summarized in following table 12.

The analysis of table 12. pair carotenoid, chlorophyll, tocopherol/sterol and tocotrienols that the oils of extracting from the former algae of mulberry fruit shape (UTEX 1435) is carried out.

Application standard vegetables oil working method is refined and is bleached four batches of independent oils of extracting from the former algae of mulberry fruit shape.In brief, purify the thick oils of extracting in horizontal decanting vessel from the former algae of mulberry fruit shape, in horizontal decanting vessel, solid separates with oils.Then will be transferred in the storage tank with citric acid and water through the oils purified and by its standing approximately 24 hours.After 24 hours, mixture forms 2 independent layers in storage tank.Bottom consists of water and colloid, then by decant, bottom is removed, and will transfer in bleaching tank through the oils of coming unstuck afterwards.Then together with the citric acid of oils and other doses, heat.Then bleaching clay is joined in bleaching tank, and under vacuum further heated mixt to evaporate any water existed.Then pump mixture to remove bleaching clay via leaf filter.Then make the oils through filtering pass through 5 final μ m fine filters, then collected to store until use.Then analyze carotenoid, chlorophyll, sterol, tocotrienols and tocopherol in the oils through refining and bleach (RB).The results are summarized in following table 13 of these analyses." Nd " means not detect and detection sensitivity is listed in hereinafter:

Detection sensitivity

Carotenoid (mcg/g) nd=<0.003mcg/g

Chlorophyll (mcg/g) nd=<0.03mcg/g

Sterol (%) nd=0.25%

Tocopherol (mcg/g); Nd=3mcg/g

Table 13. pair carotenoid, chlorophyll, sterol, tocotrienols and the tocopherol analysis through the former algae oils of mulberry fruit shape of refining and bleach, carried out.

Also the former algae oils of identical four batches of mulberry fruit shapes is carried out trace element analysis and be the results are summarized in following table 14.

The table 14. pair ultimate analysis of carrying out through the former algae oils of mulberry fruit shape of refining and bleach.

Embodiment 2: the general method that former algae is carried out to via Particle Bombardment Transformation

Prepare Seashell gold microcarrier (550 nanometer) according to the scheme of manufacturers.Plasmid (20 μ g) is mixed with 50 μ l binding buffer liquid and 60 μ l (30mg) S550d gold carrier, and hatch on ice 1 minute.Add precipitation buffering liquid (100 μ l), and mixture is hatched on ice 1 minute again.The Vortex supination, by rotating 10 seconds so that scribble the solids precipitation of DNA with 10,000rpm in Eppendorf tube 5415C.With the cold 100% washing with alcohol gold throw out of 500 μ l once, in Eppendorf tube, of short duration rotation makes its precipitation, and resuspended with the ice-cold ethanol of 50 μ l.After of short duration (1-2 second) sonic treatment, immediately 10 μ l are scribbled to the transfer of granules of DNA to carrier film.

Make the strain of former Trentepohlia algae grow in proteose substratum (2g/L yeast extract, 2.94mM NaNO on the Oscillation device ₃, 0.17mM CaCl ₂2H ₂o, 0.3mM MgSO ₄7H ₂o, 0.4mM K ₂hPO ₄, 1.28mM KH ₂pO ₄, 0.43mM NaCl) and 2% glucose in until its cell density reaches 2 * 10 ⁶till individual cells/ml.Collecting cell, with the sterile distilled water washing once, and be resuspended in 50 μ l substratum.By 1 * 10 ⁷individual cell is applied to 1/3rd zones, centre of non-selective proteose culture plate.With PDS-1000/He particle gun particle delivery system (Bio-Rad) bombardment cell.Video disc (1350psi) is split in use, and culture plate is placed on to 6cm place below screen/huge carrier accessory.Make cell recovery 12 hours-24 hours under 25 ℃.After recovery, with vulcanite scraper, from culture plate, scrape cell, mix with 100 μ l substratum, and be applied on the culture plate that contains suitable microbiotic selection.Hatch 7-10 days under 25 ℃ after, can see the group of representative through the cell of conversion on culture plate.Picking group, and point sample carries out second and takes turns selection on selectivity (microbiotic or carbon source) agar plate.

Embodiment 3: the conversion of chlorella

vector construction

BamHI-SacII fragment (the SEQ ID NO:152 that will contain CMV promotor, hygromycin resistance cDNA and CMV 3 ' UTR, the subsequence of pCAMBIA1380 carrier, Cambia, Canberra, Australia) be cloned in the BamHI of pBluescript and SacII site and be called in this article pHyg.

chlorella is carried out to via Particle Bombardment Transformation

Prepare S550d gold carrier (from Seashell Technology) according to the scheme of manufacturers.Linearizing pHyg plasmid (20 μ g) is mixed with 50 μ l binding buffer liquid and 60 μ l (30mg) S550d gold carrier, and hatch on ice 1 minute.Add precipitation buffering liquid (100 μ l), and mixture is hatched on ice 1 minute again.The Vortex supination, by rotating 10 seconds so that scribble the solids precipitation of DNA with 10,000rpm in Eppendorf tube 5415C.With the cold 100% washing with alcohol gold throw out of 500 μ l once, in Eppendorf tube, of short duration rotation makes its precipitation, and resuspended with the ice-cold ethanol of 50 μ l.After of short duration (1-2 second) sonic treatment, immediately 10 μ l are scribbled to the transfer of granules of DNA to carrier film.

With 75 μ mol photon m ^-2sec ^-1carry out under continuous illumination making original chlorella culture (University of Texas's culture collection center 250) to grow on the Oscillation device in proteose substratum (2g/L yeast extract, 2.94mM NaNO3,0.17mM CaCl22H2O, 0.3mM MgSO47H2O, 0.4mM K2HPO4,1.28mM KH2PO4,0.43mMNaCl) until its cell density reaches 2 * 10 ⁶till individual cells/ml.Collecting cell, with the sterile distilled water washing once, and be resuspended in 50 μ l substratum.By 1 * 10 ⁷individual cell is applied to 1/3rd zones, centre of non-selective proteose culture plate.With PDS-1000/He particle gun particle delivery system (Bio-Rad) bombardment cell.Video disc (1100psi and 1350psi) is split in use, and culture plate is placed on to 9cm and 12cm place below screen/huge carrier accessory.Make cell recovery 12 hours-24 hours under 25 ℃.After recovery, with vulcanite scraper, from culture plate, scrape cell, mix with 100 μ l substratum, and be applied on the culture plate (200 μ g/ml) that contains Totomycin.Hatch 7-10 days under 25 ℃ after, 1100psi and 1350psi splits on video disc and the culture plate of 9cm and 12cm distance on can see the group of representative through the cell that transforms.Picking group, and point sample carries out second and takes turns selection on the selectivity agar plate.

by electroporation, chlorella is transformed

With 75 μ mol photon m ^-2sec ^-1carry out under continuous illumination on the Oscillation device, making original chlorella culture grow until its cell density reaches 2 * 10 in the proteose substratum ⁶till individual cell/ml.Collecting cell, with the sterile distilled water washing once, and with 4 * 10 ⁸the density of individual cell/ml be resuspended in the tris-phosphate buffered saline buffer that contains 50mM sucrose (20mMTris-HCl, pH 7.0; The 1mM potassiumphosphate) in.By the about cell suspending liquid (1 * 10 of 250 μ l ⁸individual cell) be placed in the disposable electroporation sulculus in 4mm gap.Add 5 μ g linearizing pHyg plasmid DNA and 200 μ g carrier DNAs (salmon sperm DNA of having sheared) in cell suspending liquid.Then the electroporation sulculus is hatched 10 minutes in water bath under 16 ℃.Then use gene pulse device II (Bio-Rad Labs, Hercules, CA) electroporation device to apply electricimpulse (1100V/cm) with the electric capacity (for electroporation, not using divert shunt resistor) of 25 μ F to sulculus.Then sulculus is at room temperature hatched 5 minutes, cell suspending liquid is transferred in 50ml proteose substratum afterwards, and vibrate 2 days on the Oscillation device.After recovery, by the low-speed centrifugal collecting cell, be resuspended in the proteose substratum, and be seeded on the culture plate that is supplemented with 200 μ g/ml Totomycin with low density.With 75 μ mol photon m ^-2sec ^-1carry out hatching culture plate under continuous illumination.Transformant occurred as group in 1 week-2 weeks.Picking group, and point sample carries out second and takes turns selection on the selectivity agar plate.

gene type assay

Small volume is cultivated and to be withstood the second group's subset and collection of taking turns selection.Tong Guo Vortex revolves the about throw out of 5 μ L-10 μ L volumes is resuspended in 50 μ L 10mM NaEDTA, then under 100 ℃, hatches 10.Then Duan Zan Vortex revolves test tube and carries out sound wave and process 10 seconds, then with 12,000 * g centrifugal 1 minute.In 50 μ L PCR reactions, use 2 μ L supernatant liquors as template.Primer for gene type assay is SEQ ID NO:153 and SEQ ID NO:154.The PCR condition is as follows: 95 ℃, continue 5 minutes * 1 circulation; 95 ℃, continue 30 seconds-58 ℃, continue 30 seconds-72 ℃, continue 30 seconds again * 35 circulations in 1 minute; 72 ℃, continue 10 minutes * 1 circulation.From the particle gun method with find the 992bp fragment of expection in from 6 groups in 10 groups of single electroporation group.All there is the non-specific band of low size in all swimming lanes.In order to determine the identity of the 992bp fragment increase, from gel, cut two particle gun bands and electroporation band and individually checked order.The sequence of all three bands is corresponding to the 992bp fragment of expection.(DNA molecular amount standard:

all Purpose dNA molecular amount standard, catalog number (Cat.No.) BN2050).

Embodiment 4: for the promotor that is derived from algae and the gene of micro-algae

A. 5 ' UTR and promoter sequence from original chlorella

The Application standard technology produces cDNA library from the original chlorella (UTEX 250) of the health length of holding concurrently.Based on the cDNA sequence, use in the house-keeping gene that the DNA walking kit (Rockville, MD) of Seegene is known at some and design primer with upstream of coding region " step is moved ".The sequence of separating comprises Actin muscle (SEQ ID NO:155) and elongation factor-1a (EF1a) (SEQ ID NO:156) promotor/UTR (initiation site (being runic) that both contains intron (as with as shown in small letters) and exon (uppercase of italic) and prediction) and two beta-tubulin promoter/UTR element: hypotype A (SEQ ID NO:157) and hypotype B (SEQ ID NO:158).

B. lipid biosynthetic enzyme and plastid target sequence from original chlorella

From above-mentioned cDNA library, use and bring into play three cDNA of the protein of function with identical method clones coding mentioned above in original chlorella (UTEX 250) lipid metabolism.Sequence table comprises nucleotide sequence and the aminoacid sequence of acyl group ACP desaturase (SEQ ID NO:159 and 160) and two kinds of geranyl geranyl diphosphate synthases (SEQ ID NO:161-164) hereinafter.In addition, three cDNA of the supposition signal sequence with target plastid have also been cloned.Sequence table comprises nucleotide sequence and the aminoacid sequence of glyceraldehyde-3-phosphate dehydrogenase (SEQ ID NO:165 and 166), oxygen evolution complex albumen OEE33 (SEQ ID NO:167 and 168) and Clp proteolytic enzyme (SEQ ID NO:169 and 170) hereinafter.In nucleotide sequence and aminoacid sequence, supposition character body target sequence has added underscore.Can use the plastid of plastid target sequence render transgenic product targeted microorganisms, described product is as lipid-modified enzyme.

Embodiment 5: to original chlorella, carry out genetically engineered so that it expresses exogenous invertase

algae strain and substratum:obtain original chlorella (UTEX 250) from the algal cultures preservation center (Austin, TX, USA) of University of Texas.The Primary spawn thing is maintained in the proteose substratum through improvement.Proteose substratum through improvement is comprised of following: every liter of 0.25g NaNO ₃, 0.09g K ₂hPO ₄, 0.175g KH ₂pO ₄0.025g, 0.025gCaCl ₂2H ₂o, 0.075g MgSO ₄7H ₂o and 2g yeast extract (g/L).

plasmid construction:for the saccharase of expression-secretion form in original chlorella, make Saccharomyces Cerevisiae in S UC2 gene under three kinds of different promotors are controlled: cauliflower mosaic virus 35 S promoter (CMV), chlorella virus prompters (NC-1A) and chlorella HUP1 promotor.Synthetic yeast SUC2 gene is to provide the codon be optimized for original chlorella to use and to comprise the required signal sequence of guiding saccharase cell exocrine.Set up each construct in pBluescript KS+, and use Auele Specific Primer respectively EcoRI/AscI, AscI/XhoI and XhoI/BamHI site to be incorporated in each promotor, invertase gene and CMV 3 ' UTR by pcr amplification.Sequentially clone purified PCR product.

original chlorella is transformed:on the Oscillation device with 75 μ mol photon m ^-2sec ^-1carry out under continuous illumination making original chlorella culture to grow until its cell density reaches 6 * 10 in the proteose substratum through improvement ⁶till individual cell/ml.

For via Particle Bombardment Transformation, according to the scheme of manufacturers, prepare S550d gold carrier (from Seashell Technology).In brief, linearizing construct (20 μ g) (BsaI) is mixed with the S550d gold carrier of 50 μ l binding buffer liquid and 60 μ l (3mg), and hatch on ice 1 minute.Add precipitation buffering liquid (100 μ l), and mixture is hatched on ice 1 minute again.Shi Du Vortex supination, by rotating 10 seconds so that scribble the solids precipitation of DNA with 10,000rpm in Eppendorf tube.With the cold 100% washing with alcohol gold throw out of 500 μ l once, in Eppendorf tube, of short duration rotation makes its precipitation, and resuspended with the ice-cold ethanol of 50 μ l.After of short duration (1-2 second) sonic treatment, immediately 10 μ l are scribbled to the transfer of granules of DNA to carrier film.Collecting cell, with sterile distilled water washing once, be resuspended in 50 μ l substratum (1 * 10 ⁷and be applied to 1/3rd zones, centre of non-selective proteose culture plate individual cell).With PDS-1000/He particle gun particle delivery system (Bio-Rad) bombardment cell.Video disc (1100psi and 1350psi) is split in use, and culture plate is placed on to 9cm-12cm place below screen/huge carrier accessory.Make cell 12 hours-24 hours under 25 ℃.After recovery, with vulcanite scraper, from culture plate, scrape cell, mix with 100 μ l substratum, and be applied on the proteose culture plate through improvement with 1% sucrose.Hatch 7-10 days in dark place under 25 ℃ after, can see the group of representative through the cell of conversion on culture plate.

For being transformed with electroporation, collecting cell, with the sterile distilled water washing once, and with 4 * 10 ⁸the density of individual cells/ml be resuspended in the Tris-phosphate buffered saline buffer that contains 50mM sucrose (20mM Tris-HCl, pH 7.0; The 1mM potassiumphosphate) in.By the about cell suspending liquid (1 * 10 of 250 μ l ⁸individual cell) be placed in the disposable electroporation sulculus in 4mm gap.Add 5 μ g linearization plasmid DNA and 200 μ g carrier DNAs (salmon sperm DNA of having sheared) in cell suspending liquid.Then the electroporation sulculus is hatched 10 minutes in the frozen water bath under 16 ℃.Then use gene pulse device II (Bio-Rad Labs, Hercules, CA) electroporation device to apply electricimpulse (1100V/cm) with the electric capacity (for electroporation, not using divert shunt resistor) of 25 μ F to sulculus.Then sulculus is at room temperature hatched 5 minutes, afterwards cell suspending liquid is transferred in the proteose substratum of 50ml through improvement, and vibrate 2 days on the Oscillation device.After recovery, with low speed (4000rpm) collecting cell, be resuspended in the proteose substratum through improvement, and be seeded on the proteose culture plate through improvement with 1% sucrose with low density.Hatch 7-10 days in dark place under 25 ℃ after, can see the group of representative through the cell of conversion on culture plate.

screening transformant and gene type assay:from the picking group through the proteose culture plate of improvement with 1% sucrose of dark place growth, and the cell of about same amount is transferred to and contains in 24 well culture plates of the proteose liquid nutrient medium through improvement that 1ml has 1% sucrose.Culture is remained on to dark place and vibrate 5 days with 430rpm by rotary type vibrator (Labnet, Berkshire, UK).

In order to confirm to introduce the existence of the invertase gene in the chlorella transformant, isolate the DNA of each transformant and with one group of gene-specific primer (CMV construct: forward primer (CAACCACGTCTTCAAAGCAA) (SEQ ID NO:153)/reverse primer (TCCGGTGTGTTGTAAGTCCA) (SEQ ID NO:171) that increased; CV construct: forward primer (TTGTCGGAATGTCATATCAA) (SEQ ID NO:172)/reverse primer (TCCGGTGTGTTGTAAGTCCA) (SEQ ID NO:171); And HUP1 construct: forward primer (AACGCCTTTGTACAACTGCA) (SEQ ID NO:173)/reverse primer (TCCGGTGTGTTGTAAGTCCA) (SEQ ID NO:171)).Separate for rapid DNA, the cell of certain volume (the about 5-10 μ of volume L) is resuspended in 50 μ L 10mMNa-EDTA.At 100 ℃ of lower incubated cell suspension 10 minutes and sound wave, process 10 seconds.With 12000g, after centrifugal 1 minute, use 3 μ L supernatant liquors to carry out the PCR reaction.Carry out pcr amplification in DNA thermo cycler (Perkin-Elmer GeneAmp 9600).According to the specification sheets of manufacturers, reaction mixture (50 μ L) contains DNA, 100pmol each above-mentioned corresponding primer, 200 μ M dNTPs, 0.5 unit Taq archaeal dna polymerase (NEB) and the Taq DNA polymerase buffer liquid of 3 μ L through extracting.Make the DNA sex change 5 minutes under 95 ℃, continue first circulation, then continue 30 seconds.Respectively under 58 ℃ (30 seconds) and under 72 ℃ (1 minute) carry out primer annealing and extend reaction.Then make the PCR product manifest on 1% sepharose with ethidium bromide staining.

in liquid culture, grow:after in the dark growing five days, the transformant of the genotype positive can in the dark be utilized indivisible liquid proteose substratum+1% sucrose growth, and wild-type cell in the dark can not be grown in same medium.

Embodiment 6: with the secretor type saccharase that stems from yeast saccharomyces cerevisiae, transform the strain of algae algae

the secretor type saccharase:gene (gene pool accession number NP_012104 by coding secretor type invertase, come from yeast saccharomyces cerevisiae) again synthesize 1599bp Asc I-Xho fragment, subsequently by described fragment subclone to the pUC19 derivative with cauliflower mosaic virus 35s promotor and 3 ' UTR (being respectively EcoR I/Asc I and Xho/Sac I box).

the growth of alga cells:the substratum used in these experiments is liquid base substratum (2g/L yeast extract, 2.94mM NaNO ₃, 0.17mM CaCl ₂2H ₂o, 0.3mMMgSO ₄7H ₂o, 0.4mM K ₂hPO ₄, 1.28mM KH ₂pO ₄, 0.43mM NaCl) and contain the solid-based basal culture medium (+1.5% agarose) that the ultimate density that is sucrose or glucose (as specified) form is 1% fixed carbon.The algae strain of using in this experiment is not in the dark in the situation that exist other fixedly carbon source can not utilize the basic medium growth.By the species streak inoculation on culture plate, and make its in the dark under 28 ℃ the growth.The single group of picking and the liquid base substratum that contains 1% glucose for inoculating 500mL, and it is in the dark grown until logarithmic growth mid-term is measured cell counting every day.Previous in the dark utilizing sucrose as the growth that carbon source is only arranged, following each algae strain to be tested and these algae strains all can not be grown, and therefore be selected with for being transformed with the secretor type saccharase: (1) original chlorella (UTEX 31); (2) atomic chlorella (UTEX 2341); And (3) chlorella (CCAP 211/15) that swims.

by particle bombardment, alga cells is transformed:enough cultures is centrifugal to obtain about 1-5 * 10 altogether ⁸individual cell.With not adding the fixedly basic medium of carbon source to wash resulting throw out.Be resuspended in and be enough to reach 5 * 10 by cell centrifugation and by throw out again ⁷individual to 2 * 10 ⁸in the basic medium of the volume of individual cells/ml.Then be seeded on the solid-based basal culture medium that is supplemented with 1% sucrose by 250-1000 μ l cell and make it dry in aseptic cover on culture plate.According to manufacturer's recommendation (Seashell Technology, La Jolla, CA), plasmid DNA is deposited on gold particle.Use BioRad PDS He-1000 particle delivery system, utilize the video disc that splits of 1350psi, in the situation that huge carrier accessory is split to being transformed apart from being set in 9cm of video disc fixer apart.After conversion, in the dark under 28 ℃, hatch culture plate.All algae strains all produce a plurality of transformant group.In the situation that insert and transformed without saccharase, but the contrast culture plate prepared in addition in the same manner is containing group.

analysis to original chlorella transformant:extract as follows genomic dna from original chlorella wild-type cell and transformant group: cell is resuspended in 100 μ l Extraction buffers (87.5mM Tris Cl (pH 8.0), 50mM NaCl, 5mM EDTA (pH 8.0), 0.25%SDS) and hatches under 60 ℃, wherein mixed by putting upside down once in a while, continued 30 minutes.For PCR, 1: 100 dilute sample in 20mM Tris Cl (pH 8.0).

Genomic dna from WT, transformant and extraction of plasmid DNA is carried out to gene type assay.For marker gene, sample is carried out to gene type assay.Use primer 2 383 (5 ' CTGACCCGACCTATGGGAGCGCTCTTGGC3 ') (SEQ ID NO:174) and 2279 (5 ' CTTGACTTCCCTCACCTGGAATTTGTCG 3 ') (SEQ ID NO:175) in this gene type assay PCR.PCR kenel used is as follows: 94 ℃ of sex change continue 5 minutes; 35 circulations, 94 ℃-30 seconds, 60 ℃-30 seconds, 72 ℃-3 minutes; 72 ℃-5 minutes.From positive control (plasmid) with amplify the identical band of size two kinds of original chlorellas (UTEX 31) transformant.

Analysis to atomic chlorella and the chlorella transformant of swimming: extract as follows genomic dna from chlorella wild-type cell and transformant: cell is resuspended in 100 μ l Extraction buffers (87.5mM Tris Cl (pH 8.0), 50mM NaCl, 5mM EDTA (pH 8.0), 0.25%SDS) and hatches under 60 ℃, wherein mixed by putting upside down once in a while, continued 30 minutes.For PCR, 1: 100 dilute sample in 20mM Tris Cl (pH 8.0).Genomic dna from WT, transformant and extraction of plasmid DNA is carried out to gene type assay.For marker gene, sample is carried out to gene type assay.Primer 2 336 (5 ' GTGGCCATATGGACTTACAA 3 ') (SEQ ID NO:176) and 2279 (5 ' CTTGACTTCCCTCACCTGGAATTTGTCG 3 ') (SEQ ID NO:175) are the primer sets 2 of appointment (the expection product of 1215bp), and primer 2 465 (5 ' CAAGGGCTGGATGAATGACCCCAATGGACTGTGGTACGACG3 ') (SEQ ID NO:177) and 2470 (5 ' CACCCGTCGTCATGTTCACGGAGCCCAGTGCG 3 ') (SEQ ID NO:178) are the primer sets 4 (the expection product of 1442bp) of appointment.PCR kenel used is as follows: 94 ℃ of sex change continue 2 minutes; 29 circulations, 94 ℃-30 seconds, 60 ℃-30 seconds, 72 ℃-1 minute 30 seconds again; 72 ℃-5 minutes.The plasmid contrast that contains the secretor type saccharase is used as the PCR contrast.

The sequence of saccharase construct is corresponding to SEQ ID NO:8.

Embodiment 7: the homologous recombination in former Trentepohlia species

Genetically modified homologous recombination has multiple advantage.At first, it is uncertain not utilizing homologous recombination and transgenosis is introduced, because can not control the number of the plasmid copy of introducing in cell.In addition, it is unsettled not utilizing homologous recombination and transgenosis is introduced, because plasmid may keep unbound state and lose in fission process subsequently.Another advantage of homologous recombination is " to knock out " target gene, introduces epitope tag, changes the promotor of endogenous gene and changes in addition target gene (for example introducing point mutation).

Utilize the genomic specific region of the former algae of mulberry fruit shape (UTEX 1435) of called after KE858 to build two carriers.KE858 is a 1.3kb genomic fragment, and it comprises a part that has the protein coding region of homology with transfer RNA (tRNA) (tRNA) family of protein.The southern blotting technique method has showed that there is single copy in the KE858 sequence in the former algae of mulberry fruit shape (UTEX 1435) genome.Build the carrier of the first type, by its called after SZ725 (SEQ ID NO:179), it is cloned in the pUC19 carrier framework and is formed by whole 1.3kb KE858 fragment, and described pUC19 carrier framework also contains yeast invertase (suc2) gene through optimizing.The KE858 fragment contains unique ，Gai site, SnaB1 site and is not present on any position in the target construct.Build the carrier of the second type, by its called after SZ726 (SEQ IDNO:180), its KE858 sequence be damaged by the insertion yeast invertase gene of the SnaB1 site by the KE858 genome sequence (suc2) forms.The EcoRI digestion that can be cut by being used in two ends, KE858 zone will contain the whole DNA fragmentation excision of the KE858 sequence of side joint yeast invertase gene from carrier framework.

Use these two carriers that the direct homologous recombination of yeast invertase gene (suc2) is arrived in the former algae of the mulberry fruit shape corresponding KE858 of (UTEX 1435) genome zone.By with SnaB1 digested vector construct SZ725 and with EcoRI digested vector construct SZ726, making the linear DNA end restructuring with the genome area homology of homologous recombination institute target.Then utilize aforesaid method to be incorporated in the former algae culture of mulberry fruit shape through the vector construction body of digestion.Then utilize the sucrose culture plate to be selected the transformant of each vector construction body.To by each carrier, transformed 10 of producing independent, pure clone's property transformant carries out about successfully the recombinate analysis (utilizing the southern blotting technique method) of required genome position and about the analysis of Stability of Transgenic of yeast invertase gene.

Southern blotting technique analysis that the SZ725 transformant is carried out shows, the restructuring band that 10 transformant for analyzing of selecting have 4 transformant to contain prediction shows generation single exchange event between KE858 sequence in carrier and the KE858 sequence in genome.On the contrary, all 10 SZ726 transformant all contain the restructuring band of prediction, show with in the EcoRI fragment of the pSZ726 of the genetically modified KE858 sequence of side joint yeast invertase and genome, between corresponding KE858 zone, dual exchange event occurring.

By making transformant, in the situation that do not selected growth to surpass for 15 generations, expression and the genetically modified stability of invertase are assessed.4 SZ725 transformant and 10 SZ276 transformant of transgenic positive are shown in selection by the southern blotting technique Faxian, and 48 single groups of each transformant are grown continuously: at first in the situation that do not selected to grow in containing the substratum of glucose, then in the situation that selected to grow in containing the substratum of sucrose as sole carbon source.All 10 SZ276 transformant (100%) all keep its ability of utilizing the sucrose growth after 15 generations, and approximately 97% SZ725 transformant keeps it to utilize the ability of sucrose growth after 15 generations.The transgenosis (SZ726 carrier) of introducing by dual exchange event has high stability in going down to posterity.On the contrary, the transgenosis (SZ725 carrier) of introducing by the single exchange event is in the certain unstable of middle demonstration that goes down to posterity, because what introduce is genetically modified tandem copy, the genetically modified repetition homology of side joint zone may occur to recombinate and excise the transgenosis DNA between it.

These experiments show, have successfully utilized homologous recombination to prepare and have contained the former algae transformant of stable integration to the allos invertase gene in organism nuclear staining body.Successfully carry out homologous recombination and make it possible to occur other genome variation in former algae, comprise genetically deficient, point mutation and make required gene product with epitope tag.These experiments also disclose the system of carrying out homologous recombination in the micro-algae nuclear gene of eucaryon group first.

Utilize homologous recombination to knock out the former algae gene of endogenous mulberry fruit shape: in the screening of the former algae cDNA/ of mulberry fruit shape genome (as above in the screening described in embodiment 4), to identify endogenous stearyl--ACP desaturase (SAPD) cDNA.Stearyl--ACP desaturase is the part of lipid synthesis path, and their function is that two keys are incorporated in fatty acyl chain.In some cases, in order to change the lipid acid kenel, it is favourable knocking out the lipid pathway enzyme or reducing its expression.Prepare the homologous recombination construction body, with the expression of assessing endogenous stearyl--ACP desaturase, whether reduce (or knocking out) and whether can observe the corresponding minimizing of unsaturated fatty acids in host cell lipid kenel.Identify the approximately 1.5kb encoding sequence of stearyl-in the former algae of mulberry fruit shape (UTEX 1435)-ACP delta 8 desaturase genes and it is cloned to (SEQID NO:181).Build the homologous recombination construction body with the SAPD encoding sequence (5 ' end target site) of 0.5kb on 5 ' end, described SAPD encoding sequence back is the Chlamydomonas reinhardtii beta-tubulin promoter, the yeast invertase suc2 gene that the codon that described promoters driven contains Chlorella vulgaris 3 ' UTR is optimized.Then the former algae SAPD of (about 1kb) the mulberry fruit shape encoding sequence of remainder is inserted into to Chlorella vulgaris 3 ' UTR back, to produce 3 ' end target site.The sequence of this homologous recombination box is listed in SEQ ID NO:182.As implied above, thus can make ends exposed increase the success ratio of homologous recombination box in being incorporated into the nuclear gene group by made the linearizing of homologous recombination box before transforming micro-algae.Make the homologous recombination box linearizing of endogenous SAPD enzyme in the former algae of target mulberry fruit shape, then be transformed in host cell (the former algae of mulberry fruit shape, UTEX 1435).Successful integration can be removed endogenous SAPD enzyme coding region by dual mutual recombination event from host genome, and the expression of the new suc2 gene inserted can be subject to the adjusting of Chlamydomonas reinhardtii beta-tubulin promoter.Utilization contains sucrose and as the culture plate/substratum of sole carbon source, resulting clone is screened.The clone that the homologous recombination box is successfully integrated can utilize sucrose to grow as sole carbon source, and using the variation of the overall saturation ratio of lipid acid in the lipid kenel as less important definite factor.In addition, can also measure by southern blotting technique existence and expression that (utilizing yeast invertase suc2 gene-specific probe) and RT-PCR determine invertase gene in positive colony.Perhaps, the coding region that can excise endogenous SAPD enzyme with the identical construct that does not contain beta-tubulin promoter.In this case, the new yeast invertase suc2 gene inserted can be regulated by endogenous SAPD promotor/5 ' UTR.

Embodiment 8: the expression of various thioesterases in former algae

Make method that the heterology thioesterase gene expresses in former Trentepohlia species and impact before have been described in PCT and apply for that in No. PCT/US2009/66142, described application is incorporated to this paper by reference at this.Further research is from the impact of other thioesterase gene/gene product of higher plant species.These thioesterases comprise the thioesterase from following higher plant:

In all cases, use particle gun particle bombardment that above-mentioned each thioesterase construct is converted in the former algae of mulberry fruit shape (UTEX 1435).Comprise as PCT applies for other method for transformation of disclosed homologous recombination in No. PCT/US2009/66142 and also be applicable to the heterology expression of target gene.Use the method described in embodiment 2 with above-mentioned each thioesterase construct, the former algae of mulberry fruit shape (UTEX 1435) to be transformed.Each construct contains the NeoR gene and uses 100 μ g/ml G418 to be selected positive colony.All coding regions codon optimizes to reflect the intrinsic codon bias of the former algae UTEX 1435 of mulberry fruit shape (referring to table 2) nuclear gene.The aminoacid sequence of construct used and cDNA sequence are listed in recognition sequence number table.The transit peptides of each higher plant thioesterase is replaced by the algae transit peptides of the codon optimization of the former algae δ-12 of mulberry fruit shape fatty acid desaturase (SEQID NO:48) or original chlorella stearyl--ACP desaturase (SEQ ID NO:49).All thioesterase constructs are driven by Chlamydomonas reinhardtii beta-tubulin promoter/5 ' UTR.The growth of selected positive colony and lipid production are compared with the former algae of mulberry fruit shape (UTEX 1435) of wild-type (not through transforming).Wild-type and selected positive colony are grown on 2% glucose G418 culture plate.The lipid kenel analysis that the selected positive colony of each construct is carried out is summarized in (% means with area) in following table 15.

Table 15. is expressed the lipid kenel of the former algae of mulberry fruit shape of various heterology thioesterases.

The result demonstration, expressed all thioesterases all affect the lipid acid kenel to a certain extent.See " total saturate " a line, saturation ratio is subject to the impact of the expression of multiple thioesterase significantly, and described thioesterase comprises the thioesterase from California bay, camphor tree and white elm (affecting the most remarkable).These variations of the per-cent aspect of total saturate are to exceed unexpectedly, from the heterology of the thioesterase of higher plant, express and obviously not merely affect the lipid chain length; It can also affect other attribute of the lipid kenel produced by micro-algae, the i.e. saturation ratio of lipid acid.

Make in the selected G418 (25mg/L to 50mg/L) that are cloned in different amounts that transform apart from flower thioesterase, California bay and camphor tree thioesterase apart from flower C8 thioesterase, spire calyx with the wetland calyx and in the lower further growth of differing temps (22 ℃ to 25 ℃) and measure these clones' lipid kenel.Table 16 has been summed up the representativeness clone's who contains each thioesterase lipid kenel (% means with area).The second construct that structure contains the white elm thioesterase and use said gene marksmanship are transformed into it in former algae of mulberry fruit shape (UTEX 1435).By homologous recombination, this second construct is incorporated in cell.The method of carrying out homologous recombination in former Trentepohlia species had before had been described in PCT and had applied in No. PCT/US2009/66142.Homologous dna used comes from the genomic dna sequence of 6S rRNA in the former algae UTEX 1435 of mulberry fruit shape.Selection factor is that use can utilize the ability of sucrose growth by the suc2 gene of the optimization of the codon from yeast saccharomyces cerevisiae of Chlamydomonas reinhardtii beta-tubulin promoter driving.Primary white elm transit peptides is replaced by original chlorella (UTEX 250) stearyl--ACP desaturase transit peptides.The cDNA of this construct classifies SEQ ID NO:50 as in sequence table.On 2% sucrose culture plate, positive colony is selected, and also made resultingly for the culture that carries out lipid kenel mensuration, to grow in the substratum that contains 2% sucrose.This representative lipid kenel contained through the former algae algae of the mulberry fruit shape strain of the heterology white elm thioesterase of homologous recombination is summarized in table 16.

The lipid kenel of the former algae algae of the mulberry fruit shape strain that table 16. contains the heterology thioesterase gene.

As above-mentioned clone's situation, with wild-type (not through transforming) the former algae of mulberry fruit shape, compare, the all transformant that contain the heterology thioesterase gene demonstrate the lipid acid kenel and are subject to impact to a certain degree, and the percent of total of saturated fatty acid also changes.The degree maximum that total saturate content of the former algae of mulberry fruit shape that contains the white elm thioesterase of introducing by homologous recombination increases.

In addition, assessment contains the novel lipid kenel of exogenous spire calyx apart from the transgene clone of flower, camphor tree, California bay or white elm thioesterase.Contain the spire calyx and obtain following lipid kenel when being cloned in 2% glucose, 25mg/ml G418 of flower thioesterase grown under 22 ℃: C8:0 accounts for 5.10%; C10:0 accounts for 18.28%; C12:0 accounts for 0.41%; C14:0 accounts for 1.76%; C16:0 accounts for 16.31%; C18:0 accounts for 1.40%; C18:1 accounts for 40.49%; And C18:2 accounts for 13.16%.The clone who contains the camphor tree thioesterase (also containing exogenous invertase) obtains following lipid kenel while growing under 25 ℃ in 2% sucrose: C10:0 accounts for 0.04%; C12:0 accounts for 6.01%; C14:0 accounts for 35.98%; C16:0 accounts for 19.42%; C18:0 accounts for 1.48%; C18:1 accounts for 25.44%; And C18:2 accounts for 9.34%.Contain being cloned in 2% glucose, 25-100mg/ml G418 while growing of California bay thioesterase and obtain following lipid kenel under 22 ℃: C8:0 accounts for 0%; C10:0 accounts for 0.11%; C12:0 accounts for 34.01%; C14:0 accounts for 5.75%; C16:0 accounts for 14.02%; C18:0 accounts for 1.10%; C18:1 accounts for 28.93%; And C18:2 accounts for 13.01%.Contain being cloned in 2% glucose while growing of white elm thioesterase and obtain following lipid kenel under 28 ℃: C10:0 accounts for 1.54%; C12:0 accounts for 0.43%; C14:0 accounts for 7.56%; C16:0 accounts for 39.45%; C18:0 accounts for 2.49%; C18:1 accounts for 38.49%; And C18:2 accounts for 7.88%.

Embodiment 9: with multiple exogenous allos thioesterase gene, former algae is transformed

Use above-disclosed method to transform the former algae of micro-algae algae strain mulberry fruit shape (UTEX 1435) so that multiple thioesterase is expressed in single clone.The diverse oils of lipid acid kenel (as indicated in as previous embodiment) of setting forth while multiple thioesterase being expressed in single clone make micro-algae can produce the lipid acid kenel and make any single thioesterase single expression.At first utilize camphor tree thioesterase for homologous recombination (C14 type of priority thioesterase) and invertase gene (from the suc2 of yeast saccharomyces cerevisiae) (selection factor is the ability of utilizing the sucrose growth) to transform the former algae of mulberry fruit shape (UTEX 1435).The KE858 zone that comes from the former algae genomic dna of mulberry fruit shape described in above-mentioned III part for the DNA of this homologous recombination construction body.The relevant portion of this construct is classified SEQ ID NO:51 as in sequence table.Containing screening positive clone on the culture plate of sucrose.Then with a kind of positive colony that transforms again in following three kinds of boxes, each box is encoded for the resistance of microbiotic G418 and other thioesterase: (1) is the thioesterase gene (C8-10 type of priority) apart from flower from the spire calyx, SEQ ID NO:52; (2) from the thioesterase gene (C12 type of priority) of California bay, SEQ ID NO:53; Or (extensive from the thioesterase of white elm; The C10-C16 type of priority), SEQ ID NO:54.Sequence table comprises the sequence of the relevant portion of each construct.In the substratum that contains sucrose and 50 μ g/ml G418, the clone of two kinds of thioesterase genes is expressed in screening.Select positive colony and measure growth and lipid kenel.Table 17 has been summed up the lipid kenel (% means with area) of representative positive colony.

The lipid kenel of the former algae of mulberry fruit shape that table 17. transforms with multiple thioesterase.

In addition, make to have the dual thioesterase clonal growth of camphor tree and California bay thioesterase under 22 ℃ in the substratum that contains 2% sucrose and 50mg/L G418.The lipid acid kenel obtained by this algae strain under these growth conditionss is: C8:0 (0); C10:0 (0.10); C12:0 (31.03); C14:0 (7.47); C16:0 (15.20); C18:0 (0.90); C18:1 (30.60); C18:2 (12.44); And C18:3 α (1.38), wherein total saturate is 54.7.

Produce dual thioesterase clone with two kinds of homologous recombination construction bodies that contain the camphor tree thioesterase (a kind of target 6S zone and another kind of target KE858 zone).Positive representative clone has following lipid acid kenel: C8:0 accounts for 0%; C10:0 accounts for 0.06%; C12:0 accounts for 5.91%; C14:0 accounts for 43.27%; C16:0 accounts for 19.63%; C18:0 accounts for 0.87%; C18:1 accounts for 13.96%; And C18:2 accounts for 13.78%, wherein total saturate accounts for 69.74%.This clone's C12-C14 horizontal exceeding 49% is more than 37 times of C12-C14 level in wild-type cell.

Above-mentioned data presentation, multiple thioesterase successfully coexpression in micro-algae.Multiple thioesterase coexpression can make the lipid acid kenel change and be not only significantly different from the strain of wild-type algae, and from significantly different by expressing the lipid acid kenel that any single thioesterase obtains.Make multiplely to there is the specific thioesterase of overlapping chain length and express and can make those specific fats acid cumulative rises.

The lipid acid that heterology thioesterase (alone or in combination) is expressed in the former algae of mulberry fruit shape not only can change the strain of host algae/lipid kenel, and, when the oils (table 5) with obtaining from multiple seed crop is at present compared, these kenels are to belong to peculiar the oils of the in fact uniqueness of finding in other current use system.Not only with not there is significant difference in the transgenic alga strain through the wild-type algae strain transformed, and they also have significantly different kenels from any commercially available oils shown in table 5.For instance, the C8-C10 fatty acid levels of Oleum Cocois and palm-kernel oil is in the 5.5%-17% scope.Express the wetland calyx and gathered respectively 3.66% to 8.65% apart from flower C8 type of priority thioesterase or spire calyx apart from the transgenic alga strain of flower C10 type of priority thioesterase.These C8-C10 fatty acid levels are similar to Oleum Cocois and palm-kernel oil, yet, the strain of transgenosis algae algae does not have significantly higher C12:0 lipid acid, and they have very high C16:0 (23% in transgenosis oils is respectively than the 11%-16% in Oleum Cocois or palm-kernel oil) and/or 18:1 (50%-57% in transgenosis oils is respectively than the 8%-19% in Oleum Cocois or palm-kernel oil).

Embodiment 10: identify the former algae promotor of endogenous nitrogen dependency

A. identify and characterize endogenous nitrogen dependency promotor.

Utilize standard technique to prepare cDNA library from the former algae of mulberry fruit shape (UTEX 1435).The former frustule of mulberry fruit shape is grown 48 hours under the condition of nitrogen abundance.Then 5% inoculum (v/v) is transferred in low nitrogen, and in 7 days every 24 hours collecting cells.Cultivate approximately after 24 hours, the nitrogen supply in substratum is consumed fully.Utilize dry ice and Virahol that collected sample is freezing immediately.Separate subsequently total RNA from freezing cell precipitation matter sample, and the total RNA of a part that retains each sample is to study for RT-PCR.Remaining part to total RNA of obtaining from sample carries out the polyadenylic acid selection.Then the RNA selected through polyadenylic acid that collects equimolar amount in various conditions, and at carrier pcDNA3.0 (Invitrogen), preparing cDNA library.About 1200 clones of random choose from the resulting cDNA library collected, and carry out two-way order-checking.Select approximately 68 different cDNA from these 1200 sequences, and the cDNA Auele Specific Primer used for designing real-time RT-PCR research.

The standby RNA separated from the cell precipitation matter sample is utilizing the above real-time RT-PCR of the cDNA Auele Specific Primer group of preparation to be used as substrate in studying.This standby RNA is changed into to cDNA, and as 68 gene-specific primer groups substrate separately in RT-PCR.Utilize cycle threshold or C _tin the numeric representation time-histories in collected each RNA sample in 68 cDNA each cDNA relatively transcribe abundance.To between nitrogen abundance and nitrogen shortage condition, show that the cDNA that significantly increases (being greater than 3 times) expresses by nitrogen and lacks the latent gene raised as it.As discussed in this specification sheets, lack/restriction of nitrogen is lipogenetic known induction factor in oleaginous microorganism.

Express supposition promotor in the cDNA raised/5 ' UTR sequence when identifying that nitrogen lacks/limits, separate total DNA under the nitrogen sufficiency, then utilize 454 sequencing technologies (Roche) to be checked order from the former algae of mulberry fruit shape (UTEX 1435) grown.The assembling contig that utilizes BLAST that the cDNA that raised in top RT-PCR result and 454 gene order-checking readings are produced compares.5 ' end of cDNA is positioned to specific contig, and if may, the 5 ' flanking DNA supposition property evaluation promotor/UTR that is greater than 500bp utilized so.Confirm the existence of promotor/5 ' UTR and cloned by genomic dna being carried out to pcr amplification subsequently.Utilize 5 ' tip designs 3 of single cDNA ' end primer, and 5 ' tip designs, the 5 ' end group that utilizes 454 contigs assemblings is because of Auele Specific Primer.

As screening for the first time; by a supposition property promotor from Aat2 (ammonium transporter; 5 ' UTR/ promotor of separating SEQ ID NO:63) is cloned in the camphor tree C14 thioesterase construct with original chlorella stearyl--ACP desaturase transit peptides, substitutes thermotolerance chlorella glutamate dehydrogenase promotor.This construct is listed in SEQ ID NO:81.In order to test this supposition promotor, by the thioesterase construct be transformed in the former frustule of mulberry fruit shape with by utilize aforesaid method for low/without the nitrogen condition under the increase of C14/C12 lipid acid screened to confirm actual promoter activity.Can utilize same procedure to carry out similar test to isolated supposition nitrogen adjustment type promotor from the screening of cDNA/ genome.

From the screening of cDNA/ genome, isolated other supposition property nitrogen adjustment type promotor/5 ' UTR is:

Increase the increase multiple that multiple refers to cultivation cDNA abundance after 24 hours in low nitrogen substratum.

In order further to understand the potential adjusting of these supposition property promotor/5 ' UTR, select eight sequences further to test: (1) FatB/A; (2) SulfRed sulfite reductase; (3) SugT HUCEP-8; (4) the Amt02-ammonium transporter 02; (5) the Aat01-amino acid transporter 01; (6) the Aat03-amino acid transporter 03; (7) the Aat04-amino acid transporter 04; And (8) Aat05-amino acid transporter 05.Utilize Illumina order-checking reading to carry out high resolving power to the isolated RNA of the former frustule of mulberry fruit shape from each time point and transcribe group analysis: T0 (seed cell); At from seed cell is inoculated the 20th hour; The 32nd hour; The 48th hour; The 62nd hour; And the 114th hour.Nitrogen when T0 (seed cell) in substratum is sufficient, and when the 20th hour and longer time time, and substratum is hardly containing to nonnitrogenous.Then the transcript contig through assembling with each transcript in previous eight transcripts identifying, the RNA separated by each time point produced independently carries out sequence Local Alignment (blast).The results are summarized in following table 18.

The group of transcribing of eight supposition property promotor/5 ' UTR of table 18. is expressed kenel.

From the result of above summing up, multiple transcript demonstrates passes cumulative rises in time, but what is interesting is, sulfite reductase mRNA demonstrates the unique mRNA of passing in time accumulation to be reduced.

These eight supposition property promotor/5 ' UTR districts are cloned in to the camphor tree thioesterase upstream of coding region that primary transit peptides is removed and replace with the transit peptides of original chlorella (UTEX 250) stearyl--ACP desaturase.By homologous recombination, utilize the DNA of the genome sequence of 6S rRNA that each supposition property promotor/5 ' UTR district construct is incorporated in the former algae UTEX1435 of mulberry fruit shape.In construct, also contain from the suc2 invertase gene of yeast saccharomyces cerevisiae to select positive colony containing on the substratum/culture plate of sucrose.The cDNA sequence of the relevant portion of the construct of Aat01 is classified SEQ ID NO:67 as in sequence table.For other construct, use identical skeleton, unique variable be supposition property promotor/5 ' UTR sequence.Prepare another contrast transgenic alga strain, wherein use the Chlamydomonas reinhardtii beta-tubulin promoter to drive the camphor tree thioesterase gene to express.Show, this promoters driven target gene carries out constitutive expression, and therefore the useful contrast of measuring identical thioesterase courier's expression when the various supposition nitrogen adjustment type promotors by tested/5 ' UTR drives is provided.

After producing transgene clone, carry out three independent experiments.The potential nitrogen controllability of all eight supposition property promotors is assessed in the first two experiment by the ammonia level in thioesterase mRNA level, measurement lipid acid kenel and the culture supernatants of utilizing RT-PCR Measurement sensibility state.Make to be cloned in the seed cell substratum (1g/L ammonium nitrate-15mM nitrogen (in ammonia), 4g/L yeast extract) that is rich in nitrogen under vibration (200rpm) at first under 28 ℃ and grow 24 hours to 48 hours, now use (the A of 20OD unit ₇₅₀) the low nitrogen substratum (0.2g/L ammonium sulfate-3mM nitrogen (in ammonia), 0.2g/L yeast extract) of inoculation 50ml.Cell was sampled in every 24 hours in 6 days, and collected sample when being about to low nitrogen condition conversion.Then use a part of cell in each sample to utilize Trizol reagent (according to the method for manufacturers's suggestion) to carry out total RNA extraction.Ammonia measure be disclosed in low nitrogen substratum the ammonia level in supernatant liquor after 24 hours lower than limit of detection (approximately 100 μ M).

For real-time RT-PCR, for internal reference rna level expressed in the former algae of each time point mulberry fruit shape (UTEX 1435) by all rna level normalization method.The internal reference RNA that is called cd189 is the product of the ARG9 gene of coding N-acetylornithine transaminase.Primer sets for real-time RT-PCR in these experiments is:

Also obtained each time point each transformant the lipid kenel and with the RT-PCR result, compare.Change based on ammonia level, RT-PCR result and C12-C14 fatty acid levels can draw to draw a conclusion: amino acid transporter 01 (Aat-01), amino acid transporter 04 (Aat-04) and ammonium transporter 02 (Amt-02) sequence contain functional nitrogen really can regulate promotor/5 ' UTR.

From the RT-PCR result, Aat-01 shows the ability of four times that the camphor tree thioesterase mRNA level that can drive steady state reaches contrast (Chlamydomonas reinhardtii beta-tubulin promoter).The mRNA level also significantly increases relevant to nitrogen restriction and C12-C14 fatty acid levels.May be more effective than contrasting the Chlamydomonas reinhardtii promotor aspect the protein synthesis of 5 ' UTR in driving the lipid biosynthesizing that these results show to associate with the Aat-01 promotor.As the Aat-01 promotor, the Aat-04 promotor can drive mRNA accumulation to reach five times of mRNA accumulation that Chlamydomonas reinhardtii contrast promotor drives.Yet the Aat-04 promoter construct only can moderately affect the C12-C14 fatty acid levels.These data show that the Aat-04 promotor can be subject to the adjusting that nitrogen lacks significantly, may be poor but serve as the function of translational enhancer with UTR that promotor is associated.Finally, the Amt-02 promotor is similar to the Aat-01 promotor, because it can drive mRNA accumulation to reach three times of mRNA accumulation that the contrast promotor drives.The mRNA level also significantly increases relevant to nitrogen restriction and C12-C14 fatty acid levels.In a word, verified, all these three kinds of promotors all are subject to nitrogen and regulate.

B. ammonium transporter 3 (amt03) promotor is further characterized and makes various sulphur esterase is expressed.

As described above, identify the Partial cDNA that is called ammonium transporter 02 and 03 (amt02 and amt03).Together with these two Partial cDNA, also identify the 3rd Partial cDNA that is called ammonium transporter 01 (amt01).Partial cDNA and supposition property are compared through the aminoacid sequence of translating.The result demonstration, the dependency of amt01 in these three sequences is far away, and amt02 and amt03 only differ single amino acids.

At first with computer simulation mode, by Partial cDNA Sequence and Roche 454 genomic dnas assemblings as described above and Illumina being transcribed to group, assemble and carry out the sequence Local Alignment and produce promotor/5 ' UTR.Identify the transcript contig with the cDNA display consistency of the amt01 that encodes, amt02 and amt03, yet the transcript contig can not distinguish three mRNA, this is because contig contains all three sequences that mRNA is common.Roche 454 genomic dnas assemblings are hit for amt02 and amt03cDNA sequence and are contained N end protein matter sequence.Carry out PCR to clone 5 ' end flank region.For the PCR primer of verifying clone amt02 and amt03 promotor/UTR, be:

The Amt03 forward primer: 5 '-GGAGGAATTCGGCCGACAGGACGCGCGTCA-3 ' (SEQ ID NO:85)

The Amt03 reverse primer: 5 '-GGAGACTAGTGGCTGCGACCGGCCTGTG-3 ' (SEQ ID NO:86)

The Amt02 forward primer: 5 '-GGAGGAATTCTCACCAGCGGACAAAGCACCG-3 ' (SEQ ID NO:87)

The Amt02 reverse primer: 5 '-GGAGACTAGTGGCTGCGACCGGCCTCTGG-3 ' (SEQ ID NO:88)

In both cases, 5 ' end and 3 ' end primer contains and can be used for expecting the restriction site that is cloned in expression vector the function to verify these promotors/5 ' UTR district.

Fit at the computer mould by this associating between method clone's the initial cDNA of DNA and encode amt02 (SEQ ID NO:61) and amt03 (SEQ ID NO:60) of PCR-based and compare in pairs.The result of these comparisons shows initial cDNA and, through between the genome sequence of cloning, having significant difference, means that ammonium transporter likely represents different gene families.In addition, the promotor of the method based on associating of amt03/5 ' UTR clone is different from initial amt03 sequence, and the amt02 sequence is identical.Carry out further experiment to characterize amt03 promotor/UTR sequence (SEQ ID NO:89) and to be described in hereinafter.

The amt03 promotor above identified/UTR sequence (SEQ ID NO:89) is by cloning this supposition property promotor/UTR sequence to drive four kinds of different thioesterases to express to test.The homologous recombination sequence that expression cassette contains genomic 6S locus upstream and downstream (being respectively SEQ ID NO:82 and 84).Expression cassette also contains Saccharomyces Cerevisiae in S UC2 invertase cDNA can in containing the substratum of sucrose, positive colony being selected.The sucrose inversion expression of enzymes be by the Chlamydomonas reinhardtii beta-tubulin promoter, driven and contain Chlorella vulgaris nitrate reductase 3 ' UTR.Then by amt03 promotor/UTR sequence clone to invertase box downstream, back is thioesterase cDNA sequence in the frame of a kind of thioesterase gene in following four kinds of thioesterase genes: (1) is from the C14 thioesterase of camphor tree; (2) from the C12 thioesterase of California bay; (3) from the C10-C16 thioesterase of white elm; Or (4) from the spire calyx apart from the flower the C10 thioesterase; And contain Chlorella vulgaris nitrate reductase 3 ' UTR.C14 camphor tree thioesterase, C12 California bay thioesterase and C10-C16 white elm thioesterase all contain the transit peptides of original chlorella stearyl--ACP desaturase.The transit peptides that C10 spire calyx contains the former algae δ-12 of mulberry fruit shape fatty acid desaturase (FAD) apart from the flower thioesterase.In all cases, the optimization of sequence codon to express in the former algae of mulberry fruit shape.The sequence description of above-mentioned thioesterase construct is in sequence table:

By the former frustule of wild-type mulberry fruit shape is carried out being selected on the culture plate/substratum as above in the via Particle Bombardment Transformation method described in embodiment 2, prepared transgenic line and containing sucrose.Then the degree changed for the lipid acid kenel is screened positive strain.Then four kinds of strains using respectively in above-mentioned four kinds of constructs each to be transformed and produce are carried out to other analysis.Strain 76 is expressed camphor tree C14 thioesterase, and strain 37 is expressed California bay C12 thioesterase, and strain 60 is expressed white elm C10-C16 thioesterase, and strain 56 is expressed the spire calyx apart from flower C10 thioesterase.Make each strain contain sucrose as the substratum of sole carbon source in growth 48 hours and the 14th hour, the 24th hour, the 36th hour and the 48th hour, take out cell sample (seed cell cultivations) with by GC-FID (above-mentioned) via the direct transesterification formation of lipid acid fatty acid methyl ester is measured to the lipid acid kenel and carried out follow-up analysis and separate total RNA.When within 48 hours, finishing, use these cell inoculations to maintain pH 5.0 (Citrate trianion buffering, 0.05M ultimate density) or pH 7.0 (HEPES buffering, 0.1M ultimate density) nonnitrogenous or the culture (containing sucrose as sole carbon source) that contains low-level nitrogen.Take out culture samples to carry out the analysis of lipid acid kenel and to separate total RNA at the 12nd hour, the 24th hour, the 72nd hour and the 108th hour (generation lipid).Ammonia that these cultures are carried out is measured and is disclosed, in low nitrogen substratum after 24 hours ammonia level lower than limit of detection (approximately 100 μ M).

To total RNA of above-mentioned collected each time point carry out to the real-time RT-PCR of thioesterase mRNA level measure and for the level of internal reference RNA (cd189) by the horizontal normalization method of all mRNA.Primer sets for PCR in real time is showed in following table 19:

Table 19. is for the primer sets of PCR in real time.

In the seed cell cultivation stage, the result of the lipid acid kenel of each time point shows, thioesterase does not almost exert an influence.Along with the lipid generation stage, the lipid acid kenel is subject to remarkably influenced, wherein be maintained at pH 5.0 under culture compare, the lipid increase degree that is maintained at the culture under pH 7.0 wants much remarkable.Although the value in the difference aspect the accumulation of target lipid acid between pH 7.0 and pH 5.0 changes with each tested thioesterase, but general impacts are identical: the level of the target lipid acid gathered in the cell of 5.0 times growths of pH is significantly lower, but more than the contrast wild-type cell.

On isolated RNA carries out from these same sample analysis, in culture pH value, on the mRNA level of the steady state of each thioesterase, exist aspect obvious impact very relevant to lipid acid kenel data.By the lipid acid cumulative data together with the mRNA Data relationship, in transcriptional level, mRNA stability or mediated significantly the regulating effect that the pH value is expressed the thioesterase gene driven by amt03 promotor/UTR aspect the two.In addition, observe steady state California bay mRNA level lower than steady state spire calyx apart from flower mRNA level four logarithms.This observed result is consistent with the hypothesis that single mRNA sequence works in controlling expression.The ammonium undertaken by amt03 translocator family in the former algae of these data representation mulberry fruit shapes absorbs directly relevant with the pH value.

The amt03 promotor that drives white elm C10-C16 thioesterase to express by use/UTR construct is transformed to the former frustule of mulberry fruit shape 12 kinds of strains that produce and carried out other lipid acid kenel analysis.Above-mentioned strain 60 is parts of following analysis.Following table 20 has shown three kinds of strains in 12 kinds of strains analyzing and the lipid kenel of wild-type contrast.

The lipid acid kenel of the transformant that table 20. contains the white elm TE driven by amt03 promotor/UTR.

Area %	C8:0	C10:0	C12:0	C14:0	C16:0	C18:0	C18:1	C18:2	Total saturate
										Wild-type	0.00	0.01	0.04	1.27	27.20	3.85	58.70	7.18	32.36
Strain 40	2.38	20.61	3.41	28.41	29.92	1.91	8.57	3.74	86.64
										Strain 44	1.50	20.16	4.44	31.88	26.66	1.88	6.95	5.42	86.50
Strain 60	0.98	14.56	3.15	27.49	31.76	2.14	12.23	6.36	80.06

As above shown in the table, with wild-type, compare, the level of total saturate significantly increases, wherein in the situation that strain 40, with wild-type, compare, the level of total saturate is increased to more than 2.6 times (the total saturate in 12 kinds of strains analyzing approximately 63% to surpassing in 86% scope).In addition, the white elm thioesterase can make the level of unsaturated materials (especially C18:1 and C18:2) significantly reduce (referring to strain 40 and 44) with these horizontal expressions the time, wherein, in strain 44, the C18:1 level is reduced to below 1/8th of wild-type.And white elm thioesterase (by the amt03 promoters driven) can make the level of medium chain fatty acid greatly increase.The horizontal exceeding 57% of the horizontal exceeding 56% of C10:0-C14:0 in strain 44 (be the level that arrives seen in the strain of wild-type algae approximately 42 times) and C8:0-C14:0.The other algae strain that the Amt03 promoter construct of expressing through the white elm thioesterase of overdriving transforms has following representative lipid kenel: C8:0 accounts for 0.23%; C10:0 accounts for 9.64%; C12:0 accounts for 2.62%; C14:0 accounts for 31.52%; C16:0 accounts for 37.63%; C18:0 accounts for 5.34%; C18:1 accounts for 7.05%; And C18:2 accounts for 5.03%, wherein total shared per-cent of saturate is 86.98%.

By use, drive the spire calyx apart from the amt03 promotor of spending C10 thioesterase (SEQ ID NO:94) to express/UTR construct (SEQ ID NO:89), the former frustule of mulberry fruit shape to be transformed and produces other lipid kenel.Select express the positive colony of this construct and it is grown under pH 7.0 conditions.The representative lipid kenel of positive colony is: C8:0 accounts for 9.87%; C10:0 accounts for 23.97%; C12:0 accounts for 0.46%; C14:0 accounts for 1.24%; C16:0 accounts for 10.24%; C18:0 accounts for 2.45%; C18:1 accounts for 42.81%; And C18:2 accounts for 7.32%.In this clone, the shared per-cent of C8-C10 is 33.84%.

In a word, described data show that amt03 promotor/UTR and similar other promotor can be used as tight adjustment type promotor, and described promotor especially can be for expressing the possibility virose compound of tool and need to strictly forcing genetic expression.The ability that the former algae of mulberry fruit shape can grow under the pH value condition of a wider range (at least pH 5.0 to 7.0) makes this organism especially can be used in combination with regulatory element (as amt03 promotor/UTR).In addition, above-mentioned lipid kenel data show, amt03 promotor/UTR can significantly drive genetic expression.

Embodiment 11: the level that changes saturated lipid acid in the former algae of micro-algae mulberry fruit shape

As utilizing approach (based on cDNA), Illumia based on information biology to transcribe the part that group and Roche 454 order-checkings are carried out the genome screening to the genomic dna of the former algae of mulberry fruit shape (UTEX 1435), identify two groups and participate in the desat specific genes of lipid acid: stearyl--ACP desaturase (SAD) and δ-12 fatty acid desaturase (Δ 12FAD).Stearyl--ACP desaturase is the part of lipid synthesis path, and their function is that two keys are incorporated in fatty acyl chain, for example, from the synthetic C18:1 lipid acid of C18:0 lipid acid.δ-12 fatty acid desaturase is also the part of lipid synthesis path, and their function is that two keys are incorporated in undersaturated lipid acid, for example, from the synthetic C18:2 lipid acid of C18:1 lipid acid.The southern blotting technique that the probe of the two class lipid acid delta 8 desaturase genes of utilization based on identifying during information biology research carries out the analysis showed that, all kinds of delta 8 desaturase genes all may comprise a plurality of family members.In addition, the gene of coding stearyl--ACP desaturase is divided into two different families.Based on these results, three kinds of gene disruption constructs are through designing by the higher coding region of conservative property in each desaturase family of target, to destroy potentially a plurality of gene family members.

Utilization designs three kinds of homologous recombination target constructs to get off: the high conservative part in (1) δ-12 fatty acid desaturase (d12FAD) family member's encoding sequence, and (2) two kinds of constructs of a family in two different SAD families of target respectively, each construct is the conservative region in the encoding sequence of each family of target respectively.This strategy embeds selectable marker gene (from the suc2 invertase box of the ability of giving sucrose hydrolysis of yeast saccharomyces cerevisiae) in the coding region of these high conservatives (a plurality of family members of target) and unconventional gene substitution strategy, in traditional strategy, homologous recombination is by the flank region of target target gene.

Utilize aforesaid method by via Particle Bombardment Transformation, all constructs to be incorporated in cell, and before in being launched into cell by the construct linearizing.Select transformant and utilize aforesaid method to measure the change of lipid kenel in containing the culture plate/substratum of sucrose.The correlated series of each in three kinds of target constructs is listed in hereinafter.

Select the lipid kenel (% means with area) by being transformed with each construct the representative positive colony produced and measuring these clones and be summarized in following table 21.

Table 21. desaturase knocks out the lipid kenel of thing.

Required lipid acid classification is had to the impact that can measure to each construct and, in all three kinds of situations, the C18:0 level significantly increases, especially in the situation that two kinds of SAD knock out thing.What a plurality of clones that knock out generation by SAD were carried out further relatively shows, SAD2B knocks out C18:1 lipid acid in strain and compares in the situation that SAD2A knocks out the C18:1 fatty acid levels that strain observes the minimizing occurred significantly by a relatively large margin.

Under the former algae background of mulberry fruit shape, utilize aforesaid method to produce other Δ 12 fatty acid desaturases (FAD) knock out thing.In order to identify the potential homology of Δ 12FAD, carry out the genome area of amplification coding supposition property FAD with following primer:

Primer 15 '-TCACTTCATGCCGGCGGTCC-3 ' SEQ ID NO:101

Primer 25 '-GCGCTCCTGCTTGGCTCGAA-3 ' SEQ ID NO:102

Be highly similar by utilizing above-mentioned primer to make the former algae genomic dna of mulberry fruit shape carry out the sequence that genome amplification produces, but show, have polygene or the allelotrope of Δ 12FAD in former algae.

Based on this result, design two kinds of gene disruption constructs to manage to make one or more Δ 12FAD gene inactivation.Described strategy be using invertase (from the suc2 of yeast saccharomyces cerevisiae) box (thereby give sucrose hydrolysis ability and as selective marker) be embedded in the coding region of high conservative, but not use traditional gene substitution strategy.The first construct that is called pSZ1124 contains 5 ' end and 3 that side joint drives the Chlamydomonas reinhardtii beta-tubulin promoter of yeast saccharomyces cerevisiae suc2 genetic expression ' hold genome target sequence and Chlorella vulgaris nitrate reductase 3 ' UTR (yeast saccharomyces cerevisiae suc2 box).The second construct that is called pSZ1125 contains 5 ' end and 3 that side joint drives the Chlamydomonas reinhardtii beta-tubulin promoter of yeast saccharomyces cerevisiae suc2 genetic expression ' hold genome target sequence and Chlorella vulgaris nitrate reductase 3 ' UTR.The correlated series of described construct is listed in sequence table:

PSZ1124 and pSZ1125 are incorporated in the former algae background of mulberry fruit shape separately, and the ability based on sucrose hydrolysis is selected positive colony.Table 22 has been summed up the lipid kenel (% means with area, utilizes aforesaid method to produce) obtained in utilizing two transgenic lines of pSZ1124 and pSZ1125 targeting vector.

Table 22. Δ 12FAD knocks out the lipid kenel of thing

?	C10:0	C12:0	C14:0	C16:0	C16:1	C18:0	C18:1	C18:2	C18:3α
										The parent	0.01	0.03	1.15	26.13	1.32	4.39	57.20	8.13	0.61
FAD2B	0.02	0.03	0.80	12.84	1.92	0.86	74.74	7.08	0.33
										FAD2C	0.02	0.04	1.42	25.85	1.65	2.44	66.11	1.39	0.22

The transgenic line that contains FAD2B (pSZ1124) construct is having produced extremely interesting aspect the lipid kenel and having exceeded unexpected result, because expection has only reduced approximately 1 area % by the C18:2 level of minimizing.Yet the C18:1 fatty acid levels significantly increases, almost only using C16:0 level (significantly reducing) as cost.The variation that the transgenic line that contains FAD2C (pSZ1125) construct has also produced the lipid kenel: the C18:2 level significantly reduces and the corresponding increase of C18:1 level.

the tallow stand-in

Selection knocks out a positive colony of experiment generation as the background of further introducing C14 type of priority fatty acyl group-ACP thioesterase gene by above-mentioned SAD2B as described above.The target sequence (making it possible to by homologous recombination the transfering DNA targeted integration) that the construct of introducing camphor tree C14 type of priority thioesterase contains 6S rRNA genome area; and expression construct contains Chlamydomonas reinhardtii beta-tubulin promoter and the Chlorella vulgaris nitrate reductase 3 ' UTR that drives neoR genetic expression, back is the second Chlamydomonas reinhardtii beta-tubulin promoter and the second Chlorella vulgaris nitrate reductase 3 ' UTR that drives camphor tree thioesterase (the containing original chlorella stearyl--ACP desaturase transit peptides) expression of codon optimization.5 ' end 6S rRNA Genome donor sequence is listed in SEQ ID NO:82; 3 ' end 6S rRNA Genome donor sequence is listed in SEQ ID NO:84; And the correlated expression construct of camphor tree thioesterase is listed in SEQ ID NO:83.

Utilize particle bombardment as described above to be transformed and make cell recovery 24 hours on the culture plate that contains 2% sucrose.Afterwards, make cell resuspended and be inoculated on the culture plate that contains 2% sucrose and 50 μ g/ml G418 to be selected.For lipid produce and the selection of lipid kenel 9 clones in the middle of the positive colony that produces.Cultivate as described above 9 transgene clones (SAD2B is knocked and expresses camphor tree C14 type of priority thioesterase) and analyze the lipid kenel.The results are summarized in following table 23.The lipid kenel of Tallow, beef is also included within (national research council (1976): the lipid content of animal product and composition) in following table 23.

The clone's that table 23. transforms through thioesterase lipid kenel.

Can in table 23, see, the lipid kenel of transgenic line and the lipid kenel of Tallow, beef are quite similar.Generally speaking, described data show, specific transgenosis background (being that SAD2B knocks out and C14 type of priority thioesterase (from camphor tree) in this case) combination can be similar to for the preparation of the lipid kenel of produced oils to the transgenosis algae algae strain of Tallow, beef.

lower for knock out approach by target the structure that beta-keto acyl base synthase II (KASII) expresses body

To knock out approach by target lowers in the derivative S1331 of the traditional mutagenic treatment of process that the carrier of KASII genetic expression is incorporated into UTEX1435.Utilize the yeast saccharomyces cerevisiae invertase gene as selective marker, give the ability of utilizing the sucrose growth.Saccharase expression cassette under controlling at Chlamydomonas reinhardtii B-tubulin promoter is inserted to the long KASII genome area of 315bp middle to allow to carry out targeted integration (pSZ1503).

Relevant limit site in pSZ1503 is indicated with lowercase, runic and the mode that underlines and is respectively 5 '-3 ' BspQ 1, Kpn I, AscI, Xho I, Sac I, BspQ I.BspQI defines in site 5 ' end and the 3 ' end of transfering DNA.Runic lowercase sequence means in S1331 to make it possible to carry out on the KASII locus by homologous recombination the genomic dna of targeted integration.Along 5 ' end to 3 ' extreme direction, drive the Chlamydomonas reinhardtii B-tubulin promoter that yeast invertase gene (giving the ability of S1331 metabolism sucrose) is expressed to be indicated by the word that adds square frame.The initial sub-ATG of saccharase and terminator TGA are by the indication of capitalization bold Italic word, and coding region is with the italics indication of small letter.Chlorella vulgaris nitrate reductase 3 ' UTR is by the underlined word indication of small letter.

PSZ1503_[KASII_btub-y.inv-nr_KASII] in the nucleotide sequence of contained transfering DNA:

Indicate respectively the cDNA of KAS II allelotrope 1 and allelotrope 2 with SEQ ID NO:279 and 280.Indicate respectively the aminoacid sequence of allelotrope 1 and 2 with SEQ ID NO:281 and 282.

For the impact of determining that the KASII inactivation forms lipid, the pSZ1503 carrier DNA is transformed in S1331 and knocks out phenotype to produce target KASII.Separate initial single clone and it is grown in for 5.0 times under the lipid generation condition of standard at pH.The resulting kenel of best representative clone and wild-type cell is showed in following table 31.

The lipid acid kenel of the derivative transgenic line of showing 31.S1331 and transforming with pSZ1503DNA.

Embodiment 12: with the alternative mark, to former algae, carry out engineered

A. the alpha-galactosidase that can secrete is expressed in the former algae of mulberry fruit shape

Make method that the heterology invertase gene expresses in former Trentepohlia species and impact before have been described in PCT and apply for that in No. PCT/US2009/66142, described application is incorporated to this paper by reference at this.Study in the present embodiment the expression of other heterology polysaccharide degrading enzyme.The former algae UTEX 1435 of mulberry fruit shape that test has one of following allogenic gene of coding alpha-galactosidase utilizes the ability of melibiose (α-D-gal-glu) growth: from the MEL1 gene (aminoacid sequence is corresponding to NCBI accession number P04824 (SEQ ID NO:108)) of saccharomyces carlsbergensis, from the AglC gene (aminoacid sequence is corresponding to NCBI accession number Q9UUZ4 (SEQ ID NO:116)) of aspergillus niger, and (aminoacid sequence is corresponding to NCBI accession number P14749 (SEQ ID NO:120) from the alpha-galactosidase of higher plant guar-bean.Above-mentioned accession number and corresponding aminoacid sequence are incorporated to this paper by reference at this.In all cases, according to the preferential codon in the former algae of mulberry fruit shape, make for optimized gene.The relevant portion of expression cassette and sequence table number column are below.All expression cassettes are used for 5 of stable genomic integration ' end and 3 ' end Clp homologous recombination target sequence, Chlamydomonas reinhardtii TUB2 promotor/5 ' UTR and Chlorella vulgaris nitrate reductase 3 ' UTR.

With each the expression cassette utilization in three expression cassettes that contain saccharomyces carlsbergensis MEL1, aspergillus niger AlgC or guar-bean alpha-galactosidase gene as above in the via Particle Bombardment Transformation method described in embodiment 2, the former frustule of mulberry fruit shape transformed.Utilization contains the culture plate screening positive clone of 2% melibiose as sole carbon source.Do not see the group of guar-bean expression cassette transformant on culture plate.Select positive colony from the culture plate that contains saccharomyces carlsbergensis MEL1 transformant and aspergillus niger AlgC transformant.Utilize PCR, use target part Chlorella vulgaris 3 ' UTR and 3 ' to hold the primer of Clp homologous recombination target sequence to determine the integration of transfering DNA.

5 ' primer Chlorella vulgaris, 3 ' UTR: downstream Clp sequence (SEQ ID NO:123)

ACTGCAATGCTGATGCACGGGA

3 ' end primer Chlorella vulgaris, 3 ' UTR: downstream Clp sequence (SEQ ID NO:124)

TCCAGGTCCTTTTCGCACT

As negative control, also with the genomic dna in the described primer sets amplification former frustule of mulberry fruit shape that process does not transform.The product that increases of the genomic dna from wild-type cell not.

The ability that a plurality of positive colonies (as determined by PCR) of each generation of test in saccharomyces carlsbergensis MEL1 transformant and aspergillus niger AlgC transformant utilize the melibiose in liquid nutrient medium to grow as sole carbon source.In the condition described in above-described embodiment 1 and basic medium in the situation that use melibiose to make these through clonal growths of selecting 3 days as sole carbon source.The all clones that contain arbitrary alpha galactosides enzyme coding gene are firmly growth during this period of time, and through the wild-type algae strain transformed and the former algae of mulberry fruit shape of expressing Saccharomyces Cerevisiae in S UC2 invertase, does not utilize the growth of melibiose substratum poorly.These results show to use the alpha galactosides enzyme coding gene as the selective marker transformed.And these data show, the primary signal peptide be present in saccharomyces carlsbergensis MEL1 (SEQ ID NO:109) or aspergillus niger AlgC (SEQ IDNO:117) can be used for making the periplasm in the former frustule of protein target mulberry fruit shape.

B. the THIC gene supplements the VitB1 auxotrophy in former algae

Utilize the expression of exogenous THIC gene to study the VitB1 prototrophy of the former frustule of mulberry fruit shape.In plant and algae, the VitB1 biosynthesizing is carried out usually in plastid, and the most of core coded protein that therefore participates in its generation needs target plastid effectively.The former frustule of mulberry fruit shape is carried out DNA sequencing and transcribes the group order-checking and disclose, and except THIC, all genes of coding VitB1 biosynthetic enzyme all are present in genome.In order on the biological chemistry aspect, to dissect and to cause the auxotrophic dysfunction of VitB1, the growth of the research former frustule of mulberry fruit shape under following five kinds of different conditions: (1) is under 2 μ M vitamins exist; (2) there do not is VitB1; (3) there do not is VitB1, but have 2 μ M hydroxy ethylthiazoles (THZ); (4) there do not is VitB1, but have 2 μ M 2-methyl-4-amino-5-(aminomethyl) pyrimidine (PYR); And there is not VitB1 in (5), but there are 2 μ M THZ and 2 μ M PYR.The result of the growth experiment carried out under these 5 kinds of different conditions shows, the former frustule of mulberry fruit shape can de novo synthesis, but only in the situation that provide the PYR precursor to produce diphosphothiamine (TPP).This result is consistent with following hypothesis: the auxotrophic reason of VitB1 of the former algae of mulberry fruit shape is can not be from the synthetic oxymethylpyrimidine phosphoric acid (HMP-P) of aminoimidazole ribonucleotide, and this synthesizing is by the enzymatic conversion of THIC.

Utilize and above in the via Particle Bombardment Transformation method described in embodiment 2, the former frustule of mulberry fruit shape is transformed, so that it expresses glueballs algae C-169THIC (aminoacid sequence corresponding to JGI protein identification numbers 30481, and be incorporated to by reference this paper at this) and Saccharomyces Cerevisiae in S UC2 invertase (as selective marker).The upstream and downstream homologous recombination target sequence in the primary transit peptide sequence that this expression construct contains glueballs algae C-169THIC, the 6S zone of genomic dna, Chlamydomonas reinhardtii TUB2 promotor/5 ' UTR district (SEQ ID NO:104) and Chlorella vulgaris nitrate reductase 3 ' UTR (SEQ ID NO:115).Saccharomyces Cerevisiae in S UC2 expresses and to be driven by Chlamydomonas reinhardtii TUB2 promotor/5 ' UTR district (SEQ ID NO:114) equally and to contain Chlorella vulgaris nitrate reductase 3 ' UTR (SEQ ID NO:115).According to the preferential codon in the former algae of mulberry fruit shape, make for optimized gene.Correlated expression box sequence is listed in sequence table and is specified in hereinafter:

Containing VitB1, do not containing on the culture plate of sucrose as sole carbon source positive colony is being selected.Utilize PCR, be incorporated into glueballs algae C-169 THIC intragenic 5 ' end primer and the 3 ' end primer that annealed in the transfering DNA downstream on the 6S locus determine positive colony.Also utilize southern blotting technique to measure and determine definite positive colony through PCR.

In order to observe the VitB1 auxotrophy of the former frustule of wild-type mulberry fruit shape, need at first consume the inside VitB1 deposit of cell.In order to test the growth in not containing the substratum of VitB1, at first make cell grow into stationary phase in the substratum that contains 2 μ M VitB1s, then cell is not being reached approximately till 0.05 containing being diluted to optical density (OD) (OD750) under 750nm in the substratum of VitB1.And then make containing in the substratum of VitB1, do not growing into stationary phase (approximately 2 days to 3 days) through the cell of dilution.Use these cell inoculation culture things that lack VitB1 containing in the substratum of VitB1, not carry out increment study.The positive colony that wild-type cell is grown in containing the substratum of glucose as carbon source (contain or containing VitB1) and make to have primary transit peptides glueballs algae C-169THIC construct is grown in containing the substratum of sucrose as sole carbon source.Absorbancy by monitoring under 750nm is measured growth.The result demonstration of growth experiment, the extent of growth of algae strain in the substratum without VitB1 of express transgenic significantly is greater than the growth of wild-type cell in the substratum without VitB1.Yet transformant could not reach growth velocity and the cell density of wild-type cell in containing the substratum of VitB1.Transformant is cloned between the copy number without the glueballs algae enzyme of the increment in the substratum of VitB1 and process integration and also has strong correlation (be that genetically modified copy number is larger, the growth of cell in the substratum without VitB1 is better).

The expression construct that utilization contains glueballs algae THIC, Arabidopis thaliana THIC gene and synechocystis PCC6803thiC gene produces other transformant.In the situation that glueballs algae and Arabidopis thaliana THIC gene are replaced primary transit peptide sequence with the transit peptide sequence of original chlorella stearyl--ACP desaturase (SAD) gene.Synechocystis is that cyanobacteria and thiC protein do not contain primary transit peptide sequence.In synechocystis thiC construct, the transit peptide sequence of original chlorella SAD gene is fused on the N end of synechocystis thiC.In all cases, the optimization of sequence codon to express in the former algae of mulberry fruit shape.All three above-mentioned constructs all contain upstream and downstream homologous recombination target sequence (SEQID NO:82 and 84), original chlorella actin promoter/5 ' UTR and the original chlorella EF1A gene 3 ' UTR in genomic 6S zone.All three constructs all contain the neoR gene driven by Chlamydomonas reinhardtii TUB2 promotor/5 ' UTR (SEQ ID NO:114) and contain Chlorella vulgaris 3 ' UTR (SEQ ID NO:115) (can be selected by G418).The aminoacid sequence of Arabidopis thaliana THIC is corresponding to NCBI accession number NP_180524, and the aminoacid sequence of synechocystis thiC is corresponding to NCBI accession number NP_442586, and two sequences are incorporated to this paper by reference at this.Correlated expression box sequence is listed in sequence table and is specified in hereinafter:

Transform a plurality of clones of producing to be verified by PCR containing screening positive clone on the culture plate of G418 and select by each.Utilize pcr analysis, use following primer to determine the integration of transfering DNA construct in genomic 6S locus that contains respectively glueballs algae C-169 (thering is original chlorella transit peptides), Arabidopis thaliana and synechocystis PCC 6803 THIC genes:

5 ' end THIC glueballs algae is determined primer sequence (SEQ ID NO:141)

ACGTCGCGACCCATGCTTCC

3 ' end THIC determines primer sequence (SEQ ID NO:142)

GGGTGATCGCCTACAAGA

5 ' end THIC Arabidopis thaliana is determined primer sequence (SEQ ID NO:143)

GCGTCATCGCCTACAAGA

5 ' end thiC synechocystis is determined primer sequence (SEQ ID NO:144)

CGATGCTGTGCTACGTGA

In containing the substratum of G418, utilize process selection and definite positive colony of the transformant of variant construct to carry out the growth experiment (as described above) that the cell to lacking VitB1 carries out.All transformant all can grow in the substratum without VitB1 (stable degree difference).Growth in the substratum that growth by transformant in the substratum without VitB1 and wild-type cell are containing VitB1 compares demonstration, and the ability that maintains growth with regard to them in the substratum without VitB1 is arranged as follows: (1) transformation of Arabidopsis thaliana body; (2) glueballs algae C-169 (thering is original chlorella transit peptides) transformant; And (3) synechocystis transformant.These results show, although single Arabidopis thaliana THIC copy can supplement the VitB1 auxotrophy of the former frustule of mulberry fruit shape, a plurality of copies of glueballs algae C-169 (transit peptide sequence with primary transit peptide sequence or original chlorella) and synechocystis THIC are for can be in the situation that do not exist the VitB1 ramp required.In view of the mutability of the result of the different THIC from different sources, can not predict that any specific T HIC gene can supplement the ability of the dysfunction existed in former Trentepohlia species fully.

Three THIC aminoacid sequences are compared.Although have significant sequence conservation (41% consistence is arranged on the amino acid aspect) between the THIC of the thiC of synechocystis and glueballs algae and Arabidopis thaliana, lacked on the N end structural domain very conservative in algae and plant protein in cyanobacteria protein.Although lack described structural domain (and may cause textural difference), the construct of expressing synechocystis thiC still can recover the VitB1 prototrophy of the former frustule of mulberry fruit shape at least in part.

Embodiment 13: fuel production

A. utilize squeezing machine and squeezing subsidiary to extract oils from micro-algae

Utilize rotary dryer to make the micro-algal biomass drying that contains 38% oils (in DCW), make moisture content reach 5%-5.5%.Described biomass are sent in French L250 squeezing machine.Make 30.4kg (67lbs.) biomass by squeezing machine, and do not reclaim oils.Using identical combining through the microbial biomass of super-dry and the switchgrass of different weight percentage (as the squeezing subsidiary), and make it pass through squeezing machine.To combine the best overall percentage that can produce oil recovery through the microbial biomass of super-dry and the switchgrass of 20%w/w.Then squeeze cake is carried out to hexane extraction, and, for the situation of 20% switchgrass, ultimate yield is total usable oils (by weight) of 61.6%.Containing the biomass that surpass 50% oils (in dry cell weight) does not need to use squeezing subsidiary (as switchgrass) to discharge oils.Other method of utilizing squeezing machine to extract oils from micro-algae is described in PCT and applies in No. PCT/US2010/31108 and described application is incorporated to this paper by reference at this.

B. from former algae oils production biofuel

The degummed oil produced according to aforesaid method is carried out to transesterification, to produce fatty acid methyl ester from the former algae UTEX 1435 of mulberry fruit shape.The results are shown in following table 24.

The lipid kenel of oils is:

C10:0 0.02

C12:0 0.06

C14:0 1.81

C14.1 0.07

C16:0 24.53

C16:1 1.22

C18:0 2.34

C18:1 59.21

C18:2 8.91

C18:3 0.28

C20:0 0.23

C20:1 0.10

C20:1 0.08

C21:0 0.02

C22:0 0.06

C24:0 0.10

The kenel of the biofuel that table 24. is produced by the former algae triglyceride level of mulberry fruit shape oils

The lipid kenel of biofuel is similar to the lipid kenel height of raw material oils.Can carry out transesterification to other oils provided by method and composition of the present invention, comprise following biofuel to produce the lipid kenel: (a) C8-C14 accounts at least 4%; (b) C8 accounts at least 0.3%; (c) C10 accounts at least 2%; (d) C12 accounts at least 2%; And (3) C8-C14 accounts at least 30%.

By ASTM D6751 A1 method, measure, the low-temperature adaptation filterableness of the biofuel of producing is 120 seconds (for the 300ml volume).This test comprises the B100 of filter 23 00ml, is cooled to 40 ℉, continues 16 hours, is warming up to room temperature, and utilizes 0.7 micron glass fibre filter with stainless steel upholder to be filtered under vacuum.Can carry out transesterification to oils of the present invention, with produce the low-temperature adaptation time be shorter than 120 seconds, the biofuel that is shorter than 100 seconds and is shorter than 90 seconds.

C. the production of renewable diesel

To according to aforesaid method from the former algae UTEX of mulberry fruit shape 1435 produce and the lipid kenel with above-mentioned the present embodiment, for the production of the oils of biofuel, identical degummed oil carries out transesterification, with the production renewable diesel.

At first oils is carried out to hydrothermal process, with except deoxidation and glycerol backbone, produce n-paraffin.Then make N PARAFFIN & HEAVY NORMAL PARAFFIN hydrocarbon cracking and isomerization.The color atlas of this material is illustrated in Fig. 1.Then this material is carried out to cold filtration, remove approximately 5% C18 material.After cold filtration, the cumulative volume of this material is reduced to the flash-point volume and flash-point, ASTM D-86 distillation distribution, cloud point and viscosity are estimated.Flash-point is 63 ℃; Viscosity is 2.86cSt (centistoke); Cloud point is 4 ℃.ASTM D86 distillation value is shown in table 25:

Table 25.ASTM D86 distillation value.

Reading (in ℃):

The T10-T90 of the material produced is 57.9 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the triglyceride level oils that the method for other covalent modification and distillation disclosed herein and the utilization of fractionation (as cold filtration) method produce according to method disclosed herein produce the renewable diesel composition with other T10-T90 scope (as 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 60 ℃ and 65 ℃).

The T10 of the material produced is 242.1 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other T10 value, such as the T10 value between 180 and 295, between 190 and 270, between 210 and 250, between 225 and 245 and be at least 290.

The T90 of the material produced is 300 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other T90 value, such as the T90 value between 280 and 380, between 290 and 360, between 300 and 350, between 310 and 340 and be at least 290.

The FBP of the material produced is 300 ℃.Can use hydrogenation treatment method, isomerization method and disclosed hereinly oils is carried out to the method for other covalent modification and distillation disclosed herein and fractionation (as cold filtration) method produce the renewable diesel composition with other FBP value, such as the FBP value between 290 and 400, between 300 and 385, between 310 and 370, between 315 and 360 and be at least 300.

The combination of hydrogen treatment, isomerization and other covalent modification can be provided other oils provided by method and composition of the present invention, and described other oils comprises that the lipid kenel comprises following oils: (a) C8-C14 accounts at least 4%; (b) C8 accounts at least 0.3%; (c) C10 accounts at least 2%; (d) C12 accounts at least 2%; And (3) C8-C14 accounts at least 30%.

Embodiment 14: produce tailor-made oil

Utilize the various tailor-made oils of method disclosed herein and material production.Table 32 shows the gene pool accession number of algae strain, the gene of giving phenotype and gene, and by shown in the various lipid acid kenels that produce of algae strain.Algae strain A and B are the former algae of mulberry fruit shape (UTEX 1435) algae strains, by the laboratory of charge, the two are carried out traditionally to mutagenic treatment to improve oily productive rate.Then the DNA construct that use as described herein is suitable is to algae strain A and B carries out genetically engineered so that it expresses required gene.As shown, also the algae strain is carried out engineered so that endogenous desaturase inactivation.The nucleotide sequence of thioesterase is carried out codon optimized so that its expression and uses it in former algae.

The lipid acid kenel through the engineered former algae of wild-type is not shown in the first row of table 32.Can see, in different algae strains, make in a different manner the lipid acid kenel occur significantly to change.For instance, the per-cent by the C8:0 do not produced through the former frustule of genetically engineered mulberry fruit shape is 0%.Yet, through engineered and express C8:0 that the spire calyx produces apart from the former frustule of mulberry fruit shape of flower thioesterase and be increased to and account for total triglyceride level 13.2% from accounting for total triglyceride level 0%.Again for instance, account for approximately 39% of total fatty acids through the combination total amount of C8:0 in engineered algae strain and C10:0.By contrast, in wild-type cell, the combination total amount of C8:0 and C10:0 is 0.01%.Again for instance, the total amount that makes saturated fatty acid by the cells that the white elm thioesterase is destroyed in the expression of endogenous SAD2b is from approximately 32% being increased to approximately 90%.This has increased almost 300%.

As hereinafter disclosed various lipid acid kenel can be for the multiple application that involves triglyceride level oils.The triglyceride level of the saturated fatty acid that for instance, comprises high-caliber short carbon chain length (C12:0, C14:0, C16:0) is particularly useful for producing renewable rocket engine fuel.For production of biodiesel, need the amount of C18:1 higher.For soap slab production, need to control and realize the proper equilibrium between saturation ratio and short chain fatty acid.For instance, the C12:0 of a large amount is that bubbling character is required, and longer chain length provides more structure, and the triglyceride level that contains linoleic acid plus linolenic acid does not cater to the need so because they can cause oxidative instability.For liquid soap, need the amount of C12:0 and C14:0 higher.In addition, for soap slab and liquid soap production, need the amount of C6:0, C8:0 and C10:0 lower, because these short chain triglyceride are skin irritants.

palm-kernel oil

We produce the microorganism palm-kernel oil stand-in that are similar to palm-kernel oil (PKO).In order to produce the palm-kernel oil stand-in, build plasmid and use it for conversion algae strain A, and carry out oils production.The bad Te Shi calyx that construct pSZ1413 (SEQ ID NO:231) comprises codon optimization is apart from flower FATB2 gene (SEQ ID NO:284) (gene pool accession number U56106) and SAD2B (stearyl--ACP desaturase) gene disruption.

As shown in following table 33, the palm-kernel oil stand-in are similar to palm-kernel oil.In the PKO stand-in, the per-cent of three kinds of lipid acid that content is the highest (C12:0, C14:0 and C18:1) is identical with palm-kernel oil or differ in 10% with palm-kernel oil.

The triglyceride level kenel of table 33. palm-kernel oil stand-in.

plam oil

We produce and are similar to palmitic microorganism plam oil stand-in.Build multiple different plasmid and it individually is transformed in algae strain A, and carrying out oils production.Design construction body pSZ1503 (SEQ ID NO:283) is to destroy endogenous KASII gene.Construct pSZ1439 (SEQ ID NO:237) comprises the oil palm TE gene (SEQID NO:205) (gene pool accession number AAD42220.2) that codon is optimized.The spire calyx that construct pSZ1420 (SEQ IDNO:225) comprises codon optimization is apart from flower TE gene (SEQ ID NO:201) (gene pool accession number Q39513).The spire calyx that construct pSZ1119 (SEQ ID NO:227) comprises codon optimization is apart from spending KAS IV gene (SEQ ID NO:186) (gene pool accession number AF060519) and bad Te Shi calyx apart from flower FATB2 gene (SEQ ID NO:184) (gene pool accession number U56104).

As shown in following table 34, the plam oil stand-in are similar to plam oil.In the plam oil stand-in, the per-cent of three kinds of lipid acid that content is the highest (C16:0, C18:1 and C18:2) is identical with plam oil or differ in 10% with plam oil.

The triglyceride level kenel of table 34. plam oil stand-in.

theobroma oil

We produce the microorganism theobroma oil stand-in that are similar to theobroma oil.Build construct pSZ1451 and be transformed in algae strain A by it and carry out oils production.Construct pSZ1451 (SEQ ID NO:239) comprises the safflower TE gene (SEQID NO:187) (gene pool accession number AAA33019.1) that codon is optimized.

As shown in following table 35, theobroma oil oils stand-in are similar to theobroma oil.In the theobroma oil stand-in, the per-cent of three kinds of lipid acid that content is the highest (C16:0, C18:0 and C18:1) is identical with theobroma oil or differ in 10% with theobroma oil.

The triglyceride level kenel of table 35. theobroma oil stand-in.

C8:0 C10:0 C12:0 C14:0 C16:0 C18:0 C18:1 C18:2

Theobroma oil 0 0-1 0-1 0-4 22-38 24-37 29-38 0-3

PSZ1451 0.05 0.14 0.99 28.34 27.39 29.40 10.26

lard

We produce the microorganism lard stand-in that are similar to lard.Build multiple different plasmid and it individually is transformed in algae strain A, and carrying out oils production.Design construction body pSZ1493 (SEQ ID NO:241) is to destroy endogenous SAD 2B gene and to express the California bay TE gene (SEQ ID NO:285) (gene pool accession number M94159) that codon is optimized simultaneously.Design construction body pSZ1452 (SEQ ID NO:240) is to destroy endogenous SAD 2B gene and to express the mangosteen TE gene (SEQ ID NO:196) (gene pool accession number AAB51525.1) that codon is optimized.The swede type rape TE gene (SEQ ID NO:195) (gene pool accession number CAA52070.1) that design construction body pSZ1449 (SEQ ID NO:238) optimizes to express codon.The polymerized nucleoside acid sequence of construct pSZ1458 is consistent with pSZ1449, makes an exception as the polymerized nucleoside acid sequence (SEQ ID NO:195) (gene pool accession number CAA52070.1) of the coding spire calyx with codon optimization apart from polymerized nucleoside acid sequence (gene pool accession number U39834) the permutation encoding swede type rape TE gene of flower thioesterase.

As shown in following table 36, the lard stand-in are similar to lard.In the lard stand-in, the per-cent of three kinds of lipid acid that content is the highest (C16:0, C18:0 and C18:1) is identical with lard or differ in 10% with lard.

The triglyceride level kenel of table 36. lard stand-in.

Although the present invention is described together with its particular, should be appreciated that and can further improve it.The application intention contains according to principle of the present invention and comprises of the present invention any variation, purposes or the adjustment that departs from this paper disclosure, known or convention and the key character that is applicable to above set forth in field under the present invention.

All reference that this paper quotes, comprise patent, patent application and announcement (comprising the gene pool accession number) this by reference integral body be incorporated to this paper, no matter before whether specifically be incorporated to.The purpose of quoting the mentioned publication of this paper is to describe and disclose for reagent of the present invention, method and concept.This paper does not regard as and admits that these reference are prior aries relevant to the present invention as herein described.Specifically, following patent application this for all purposes by reference integral body be incorporated to this paper: the PCT that the name of submitting on June 2nd, 2008 is called " Production of Oil in Microorganisms " applies for No. PCT/US2008/065563; The PCT that the name of submitting on April 14th, 2010 is called " Methods ofMicrobial Oil Extraction and Separation " applies for No. PCT/US2010/31108; And PCT that the name submitted to is called " Production of Tailored Oils in Heterotrophic Microorganisms " applies for No. PCT/US2009/066142 on November 30th, 2009.

Claims (69)

1. an oleaginous microorganism cell that comprises triglyceride level oils, the lipid acid kenel choosing of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%.

2. oleaginous microorganism cell as claimed in claim 1, wherein said oleaginous microorganism cell comprises allogenic gene, and optionally inactivation or the sudden change and have less enzymic activity of the endogenous desaturase of wherein said oleaginous microorganism cell.

3. oleaginous microorganism cell as claimed in claim 2, the lipid acid kenel of wherein said triglyceride level oils is similar to the triglyceride level oil type state of naturally occurring oils.

4. oleaginous microorganism cell as claimed in claim 3, the group that wherein said naturally occurring oils selects free theobroma oil, Oleum Cocois, plam oil, palm-kernel oil, shea butter, tallow and lard to form.

5. oleaginous microorganism cell as claimed in claim 2, the lipid acid kenel of wherein said triglyceride level oils comprises the freely kenel of the following group formed of choosing: the combination total amount of C8:0 and C10:0 is at least about 10%; The combination total amount of C10:0, C12:0 and C14:0 is at least about 50%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%; And the combination total amount of C18:1 and C18:2 is less than approximately 30%.

6. oleaginous microorganism cell as claimed in claim 1, the lipid acid kenel of wherein said triglyceride level oils comprises the freely fatty acid rate of the following group formed of choosing: the ratio of C8:0 and C10:0 is at least about 5: 1; The ratio of C10:0 and C12:0 is at least about 6: 1; The ratio of C12:0 and C14:0 is at least about 5: 1; The ratio of C14:0 and C12:0 is at least about 7: 1; And the ratio of C14:0 and C16:0 is at least about 1: 2.

7. oleaginous microorganism cell as claimed in claim 2, the group that wherein said endogenous desaturase selects free stearyl-ACP desaturase and δ-12 fatty acid desaturase to form.

8. oleaginous microorganism cell as claimed in claim 7, freely the encode group of genomic constitution of fatty acyl-acp thioesterase of wherein said allogenic gene choosing.

9. oleaginous microorganism cell as claimed in claim 8, wherein said allogenic gene coding fatty acyl-acp thioesterase, described fatty acyl-acp thioesterase choosing is the following group formed freely: California bay fatty acyl group-ACP thioesterase (gene pool numbering AAC49001); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering Q39473); California bay fatty acyl group-ACP thioesterase (gene pool numbering Q41635); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71730); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering ABD83939); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAD42220); Cortex Populi Tomentosae fatty acyl group-ACP thioesterase (gene pool numbering ABC47311); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering NP_172327); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85387); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85388); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering Q9SQI3); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAA54060); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC72882); U.S. leaf calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering ABB71581); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAC19933); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAL15645); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering Q39513); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering AAD01982); Grape fatty acyl group-ACP thioesterase (gene pool numbering CAN81819); Mangosteen fatty acyl group-ACP thioesterase (gene pool numbering AAB51525); Leaf mustard fatty acyl group-ACP thioesterase (gene pool numbering ABI18986); Illipe butter resin fat fatty acyl-acp thioesterase (gene pool numbering AAX51637) comes into leaves; Swede type rape fatty acyl group-ACP thioesterase (gene pool numbering ABH11710); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY86877); Rice (japonica rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering NP_001068400); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY99617); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49269); White elm fatty acyl group-ACP thioesterase (gene pool numbering AAB71731); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAB60830); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49180); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858.1); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49179); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB717291.1); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering U39834); California bay fatty acyl group-ACP thioesterase (gene pool numbering M94159); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering U31813); Rely the Te Shi calyx apart from flower fatty acyl group-ACOP thioesterase (gene pool numbering U56103); And common species castor-oil plant fatty acyl group-ACP thioesterase (gene pool numbering ABS30422).

10. oleaginous microorganism cell as claimed in claim 2, wherein said oleaginous microorganism cell further comprises the gene of encoding sucrose saccharase.

11. oleaginous microorganism cell as claimed in claim 2, wherein said oleaginous microorganism cell is to be selected from following micro-Trentepohlia or the cell of species: the bent shell algae in east, Ah lattice's Trentepohlia, transparent cocoon shape algae, Amphora coffeaeformis, the linear mutation of Amphora coffeaeformis, the mutation of Amphora coffeaeformis point line, Amphora coffeaeformis Tai Leshi mutation, the small-sized mutation of Amphora coffeaeformis, graceful two eyebrow algae, graceful two eyebrow algae head mutation, double eyebrow algae spp, the necklace Trentepohlia, Ankistrodesmus, the crescent algae fibre, gold look algae, the Podbielniak Trentepohlia, Botryococcus braunii, Su Taidekesi grape algae, block special Trentepohlia, Chaetoceros gracilis, Chaetoceros muelleri, the wide salt mutation of Chaetoceros muelleri, Chaetoceros belongs to, without the nitre chlorella, South Pole chlorella, the green chlorella of gold, the Ka Shi chlorella, the packing chlorella, the dehydration chlorella, oval chlorella, chlorella swims, the light brown chlorella, the mutation of light brown chlorella cavity, the Gu Shi chlorella, water small stream chlorella, the seashore mutation of dwelling of water small stream chlorella, water small stream chlorella increases mutation, the Kai Shi chlorella, crawl and fan chlorella (algae strain SAG 37.88), yellowish green chlorella, the green mutation of yellowish green chlorella gold, the yellowish mutation of yellowish green chlorella, the red algae chlorella, atomic chlorella, the sudden change chlorella, night chlorella, bar Fu Shi chlorella, have a liking for the light chlorella, the Pu Shi chlorella, original chlorella (comprises UTEX algae strain 1806, 411, 264, 256, 255, 250, 249, 31, 29, 25 and the strain 211/17 of CCAP algae and 211/8d in any), the acidproof mutation of original chlorella, the rule chlorella, the small-sized mutation of rule chlorella, the mutation of rule chlorella umbrella, the Rui Shi chlorella, have a liking for sugared chlorella, have a liking for the oval mutation of sugared chlorella, the living chlorella of salt, simple chlorella, the thermotolerance chlorella, Chlorella, the spheroidal globule algae, the Si Dige chlorella, ten thousand Nissl chlorellas, Chlorella vulgaris, Chlorella vulgaris, Chlorella vulgaris tertia modification, the mutation of Chlorella vulgaris autotrophy, the green mutation of Chlorella vulgaris, the common mutation of Chlorella vulgaris, the common mutation tertia of Chlorella vulgaris modification, the green modification of the common mutation of Chlorella vulgaris, yellow chlorella, the Zuo Shi chlorella, his Bai Shi chlorella, Chlorella vulgaris, water small stream Chlorococcum, Chlorococcum, green shuttle Trentepohlia, Chroomonas, the gold goal Trentepohlia, ball calcium plate Trentepohlia, hidden Trentepohlia, hidden little ring algae, Mei Ni little encircles algae, Cyclotella, Dunaliella, Baeyer Dai Weile Dunaliella salina, the eyes Dunaliella salina, the particulate state Dunaliella salina, the ocean Dunaliella salina, small Dunaliella salina, bar husband Dunaliella salina, than thunder Dunaliella salina, the Pu Linmo Dunaliella salina, Dunaliella salina, the Lu Sheng Dunaliella salina, the Te Shi Dunaliella salina, green Dunaliella salina, the Te Shi Dunaliella salina, green solely ball algae, only ball Trentepohlia, oval Trentepohlia, Euglena, the Fu Shi Trentepohlia, the crisp bar algae in Crow, Fragilaria, Gloeocapsa, the Liz Trentepohlia, hymenomonas, Isochrysis galbana ball affinis, Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEX LB 2614), small single needle algae, the single needle Trentepohlia, Nannochloropsis oceanica belongs to, salt is given birth to micro-plan ball algae, micro-Sphaerellopsis, agreeable boat-shaped algae, Bi Shi boat-shaped algae, Navicula pseudotenelloides, film boat-shaped algae, have a liking for rotten boat-shaped algae, Navicula, the kidney Dictyocha, Nephroselmis, common rhombus algae, Alexandria rhombus algae, common rhombus algae, disperse the rhombus algae, fragment rhombus algae, Han Shi rhombus algae, mediocre rhombus algae, medium-sized rhombus algae, microcephaly's rhombus algae, small rhombus algae, the oval mutation of small rhombus algae, small rhombus algae does not receive mutation, tetragon rhombus algae, Nitzschia, Ochromonas, ovule born of the same parents algae, minimum ooecium algae, the ooecium Trentepohlia, algae quivers in lake, Oscillatoria, the inferior short algae that quivers, have a liking for sour Pa Shi algae, bar husband Trentepohlia, Phacus, Phormidium, flat algae belongs to, the Ka Shi cocolith, the dentation cocolith, the coccolith Trentepohlia, Prototheca wickerhamii, the stagnant former algae of harmony, the former algae of Puerto Rico, the former algae of mulberry fruit shape, the former algae of Rao Shi, tower born of the same parents Trentepohlia, the mulberry fruit Trentepohlia, the cryptomere chrysophyceae, by first grid algae, Spirogyra, spirulina plalensis, split the Ulothrix, synechococcus belongs to, four Ceratiums, four slit bamboo or chopped wood Trentepohlias, department Xisi slit bamboo or chopped wood algae, Wei Shi hailian seaweed and Viridiella fridericiana.

12. oleaginous microorganism cell as claimed in claim 11, wherein said oleaginous microorganism cell is the cell of described former Trentepohlia.

13. oleaginous microorganism cell as claimed in claim 12, wherein said oleaginous microorganism cell is the cell of the former Trentepohlia of described mulberry fruit shape.

14. oleaginous microorganism cell as claimed in claim 2, wherein said oleaginous microorganism cell is the oleaginous yeast cell.

15. oleaginous microorganism cell as claimed in claim 2, wherein said oleaginous microorganism cell is the produce oil bacterial cell.

16. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is theobroma oil, and wherein said allogenic gene comprises the safflower thioesterase gene.

17. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is Oleum Cocois.

18. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is plam oil, and wherein said allogenic gene comprises oil palm thioesterase gene, spire calyx apart from flower thioesterase gene, spire calyx apart from the combination of spending KAS IV gene and bad Te Shi calyx apart from flower FATB2 gene, or through designing to destroy the construct of endogenous KAS II gene.

19. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is palm-kernel oil, and wherein said allogenic gene comprises bad Te Shi calyx apart from flower FATB2 gene and the combination with the construct of destruction endogenous SAD2B gene through design.

20. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is shea butter.

21. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is tallow.

22. oleaginous microorganism cell as claimed in claim 4, wherein said naturally occurring oils is lard, and wherein said allogenic gene comprises California bay thioesterase gene and combination, mangosteen thioesterase gene and combination, the swede type rape thioesterase gene of process design with the construct of destruction endogenous SAD2B gene through designing the construct to destroy endogenous SAD2B gene, or the spire calyx is apart from the flower thioesterase gene.

23. an oleaginous microorganism triglyceride oil based composition, the lipid acid kenel choosing of wherein said triglyceride level oils is the following group formed freely: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%.

24. oleaginous microorganism triglyceride oil based composition as claimed in claim 23, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, wherein said oleaginous microorganism cell comprises allogenic gene, and optionally inactivation or the sudden change and have less enzymic activity of the endogenous desaturase of wherein said oleaginous microorganism cell.

25. oleaginous microorganism triglyceride oil based composition as claimed in claim 24, the lipid acid kenel of wherein said triglyceride level oils is similar to the triglyceride level oil type state of naturally occurring oils.

26. oleaginous microorganism triglyceride oil based composition as claimed in claim 25, the group that wherein said naturally occurring oils selects free theobroma oil, Oleum Cocois, plam oil, palm-kernel oil, shea butter, tallow and lard to form.

27. oleaginous microorganism triglyceride oil based composition as claimed in claim 24, the lipid acid kenel of wherein said triglyceride level oils comprises following kenel, and in described kenel, the combination total amount of C10:0, C12:0 and C14:0 is at least about 50%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C8:0 and C10:0 is less than approximately 50%.

28. oleaginous microorganism triglyceride oil based composition as claimed in claim 24, the lipid acid kenel of wherein said triglyceride level oils comprises the freely fatty acid rate of the following group formed of choosing: the ratio of C8:0 and C10:0 is at least about 5: 1; The ratio of C10:0 and C12:0 is at least about 6: 1; The ratio of C12:0 and C14:0 is at least about 5: 1; The ratio of C14:0 and C12:0 is at least about 7: 1; The ratio of C14:0 and C16:0 is at least about 1: 2.

29. oleaginous microorganism triglyceride oil based composition as claimed in claim 24; described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, the group that wherein said endogenous desaturase selects free stearyl-ACP desaturase and δ-12 fatty acid desaturase to form.

30. oleaginous microorganism triglyceride oil based composition as claimed in claim 29; described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, the allogenic gene that wherein said oleaginous microorganism cell comprises the fatty acyl-acp thioesterase of encoding.

31. oleaginous microorganism triglyceride oil based composition as claimed in claim 30, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, the allogenic gene that wherein said oleaginous microorganism cell comprises the fatty acyl-acp thioesterase of encoding, described fatty acyl-acp thioesterase choosing is the following group formed freely: California bay fatty acyl group-ACP thioesterase (gene pool numbering AAC49001); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering Q39473); California bay fatty acyl group-ACP thioesterase (gene pool numbering Q41635); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71730); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering ABD83939); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAD42220); Cortex Populi Tomentosae fatty acyl group-ACP thioesterase (gene pool numbering ABC47311); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering NP_172327); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85387); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85388); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering Q9SQI3); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAA54060); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC72882); U.S. leaf calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering ABB71581); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAC19933); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAL15645); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering Q39513); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering AAD01982); Grape fatty acyl group-ACP thioesterase (gene pool numbering CAN81819); Mangosteen fatty acyl group-ACP thioesterase (gene pool numbering AAB51525); Leaf mustard fatty acyl group-ACP thioesterase (gene pool numbering ABI18986); Illipe butter resin fat fatty acyl-acp thioesterase (gene pool numbering AAX51637) comes into leaves; Swede type rape fatty acyl group-ACP thioesterase (gene pool numbering ABH11710); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY86877); Rice (japonica rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering NP_001068400); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY99617); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49269); White elm fatty acyl group-ACP thioesterase (gene pool numbering AAB71731); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAB60830); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49180); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858.1); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49179); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB717291.1); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering U39834); California bay fatty acyl group-ACP thioesterase (gene pool numbering M94159); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering U31813); Rely the Te Shi calyx apart from flower fatty acyl group-ACOP thioesterase (gene pool numbering U56103); And common species castor-oil plant fatty acyl group-ACP thioesterase (gene pool numbering ABS30422).

32. oleaginous microorganism triglyceride oil based composition as claimed in claim 31, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, and wherein said oleaginous microorganism cell further comprises the gene of encoding sucrose saccharase.

33. oleaginous microorganism triglyceride oil based composition as claimed in claim 32, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, and wherein said oleaginous microorganism cell is to be selected from following micro-Trentepohlia or the cell of species: the bent shell algae in east, Ah lattice's Trentepohlia, transparent cocoon shape algae, Amphora coffeaeformis, the linear mutation of Amphora coffeaeformis, the mutation of Amphora coffeaeformis point line, Amphora coffeaeformis Tai Leshi mutation, the small-sized mutation of Amphora coffeaeformis, graceful two eyebrow algae, graceful two eyebrow algae head mutation, double eyebrow algae spp, the necklace Trentepohlia, Ankistrodesmus, the crescent algae fibre, gold look algae, the Podbielniak Trentepohlia, Botryococcus braunii, Su Taidekesi grape algae, block special Trentepohlia, Chaetoceros gracilis, Chaetoceros muelleri, the wide salt mutation of Chaetoceros muelleri, Chaetoceros belongs to, without the nitre chlorella, South Pole chlorella, the green chlorella of gold, the Ka Shi chlorella, the packing chlorella, the dehydration chlorella, oval chlorella, chlorella swims, the light brown chlorella, the mutation of light brown chlorella cavity, the Gu Shi chlorella, water small stream chlorella, the seashore mutation of dwelling of water small stream chlorella, water small stream chlorella increases mutation, the Kai Shi chlorella, crawl and fan chlorella (algae strain SAG 37.88), yellowish green chlorella, the green mutation of yellowish green chlorella gold, the yellowish mutation of yellowish green chlorella, the red algae chlorella, atomic chlorella, the sudden change chlorella, night chlorella, bar Fu Shi chlorella, have a liking for the light chlorella, the Pu Shi chlorella, original chlorella (comprises UTEX algae strain 1806, 411, 264, 256, 255, 250, 249, 31, 29, 25 and the strain 211/17 of CCAP algae and 211/8d in any), the acidproof mutation of original chlorella, the rule chlorella, the small-sized mutation of rule chlorella, the mutation of rule chlorella umbrella, the Rui Shi chlorella, have a liking for sugared chlorella, have a liking for the oval mutation of sugared chlorella, the living chlorella of salt, simple chlorella, the thermotolerance chlorella, Chlorella, the spheroidal globule algae, the Si Dige chlorella, ten thousand Nissl chlorellas, Chlorella vulgaris, Chlorella vulgaris, Chlorella vulgaris tertia modification, the mutation of Chlorella vulgaris autotrophy, the green mutation of Chlorella vulgaris, the common mutation of Chlorella vulgaris, the common mutation tertia of Chlorella vulgaris modification, the green modification of the common mutation of Chlorella vulgaris, yellow chlorella, the Zuo Shi chlorella, his Bai Shi chlorella, Chlorella vulgaris, water small stream Chlorococcum, Chlorococcum, green shuttle Trentepohlia, Chroomonas, the gold goal Trentepohlia, ball calcium plate Trentepohlia, hidden Trentepohlia, hidden little ring algae, Mei Ni little encircles algae, Cyclotella, Dunaliella, Baeyer Dai Weile Dunaliella salina, the eyes Dunaliella salina, the particulate state Dunaliella salina, the ocean Dunaliella salina, small Dunaliella salina, bar husband Dunaliella salina, than thunder Dunaliella salina, the Pu Linmo Dunaliella salina, Dunaliella salina, the Lu Sheng Dunaliella salina, the Te Shi Dunaliella salina, green Dunaliella salina, the Te Shi Dunaliella salina, green solely ball algae, only ball Trentepohlia, oval Trentepohlia, Euglena, the Fu Shi Trentepohlia, the crisp bar algae in Crow, Fragilaria, Gloeocapsa, the Liz Trentepohlia, hymenomonas, Isochrysis galbana ball affinis, Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEXLB 2614), small single needle algae, the single needle Trentepohlia, Nannochloropsis oceanica belongs to, salt is given birth to micro-plan ball algae, micro-Sphaerellopsis, agreeable boat-shaped algae, Bi Shi boat-shaped algae, Navicula pseudotenelloides, film boat-shaped algae, have a liking for rotten boat-shaped algae, Navicula, the kidney Dictyocha, Nephroselmis, common rhombus algae, Alexandria rhombus algae, common rhombus algae, disperse the rhombus algae, fragment rhombus algae, Han Shi rhombus algae, mediocre rhombus algae, medium-sized rhombus algae, microcephaly's rhombus algae, small rhombus algae, the oval mutation of small rhombus algae, small rhombus algae does not receive mutation, tetragon rhombus algae, Nitzschia, Ochromonas, ovule born of the same parents algae, minimum ooecium algae, the ooecium Trentepohlia, algae quivers in lake, Oscillatoria, the inferior short algae that quivers, have a liking for sour Pa Shi algae, bar husband Trentepohlia, Phacus, Phormidium, flat algae belongs to, the Ka Shi cocolith, the dentation cocolith, the coccolith Trentepohlia, Prototheca wickerhamii, the stagnant former algae of harmony, the former algae of Puerto Rico, the former algae of mulberry fruit shape, the former algae of Rao Shi, tower born of the same parents Trentepohlia, the mulberry fruit Trentepohlia, the cryptomere chrysophyceae, by first grid algae, Spirogyra, spirulina plalensis, split the Ulothrix, synechococcus belongs to, four Ceratiums, four slit bamboo or chopped wood Trentepohlias, department Xisi slit bamboo or chopped wood algae, Wei Shi hailian seaweed and Viridiella fridericiana.

34. oleaginous microorganism triglyceride oil based composition as claimed in claim 24, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, and wherein said oleaginous microorganism cell is the cell of described former Trentepohlia.

35. oleaginous microorganism triglyceride oil based composition as claimed in claim 34, described composition is to produce by cultivate restructuring oleaginous microorganism cell colony in substratum, and wherein said oleaginous microorganism cell is the cell of the former Trentepohlia of described mulberry fruit shape.

36. oleaginous microorganism triglyceride level oils as claimed in claim 24, wherein said oleaginous microorganism cell is the oleaginous yeast cell.

37. oleaginous microorganism triglyceride level oils as claimed in claim 24, wherein said oleaginous microorganism cell is the produce oil bacterial cell.

38. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is Oleum Cocois.

39. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is plam oil, and wherein said allogenic gene comprises oil palm thioesterase gene, spire calyx apart from flower thioesterase gene, spire calyx apart from the combination of spending KAS IV gene and bad Te Shi calyx apart from flower FATB2 gene, or through designing to destroy the construct of endogenous KAS II gene.

40. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is palm-kernel oil, and wherein said allogenic gene comprises bad Te Shi calyx apart from flower FATB2 gene and the combination with the construct of destruction endogenous SAD2B gene through design.

41. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is shea butter.

42. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is tallow.

43. oleaginous microorganism triglyceride oil based composition as claimed in claim 26, wherein said naturally occurring oils is lard, and wherein said allogenic gene comprises California bay thioesterase gene and combination, mangosteen thioesterase gene and combination, the swede type rape thioesterase gene of process design with the construct of destruction endogenous SAD2B gene through designing the construct to destroy endogenous SAD2B gene, or the spire calyx is apart from the flower thioesterase gene.

44. oleaginous microorganism triglyceride oil based composition as claimed in claim 23, wherein said triglyceride oil based composition further comprises the freely attribute of the following group formed of choosing:

I. the total carotinoid that is less than 0.3mcg/g;

Ii. the Lyeopene that is less than 0.005mcg/g;

Iii. the β-carotene that is less than 0.005mcg/g;

Iv. the Chlorophyll A that is less than 0.3mcg/g;

V. the Gamma-Tocopherol that is less than 175mcg/g;

Vi. be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol;

Vii. the total tocotrienols that is less than 350mcg/g;

Viii. the xenthophylls that is less than 0.05mcg/g; Or

Ix. the tocopherol that is less than 275mcg/g.

45. a method for preparing oleaginous microorganism triglyceride oil based composition, described triglyceride oil based composition has the freely lipid acid kenel of the following group formed of choosing: C8:0 accounts at least about 1%; C10:0 accounts at least about 1%; C12:0 accounts at least about 1%; C14:0 accounts at least about 2%; C16:0 accounts at least about 30%; C18:0 accounts at least about 5%; C18:1 accounts at least about 60%; C18:2 accounts for and is less than approximately 7%; And saturated fatty acid accounts at least about 35%, said method comprising the steps of:

A. in substratum, cultivate the oleaginous microorganism cell colony until the dry cell weight of described oleaginous microorganism cell at least 10% be triglyceride level oils; And

B. isolate described triglyceride oil based composition from described oleaginous microorganism cell.

46. method as claimed in claim 45, wherein said oleaginous microorganism cell comprises allogenic gene, and optionally inactivation or the sudden change and have less enzymic activity of the endogenous desaturase of wherein said oleaginous microorganism cell.

47. method as claimed in claim 46, the lipid acid kenel of wherein said triglyceride level oils is similar to the triglyceride level oil type state of naturally occurring oils.

48. method as claimed in claim 47, the group that wherein said naturally occurring oils selects free theobroma oil, Oleum Cocois, plam oil, palm-kernel oil, shea butter, tallow and lard to form.

49. method as claimed in claim 46, the lipid acid kenel of wherein said triglyceride level oils comprises following kenel, and in described kenel, the combination total amount of C10:0, C12:0 and C14:0 is at least about 50%; The combination total amount of C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C18:0, C18:1 and C18:2 is at least about 60%; The combination total amount of C14:0, C16:0, C18:0 and C18:1 is at least about 60%; The combination total amount of C8:0 and C10:0 is less than approximately 50%.

50. method as claimed in claim 45, the lipid acid kenel of wherein said triglyceride level oils comprises the freely fatty acid rate of the following group formed of choosing: the ratio of C8:0 and C10:0 is at least about 5: 1; The ratio of C10:0 and C12:0 is at least about 6: 1; The ratio of C12:0 and C14:0 is at least about 5: 1; The ratio of C14:0 and C12:0 is at least about 7: 1; And the ratio of C14:0 and C16:0 is at least about 1: 2.

51. method as claimed in claim 46, the group that described endogenous desaturase selects free stearyl-ACP desaturase and δ-12 fatty acid desaturase to form.

52. method as claimed in claim 46, wherein said allogenic gene selects the group of the genomic constitution of the fatty acyl-acp thioesterase of freely encoding.

53. method as claimed in claim 52, wherein said allogenic gene coding fatty acyl-acp thioesterase, described fatty acyl-acp thioesterase choosing is the following group formed freely: California bay fatty acyl group-ACP thioesterase (gene pool numbering AAC49001); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering Q39473); California bay fatty acyl group-ACP thioesterase (gene pool numbering Q41635); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71730); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering ABD83939); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAD42220); Cortex Populi Tomentosae fatty acyl group-ACP thioesterase (gene pool numbering ABC47311); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering NP_172327); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85387); Arabidopis thaliana fatty acyl group-ACP thioesterase (gene pool numbering CAA85388); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering Q9SQI3); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAA54060); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC72882); U.S. leaf calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering ABB71581); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAC19933); Oil palm fatty acyl group-ACP thioesterase (gene pool numbering AAL15645); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering Q39513); Upland cotton fatty acyl group-ACP thioesterase (gene pool numbering AAD01982); Grape fatty acyl group-ACP thioesterase (gene pool numbering CAN81819); Mangosteen fatty acyl group-ACP thioesterase (gene pool numbering AAB51525); Leaf mustard fatty acyl group-ACP thioesterase (gene pool numbering ABI18986); Illipe butter resin fat fatty acyl-acp thioesterase (gene pool numbering AAX51637) comes into leaves; Swede type rape fatty acyl group-ACP thioesterase (gene pool numbering ABH11710); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY86877); Rice (japonica rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering NP_001068400); Rice (long-grained nonglutinous rice cultivar) fatty acyl group-ACP thioesterase (gene pool numbering EAY99617); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49269); White elm fatty acyl group-ACP thioesterase (gene pool numbering AAB71731); The lanceolata calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering CAB60830); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49180); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858); Iris germanica fatty acyl group-ACP thioesterase (gene pool numbering AAG43858.1); The wetland calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering AAC49179); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB71729); Semen Myristicae fat fatty acyl-acp thioesterase (gene pool numbering AAB717291.1); The spire calyx is apart from flower fatty acyl group-ACP thioesterase (gene pool numbering U39834); California bay fatty acyl group-ACP thioesterase (gene pool numbering M94159); Camphor tree fatty acyl group-ACP thioesterase (gene pool numbering U31813); Rely the Te Shi calyx apart from flower fatty acyl group-ACOP thioesterase (gene pool numbering U56103); And common species castor-oil plant fatty acyl group-ACP thioesterase (gene pool numbering ABS30422).

54. method as claimed in claim 46, wherein said oleaginous microorganism cell further comprises the gene of encoding sucrose saccharase.

55. method as claimed in claim 46, wherein said oleaginous microorganism cell is to be selected from following micro-Trentepohlia or the cell of species: the bent shell algae in east, Ah lattice's Trentepohlia, transparent cocoon shape algae, Amphora coffeaeformis, the linear mutation of Amphora coffeaeformis, the mutation of Amphora coffeaeformis point line, Amphora coffeaeformis Tai Leshi mutation, the small-sized mutation of Amphora coffeaeformis, graceful two eyebrow algae, graceful two eyebrow algae head mutation, double eyebrow algae spp, the necklace Trentepohlia, Ankistrodesmus, the crescent algae fibre, gold look algae, the Podbielniak Trentepohlia, Botryococcus braunii, Su Taidekesi grape algae, block special Trentepohlia, Chaetoceros gracilis, Chaetoceros muelleri, the wide salt mutation of Chaetoceros muelleri, Chaetoceros belongs to, without the nitre chlorella, South Pole chlorella, the green chlorella of gold, the Ka Shi chlorella, the packing chlorella, the dehydration chlorella, oval chlorella, chlorella swims, the light brown chlorella, the mutation of light brown chlorella cavity, the Gu Shi chlorella, water small stream chlorella, the seashore mutation of dwelling of water small stream chlorella, water small stream chlorella increases mutation, the Kai Shi chlorella, crawl and fan chlorella (algae strain SAG 37.88), yellowish green chlorella, the green mutation of yellowish green chlorella gold, the yellowish mutation of yellowish green chlorella, the red algae chlorella, atomic chlorella, the sudden change chlorella, night chlorella, bar Fu Shi chlorella, have a liking for the light chlorella, the Pu Shi chlorella, original chlorella (comprises UTEX algae strain 1806, 411, 264, 256, 255, 250, 249, 31, 29, 25 and the strain 211/17 of CCAP algae and 211/8d in any), the acidproof mutation of original chlorella, the rule chlorella, the small-sized mutation of rule chlorella, the mutation of rule chlorella umbrella, the Rui Shi chlorella, have a liking for sugared chlorella, have a liking for the oval mutation of sugared chlorella, the living chlorella of salt, simple chlorella, the thermotolerance chlorella, Chlorella, the spheroidal globule algae, the Si Dige chlorella, ten thousand Nissl chlorellas, Chlorella vulgaris, Chlorella vulgaris, Chlorella vulgaris tertia modification, the mutation of Chlorella vulgaris autotrophy, the green mutation of Chlorella vulgaris, the common mutation of Chlorella vulgaris, the common mutation tertia of Chlorella vulgaris modification, the green modification of the common mutation of Chlorella vulgaris, yellow chlorella, the Zuo Shi chlorella, his Bai Shi chlorella, Chlorella vulgaris, water small stream Chlorococcum, Chlorococcum, green shuttle Trentepohlia, Chroomonas, the gold goal Trentepohlia, ball calcium plate Trentepohlia, hidden Trentepohlia, hidden little ring algae, Mei Ni little encircles algae, Cyclotella, Dunaliella, Baeyer Dai Weile Dunaliella salina, the eyes Dunaliella salina, the particulate state Dunaliella salina, the ocean Dunaliella salina, small Dunaliella salina, bar husband Dunaliella salina, than thunder Dunaliella salina, the Pu Linmo Dunaliella salina, Dunaliella salina, the Lu Sheng Dunaliella salina, the Te Shi Dunaliella salina, green Dunaliella salina, the Te Shi Dunaliella salina, green solely ball algae, only ball Trentepohlia, oval Trentepohlia, Euglena, the Fu Shi Trentepohlia, the crisp bar algae in Crow, Fragilaria, Gloeocapsa, the Liz Trentepohlia, hymenomonas, Isochrysis galbana ball affinis, Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEX LB 2614), small single needle algae, the single needle Trentepohlia, Nannochloropsis oceanica belongs to, salt is given birth to micro-plan ball algae, micro-Sphaerellopsis, agreeable boat-shaped algae, Bi Shi boat-shaped algae, Navicula pseudotenelloides, film boat-shaped algae, have a liking for rotten boat-shaped algae, Navicula, the kidney Dictyocha, Nephroselmis, common rhombus algae, Alexandria rhombus algae, common rhombus algae, disperse the rhombus algae, fragment rhombus algae, Han Shi rhombus algae, mediocre rhombus algae, medium-sized rhombus algae, microcephaly's rhombus algae, small rhombus algae, the oval mutation of small rhombus algae, small rhombus algae does not receive mutation, tetragon rhombus algae, Nitzschia, Ochromonas, ovule born of the same parents algae, minimum ooecium algae, the ooecium Trentepohlia, algae quivers in lake, Oscillatoria, the inferior short algae that quivers, have a liking for sour Pa Shi algae, bar husband Trentepohlia, Phacus, Phormidium, flat algae belongs to, the Ka Shi cocolith, the dentation cocolith, the coccolith Trentepohlia, Prototheca wickerhamii, the stagnant former algae of harmony, the former algae of Puerto Rico, the former algae of mulberry fruit shape, the former algae of Rao Shi, tower born of the same parents Trentepohlia, the mulberry fruit Trentepohlia, the cryptomere chrysophyceae, by first grid algae, Spirogyra, spirulina plalensis, split the Ulothrix, synechococcus belongs to, four Ceratiums, four slit bamboo or chopped wood Trentepohlias, department Xisi slit bamboo or chopped wood algae, Wei Shi hailian seaweed and Viridiella fridericiana.

56. method as claimed in claim 55, wherein said oleaginous microorganism cell is the cell of described former Trentepohlia.

57. method as claimed in claim 56, wherein said oleaginous microorganism cell is the cell of the former Trentepohlia of described mulberry fruit shape.

58. method as claimed in claim 48, wherein said naturally occurring oils is Oleum Cocois.

59. method as claimed in claim 48, wherein said naturally occurring oils is plam oil, and wherein said allogenic gene comprises oil palm thioesterase gene, spire calyx apart from flower thioesterase gene, spire calyx apart from the combination of spending KAS IV gene and bad Te Shi calyx apart from flower FATB2 gene, or through designing to destroy the construct of endogenous KAS II gene.

60. method as claimed in claim 48, wherein said naturally occurring oils is palm-kernel oil, and wherein said allogenic gene comprises bad Te Shi calyx apart from flower FATB2 gene and the combination with the construct of destruction endogenous SAD2B gene through design.

61. method as claimed in claim 48, wherein said naturally occurring oils is shea butter.

62. method as claimed in claim 48, wherein said naturally occurring oils is tallow.

63. method as claimed in claim 48, wherein said naturally occurring oils is lard, and wherein said allogenic gene comprises California bay thioesterase gene and combination, mangosteen thioesterase gene and combination, the swede type rape thioesterase gene of process design with the construct of destruction endogenous SAD2B gene through designing the construct to destroy endogenous SAD2B gene, or the spire calyx is apart from the flower thioesterase gene.

64. a method of manufacturing oil-based products said method comprising the steps of:

A. oleaginous microorganism triglyceride oil based composition as claimed in claim 21 is selected to freely at least one chemical reaction of the following group formed: saponification; Metathesis; Acid hydrolysis; Basic hydrolysis; Enzymically hydrolyse; Catalytic hydrolysis; The hot pressurized water hydrolysis; Catalytic hydrolysis reaction, wherein make lipid resolve into glycerine and lipid acid; Produce the amination reaction of aliphatics nitrogen compound; Produce the ozonolysis reactions of monoprotic acid and diprotic acid; The triglyceride level decomposition reaction, select free enzymatic decomposition and pressure to decompose the group formed; Carry out condensation reaction after hydrolysis reaction; The hydrotreatment reaction; Hydrotreatment reaction and before the hydrotreatment reaction or simultaneously carry out deoxygenation or condensation reaction; Except solid/liquid/gas reactions; Deoxygenation, the group of selecting free hydrogenolysis, hydrogenation, continuous hydrogenation-hydrogenolysis, continuous hydrogenolysis-hydrogenation and associating hydrogenation-hydrogenolysis to form; Carry out condensation reaction after deoxygenation; Esterification; Transesterification reaction; Transesterification; Hydroxylating; And carry out condensation reaction after hydroxylating; And

Product and other component of b. separating described reaction.

65. method as described as claim 64, the group that wherein said oil-based products selects free soap, fuel, dielectric fluid, hydraulic liquid, softening agent, lubricant, heat-transfer fluid and metal working fluid to form.

66. method as described as claim 65, wherein said oil-based products is fuel product, and described fuel product choosing is the following group formed freely:

A. biofuel;

B. renewable diesel; And

C. rocket engine fuel.

67. method as described as claim 66, wherein said fuel product is biofuel, and described biofuel has following one or more attributes:

I. the total carotinoid that is less than 0.3mcg/g;

Ii. the Lyeopene that is less than 0.005mcg/g;

Iii. the β-carotene that is less than 0.005mcg/g;

Iv. the Chlorophyll A that is less than 0.3mcg/g;

V. the Gamma-Tocopherol that is less than 175mcg/g;

Vi. be less than 0.25% brassicasterol, campesterol, Stigmasterol or β-sitosterol;

Vii. the total tocotrienols that is less than 350mcg/g;

Viii. the xenthophylls that is less than 0.05mcg/g; Or

Ix. the tocopherol that is less than 275mcg/g.

68. method as described as claim 66, wherein said fuel product is renewable diesel, and the T10-T90 of described renewable diesel is at least 20 ℃, 40 ℃ or 60 ℃.

69. method as described as claim 66, wherein said fuel product is the rocket engine fuel that meets HRJ-5 and/or ASTM standard D1655.