CN102994618A - AKT3 gene mutation detection specificity primer and liquid chip thereof - Google Patents
AKT3 gene mutation detection specificity primer and liquid chip thereof Download PDFInfo
- Publication number
- CN102994618A CN102994618A CN2011102697736A CN201110269773A CN102994618A CN 102994618 A CN102994618 A CN 102994618A CN 2011102697736 A CN2011102697736 A CN 2011102697736A CN 201110269773 A CN201110269773 A CN 201110269773A CN 102994618 A CN102994618 A CN 102994618A
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- primer
- tag sequence
- akt3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an AKT3 gene mutation detection specificity primer and a liquid chip thereof. The liquid chip mainly comprises: an ASPE primer composed of a 5'-terminal tag sequence and a 3'-terminal specificity primer sequence focused on a target gene mutation site, wherein the specificity primer sequence comprises SEQ ID NO.7 and SEQ ID NO.8 focused on a G171R site; a microsphere coated by an anti-tag sequence; and an amplimer. The consistency between the detection result of the detection liquid chip provided by the invention and the detection result of a sequencing method is high to 100%, and the wild-type and mutant parallel detection of a plurality of mutation sites is realized.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of AKT3 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
AKT is human homology's gene of viral oncogene v-akt, the encoding serine Serineprotein kinase, in the relevant signal path of PI3K, play an important role, affect existence, propagation and the invasion and attack of cell, participate in comprising the cell processes of apoptosis and glucose metabolism.
Studies show that at present, in lung cancer and mammary cancer, AKT gene activation and chemotherapeutics resistance significant correlation, the relevant sudden change of the curative effect of AKT3 gene mainly contains G171R, (511G＞A) sudden change is that the glycine mutation of the 171st codon coding is arginine to G171R, and the AKT3 transgenation has become the focus of drug efficacy study.
At present, the method that determination and analysis is carried out in the AKT3 transgenation seldom mainly contains direct sequencing and PCR-RFLP analytical method, and wherein the most frequently used method has the PCR-RFLP analytical method.The PCR-RFLP method is based on the change of the restriction enzyme enzyme recognition site that transgenation causes, as losing or produce novel site in the site, by a certain specific fragment of pcr amplification, use again the digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, this method can directly be judged genotype for detection of the transgenation that restriction enzyme site changes, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not satisfy the needs of practical application.
Summary of the invention
One of purpose of the present invention provides the AKT3 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for detecting wild-type and the mutant of the common genotype G171R of AKT3 gene.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of AKT3 gene mutation detection liquid-phase chip includes:
(A). for the wild-type in AKT3 gene G171R site and the ASPE primer of mutant: every kind of ASPE primer is comprised of the tag sequence of 5 ' end and 3 ' the end specific primer sequence for the goal gene mutational site, and described specific primer sequence is: SEQID NO.7 and SEQ ID NO.8; Described tag sequence is selected from respectively two kinds of differences among SEQ ID NO.1～SEQ ID NO.6;
(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.14, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). being used for amplifying need to primer that detect, that have the target sequence in G171R site.
Preferably, described amplimer is: SEQ ID NO.15～SEQ ID NO.16.
Preferably, described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.7 and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.8.
Another object of the present invention provides the Auele Specific Primer for the AKT3 detection in Gene Mutation.
Concrete technical scheme is as follows:
Be used for the Auele Specific Primer of AKT3 detection in Gene Mutation, it is SEQ ID NO.7 and SEQ ID NO.8.Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below sequencing technologies commonly used, and realistic especially application needs.Prepared AKT3 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and basically there is not cross reaction between designed probe and the anti-tag sequence, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of SNP site.
2. the ASPE primer specificity primer of the present invention's design can sensitive be identified the mutational site of target detect specifically, accurately distinguishes the genotype of various types; In same reaction system, between the different Auele Specific Primers, basically do not have cross reaction between the pcr amplification product of Auele Specific Primer and non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of simultaneously parallel detection detects effect consistent.
3. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the defective that the repeatability of detected result is poor is improved existing liquid-phase chip technology simultaneously, so that prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value that detects improves greatly, thereby so that the sensitivity that detects is further enhanced, signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1 AKT3 gene mutation detection liquid-phase chip mainly includes:
One, ASPE primer
Wild-type and mutant for the common genotype G171R of AKT3 gene design respectively specific primer sequence.The ASPE primer is comprised of " tag sequence+specific primer sequence ".The ASPE primer sequence is as shown in the table:
Tag sequence in the ASPE primer sequence of table 1 AKT3 gene
| SEQ ID NO. | The tag sequence |
| 1 | CAATAAACTATACTTCTTCACTAA |
| 2 | TCAAAATCTCAAATACTCAAATCA |
| 3 | CTTTTCAATTACTTCAAATCTTCA |
| 4 | ATTATTCACTTCAAACTAATCTAC |
| 5 | CTTTTCATCTTTTCATCTTTCAAT |
| 6 | CTTTCAATTACAATACTCATTACA |
Specific primer sequence in the ASPE primer sequence of table 2 AKT3 gene
Every the ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on the corresponding microballoon, and 3 ' end is mutant or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffr.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select the tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, corresponding anti-tag sequence is as shown in table 3 on the microballoon numbering of selection and the microballoon:
Corresponding anti-tag sequence on table 3 microballoon numbering and the microballoon
| SEQ NO. | The microballoon numbering | The anti-tag sequence (5 '-3 ') of correspondence on the microballoon |
| 9 | 21 | TTAGTGAAGAAGTATAGTTTATTG |
| 10 | 23 | TGATTTGAGTATTTGAGATTTTGA |
| 11 | 31 | TGAAGATTTGAAGTAATTGAAAAG |
| 12 | 43 | GTAGATTAGTTTGAAGTGAATAAT |
| 13 | 35 | ATTGAAAGATGAAAAGATGAAAAG |
| 14 | 51 | TGTAATGAGTATTGTAATTGAAAG |
The microballoon of selecting is coated in the anti-tag sequence on the microballoon available from U.S. Luminex company.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and the microballoon, namely add the spacerarm sequence of the preceding paragraph 5-10 T before each anti-tag sequence, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With synthetic anti-tag sequence sterilization ddH
2O is made into the stock solution of 100nmol/ml.Described spacerarm is for being used for anti-tag and microsphere surface is spaced apart or anti-tag is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are such as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process that microballoon is coated with is as follows:
Get respectively 5 * 10
6The carboxylated microballoon of individual above-mentioned numbering (available from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (available from the Pierce Chemical company) working fluid of preparation 10ng/ml.The EDC working fluid that adds 2.5ul in the microballoon suspension, constant-temperature incubation 30 minutes adds the EDC working fluid of 2.5ul again, and constant-temperature incubation is 30 minutes again.After reaction finished, the Tween-20 washing with 0.02% was once washed once with 0.1% SDS liquid again.The microballoon that is coated with the anti-tag sequence after the washing is resuspended in the Tris-EDTA solution [10mmol/L Tris (pH8.0)] of 100ul, among the 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains the mutational site
For the common genotype G171R of AKT3 gene, design of amplification primers amplifies 1 target sequence that contains two mutational sites to (seeing Table 4).
Table 4 amplifies the primer of the target sequence with mutational site
All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses AKT3 gene test liquid-phase chip to the detection of sample
The prescription of described various solution is as follows:
MES damping fluid (pH5.0) prescription (250ml) of 50mM:
2 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5M NaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
Be stored in 4 ℃ after the filtration.
The ExoSAP-IT test kit is available from U.S. USB company.
Biotin labeled dCTP is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " methods involving about DNA extraction, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Design 1 pair of primer, pcr amplification goes out to contain the 1 objective sequence of the common genotype G171R of AKT3 gene, and the product size is respectively 388bp, and primer sequence (SEQ ID NO.7-8) is seen shown in the above-mentioned table 4.
At first prepare the multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.7-8 in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The multi-PRC reaction system is as follows:
The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
2.37 ℃ hatch 15min, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after the processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on the reacted product band.
At first prepare the ASPE primer working fluid that mixes: get respectively the corresponding wild-type of gene to be detected and mutant ASPE primer (the ASPE primer of the described liquid-phase chip of the present embodiment consists of specifically as shown in table 5) stock solution 10ul in the 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer and mend to 200ul, mix and be ASPE mix primer working fluid.
The design of table 5 liquid-phase chip preparation
The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
1. according to the ASPE primer of design, every group selection is coated microballoon (anti-tag is as described in Table 5) accordingly, and every kind of microballoon concentration is 2.5 * 10
5Individual/mi;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in 〉=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, the vortex mixing;
5. get the above-mentioned microballoon suspension of 25ul in the corresponding hole of 96 hole filter plates, control wells adds the ddH of 25ul
2O;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2O complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after the hybridization is in 〉=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in 〉=centrifugal the 2-5min of 3000g;
11. microballoon is resuspended in 1 * Tm hybridization buffer of 75ul, adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
12.37 ℃ hatch 15min, on the Luminex instrument, detect.
Six, the result detects and data analysis
The reaction after product detects by Luminex serial analysis instrument.Greater than 100 as the cut-off value, the MFI value that detects when mutant is judged that there is this mutation type in this sample, otherwise is judged that this sample is corresponding wild-type greater than 100 the time take mutant fluorescent value (MFI).
Use present method to detect the AKT3 transgenation of great amount of samples, compare with the liquid-phase chip result with the sequencing detection, calculate the identical rate of method detected result provided by the present invention.Present method detects 20 increments AKT3 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.As seen AKT3 gene mutation detection liquid-phase chip provided by the present invention can detect the mutation type of AKT3 gene exactly, and the result is reliable and stable.
One of table 6 pattern detection result (MFI)
Table 7 sample AKT3 gene mutation type analytical results
| Catalogue number(Cat.No.) | The liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | Wild-type | Wild-type |
| 3 | Wild-type | Wild-type |
| 4 | Wild-type | Wild-type |
| 5 | Wild-type | Wild-type |
| 6 | Wild-type | Wild-type |
| 7 | Wild-type | Wild-type |
| 8 | Wild-type | Wild-type |
| 9 | The G171R sudden change | The G171R sudden change |
| 10 | Wild-type | Wild-type |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | Wild-type | Wild-type |
| 14 | Wild-type | Wild-type |
| 15 | Wild-type | Wild-type |
| 16 | The G171R sudden change | The G171R sudden change |
| 17 | Wild-type | Wild-type |
| 18 | Wild-type | Wild-type |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of AKT3 gene SNP site
One, the design (selection of tag sequence and Anti-tag sequence) of liquid-phase chip preparation
Detect liquid-phase chip as example take AKT3 gene G171R site mutation, respectively for the wild-type of G171R and the specific primer sequence of mutant design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end then is selected from SEQ ID NO.1-SEQID NO.6, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing that is coated on the microballoon is selected from SEQ ID NO.9-SEQ ID NO.14.Specific design is shown in following table (table 8).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.
The design of table 8 liquid-phase chip preparation
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 21-40 is detected, detected result is as follows:
Table 9 pattern detection result and gene mutation analysis
Two of table 10 pattern detection result and gene mutation analysis
From experimental result as can be known, the ASPE primer uses different Tag sequences, and its result is still reliable and stable, but the ASPE primer is selected when the tag sequence is arranged in pairs or groups with specific primer sequence among the embodiment 2, effect better (signal to noise ratio is better) is referring to the present embodiment test group 1.
The selection of embodiment 4 AKT3 gene SNP detection specific primer sequences
One, the design (selection of wild-type and mutant specific primer sequence) of liquid-phase chip preparation
Detect liquid-phase chip as example take the SNP site of AKT3 gene G171R, take the forward or backwards complementary sequence of this place, mutational site target sequence as template, respectively for the wild-type of G171R and the specific primer sequence of mutant design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the invention 1, as shown in table 11.Wherein,
Interior base is the mutational site.
Table 11 specific primer sequence
Detect liquid-phase chip as example take the SNP site of AKT3 gene G171R, select different specific primer sequences for G171R, the tag sequence of ASPE primer 5 ' end then is fixed as the best effect sequence among the embodiment 1, and select with it corresponding anti-tag sequence, specific design is shown in following table (table 12).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.
Two of the design of table 12 liquid-phase chip preparation
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 41-60 is detected, detected result is as follows:
Table 13 pattern detection result and gene mutation analysis
By the present embodiment as seen, when the ASPE primer was selected among the embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better) was referring to the present embodiment test group 7.Other derives from different specific primer sequences and the collocation of tag sequence of the forward or backwards complementary sequence of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, namely still be that the specific primer sequence described in the embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
More than be for the specifying of possible embodiments of the present invention, but this embodiment limits claim of the present invention, allly do not break away from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the claim of the present invention.
Claims (5)
1. an AKT3 gene mutation detection liquid-phase chip is characterized in that, includes:
(A). for the wild-type in AKT3 gene G171R site and the ASPE primer of mutant: every kind of ASPE primer is comprised of the tag sequence of 5 ' end and 3 ' the end specific primer sequence for the goal gene mutational site, and described specific primer sequence is: SEQID NO.7 and SEQ ID NO.8; Described tag sequence is selected from respectively two kinds of differences among SEQ ID NO.1～SEQ ID NO.6;
(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.14, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). being used for amplifying need to primer that detect, that have the target sequence in G171R site.
2. AKT3 gene mutation detection liquid-phase chip according to claim 1 is characterized in that, described amplimer is: SEQ IDNO.15～SEQ ID NO.16.
3. AKT3 gene mutation detection liquid-phase chip according to claim 1 and 2 is characterized in that, described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.7 and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.8.
4. AKT3 gene mutation detection liquid-phase chip according to claim 1 and 2 is characterized in that, described spacerarm is 5-10 T.
5. be used for the Auele Specific Primer of AKT3 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is SEQ ID NO.7 and SEQID NO8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110269773.6A CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110269773.6A CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102994618A true CN102994618A (en) | 2013-03-27 |
| CN102994618B CN102994618B (en) | 2014-06-18 |
Family
ID=47923724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110269773.6A Active CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102994618B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010063300A1 (en) * | 2008-12-03 | 2010-06-10 | Università Degli Studi Di Torino | Isogenic human cell lines comprising mutated cancer alleles and process using the cell lines |
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
-
2011
- 2011-09-13 CN CN201110269773.6A patent/CN102994618B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010063300A1 (en) * | 2008-12-03 | 2010-06-10 | Università Degli Studi Di Torino | Isogenic human cell lines comprising mutated cancer alleles and process using the cell lines |
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| AIKO TANAKA ET AL: "IDENTIFICATION OF THE AKTR-2 AND AKT3-2 GENES REQUIRED FOR AK-TOXIN BIOSYNTHESIS IN THE JAPANESE PEAR PATHOTYPE OF ALTERNARIA ALTERNATA", 《THE FIRST ASIAN CONFERENCE ON PLANT PATHOLOGY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102994618B (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102994619A (en) | NRAS gene mutation detection specificity primer and liquid chip thereof | |
| CN101984072B (en) | PDGFRA gene mutation detection liquid-phase chip | |
| CN102994617A (en) | HRAS gene mutation detection specificity primer and liquid chip thereof | |
| CN102994621B (en) | PTPN11 gene mutation detection specificity primer and liquid chip thereof | |
| CN102994620B (en) | AKT1 gene mutation detection specificity primer and liquid chip thereof | |
| CN103374609A (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN103031369B (en) | CDKN2A gene mutation detection specific primer and liquid chip | |
| CN102994618B (en) | AKT3 gene mutation detection specificity primer and liquid chip thereof | |
| CN103031365A (en) | ATM gene mutation detection specific primer and liquid chip | |
| CN102912002A (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN103031368B (en) | FGFR1 gene mutation detection specific primer and liquid chip | |
| CN102912006B (en) | CYP2A6 gene polymorphism detection specific primers and liquid chip | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
| CN102994622B (en) | MET gene mutation detection specificity primer and liquid chip thereof | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN103031366B (en) | FGFR2 gene mutation detection specific primer and liquid chip | |
| CN102994625B (en) | PIK3R1 gene mutation detection specificity primer and liquid chip thereof | |
| CN102994616B (en) | MEK1 gene mutation detection specificity primer and liquid chip thereof | |
| CN103031371B (en) | CDH1 gene mutation detection specific primer and liquid chip | |
| CN102304566B (en) | Specific primers and liquid phase chip for polymorphic detection of human hedgehog interacting protein (HHIP) gene | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN102994623B (en) | STK11 gene mutation detection specificity primer and liquid chip thereof | |
| CN102304565B (en) | Specific primers and liquid phase chip for polymorphic detection of hemochromatosis (HFE) gene | |
| CN102952868B (en) | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |