CN102994618B - AKT3 gene mutation detection specificity primer and liquid chip thereof - Google Patents
AKT3 gene mutation detection specificity primer and liquid chip thereof Download PDFInfo
- Publication number
- CN102994618B CN102994618B CN201110269773.6A CN201110269773A CN102994618B CN 102994618 B CN102994618 B CN 102994618B CN 201110269773 A CN201110269773 A CN 201110269773A CN 102994618 B CN102994618 B CN 102994618B
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- primer
- tag sequence
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an AKT3 gene mutation detection specificity primer and a liquid chip thereof. The liquid chip mainly comprises: an ASPE primer composed of a 5'-terminal tag sequence and a 3'-terminal specificity primer sequence focused on a target gene mutation site, wherein the specificity primer sequence comprises SEQ ID NO.7 and SEQ ID NO.8 focused on a G171R site; a microsphere coated by an anti-tag sequence; and an amplimer. The consistency between the detection result of the detection liquid chip provided by the invention and the detection result of a sequencing method is high to 100%, and the wild-type and mutant parallel detection of a plurality of mutation sites is realized.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of AKT3 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
AKT is human homology's gene of viral oncogene v-akt, encoding serine Serineprotein kinase, in the relevant signal path of PI3K, play an important role, affect existence, propagation and the invasion and attack of cell, participate in the cell processes including apoptosis and glucose metabolism.
Research at present shows, in lung cancer and mammary cancer, AKT gene activation and chemotherapeutics resistance significant correlation, the relevant sudden change of curative effect of AKT3 gene mainly contains G171R, G171R (511G > A) sudden change is that the glycine mutation of the codon coding of the 171st is arginine, and AKT3 transgenation has become the focus of drug efficacy study.
At present, the method for AKT3 transgenation being carried out to determination and analysis is little, mainly contains direct sequencing and PCR-RFLP analytical method, and wherein the most frequently used method has PCR-RFLP analytical method.PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
Summary of the invention
One of object of the present invention is to provide AKT3 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for detecting wild-type and the saltant type of the common genotype G171R of AKT3 gene.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of AKT3 gene mutation detection liquid-phase chip, includes:
(A). the ASPE primer for wild-type and the saltant type in AKT3 gene G171R site: every kind of ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: SEQID NO.7 and SEQ ID NO.8; Described tag sequence is selected from respectively two kinds of differences in SEQ ID NO.1～SEQ ID NO.6;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.14, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). need primer detection, that there is the target sequence in G171R site for amplifying.
Preferably, described amplimer is: SEQ ID NO.15～SEQ ID NO.16.
Preferably, described ASPE primer is: the sequence being made up of SEQ ID NO.1 and SEQ ID NO.7 and the sequence being made up of SEQ ID NO.2 and SEQ ID NO.8.
Another object of the present invention is to provide the Auele Specific Primer for AKT3 detection in Gene Mutation.
Concrete technical scheme is as follows:
For the Auele Specific Primer of AKT3 detection in Gene Mutation, it is SEQ ID NO.7 and SEQ ID NO.8.Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared AKT3 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in multiple SNP site.
2. the ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also sudden change situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.
3. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1 AKT3 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of the common genotype G171R of AKT3 gene, design respectively specific primer sequence.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
Tag sequence in the ASPE primer sequence of table 1 AKT3 gene
| SEQ ID NO. | Tag sequence |
| 1 | CAATAAACTATACTTCTTCACTAA |
| 2 | TCAAAATCTCAAATACTCAAATCA |
| 3 | CTTTTCAATTACTTCAAATCTTCA |
| 4 | ATTATTCACTTCAAACTAATCTAC |
| 5 | CTTTTCATCTTTTCATCTTTCAAT |
| 6 | CTTTCAATTACAATACTCATTACA |
Specific primer sequence in the ASPE primer sequence of table 2 AKT3 gene
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffr.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on the microballoon numbering of selection and microballoon, corresponding anti-tag sequence is as shown in table 3:
Corresponding anti-tag sequence on table 3 microballoon numbering and microballoon
| SEQ NO. | Microballoon numbering | The anti-tag sequence (5 '-3 ') of correspondence on microballoon |
| 9 | 21 | TTAGTGAAGAAGTATAGTTTATTG |
| 10 | 23 | TGATTTGAGTATTTGAGATTTTGA |
| 11 | 31 | TGAAGATTTGAAGTAATTGAAAAG |
| 12 | 43 | GTAGATTAGTTTGAAGTGAATAAT |
| 13 | 35 | ATTGAAAGATGAAAAGATGAAAAG |
| 14 | 51 | TGTAATGAGTATTGTAATTGAAAG |
The microballoon of selecting, purchased from Luminex company of the U.S., is coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH
2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10
6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 DEG C keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For the common genotype G171R of AKT3 gene, design of amplification primers, to (in table 4), amplifies 1 target sequence that contains two mutational sites.
Table 4 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses the detection of AKT3 gene test liquid-phase chip to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
| Reagent | Source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5M NaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
After filtration, be stored in 4 DEG C.
ExoSAP-IT test kit is purchased from USB company of the U.S..
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to " molecular cloning " about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 1 pair of primer, pcr amplification goes out to contain the 1 objective sequence of the common genotype G171R of AKT3 gene, and product size is respectively 388bp, and primer sequence (SEQ ID NO.7-8) is shown in shown in above-mentioned table 4.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.7-8 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer (the ASPE primer of the liquid-phase chip described in the present embodiment forms specifically as shown in table 5) stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.
Design prepared by table 5 liquid-phase chip
The system of ASPE reaction is as follows:
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
1. according to the ASPE primer of design, every group selection is coated microballoon (anti-tag is as described in Table 5) accordingly, and every kind of microballoon concentration is 2.5 × 10
5individual/mi;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 DEG C, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Be greater than 100 as cut-off values taking saltant type fluorescent value (MFI), in the time that the MFI value of saltant type detection is greater than 100, judges that this sample exists this mutation type, otherwise judge that this sample is as corresponding wild-type.
Use present method to detect the AKT3 transgenation of great amount of samples, detect with liquid-phase chip result and compare with sequencing, calculate the identical rate of method detected result provided by the present invention.Present method detects 20 increments AKT3 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible AKT3 gene mutation detection liquid-phase chip provided by the present invention can detect the mutation type of AKT3 gene exactly, and result is reliable and stable.
One of table 6 pattern detection result (MFI)
Table 7 sample AKT3 gene mutation type analytical results
| Catalogue number(Cat.No.) | Liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | Wild-type | Wild-type |
| 3 | Wild-type | Wild-type |
| 4 | Wild-type | Wild-type |
| 5 | Wild-type | Wild-type |
| 6 | Wild-type | Wild-type |
| 7 | Wild-type | Wild-type |
| 8 | Wild-type | Wild-type |
| 9 | G171R sudden change | G171R sudden change |
| 10 | Wild-type | Wild-type |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | Wild-type | Wild-type |
| 14 | Wild-type | Wild-type |
| 15 | Wild-type | Wild-type |
| 16 | G171R sudden change | G171R sudden change |
| 17 | Wild-type | Wild-type |
| 18 | Wild-type | Wild-type |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to AKT3 gene SNP site
One, the design (selection of tag sequence and Anti-tag sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking AKT3 gene G171R site mutation, respectively for the wild-type of G171R and the specific primer sequence of saltant type design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQID NO.6, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.9-SEQ ID NO.14.Specific design is as shown in following table (table 8).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 8 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 9 pattern detection result and gene mutation analysis
Two of table 10 pattern detection result and gene mutation analysis
From experimental result, ASPE primer uses different Tag sequences, and its result is still reliable and stable, but ASPE primer is while selecting in embodiment 2 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1.
The selection of embodiment 4 AKT3 gene SNP detection specific primer sequences
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking the SNP site of AKT3 gene G171R, taking the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of G171R and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 11.Wherein,
interior base is mutational site.
Table 11 specific primer sequence
Detect liquid-phase chip as example taking the SNP site of AKT3 gene G171R, select different specific primer sequences for G171R, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 12).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 12 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 13 pattern detection result and gene mutation analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 7.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.
Claims (5)
1. an AKT3 gene mutation detection liquid-phase chip, is characterized in that, includes:
(A). the ASPE primer for wild-type and the saltant type in AKT3 gene G171R site: every kind of ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: SEQID NO.7 and SEQ ID NO.8; Described tag sequence is selected from respectively two kinds of differences in SEQ ID NO.1～SEQ ID NO.6;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.14, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). need primer detection, that there is the target sequence in G171R site for amplifying.
2. AKT3 gene mutation detection liquid-phase chip according to claim 1, is characterized in that, described amplimer is: SEQ IDNO.15～SEQ ID NO.16.
3. AKT3 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described ASPE primer is: the sequence being made up of SEQ ID NO.1 and SEQ ID NO.7 and the sequence being made up of SEQ ID NO.2 and SEQ ID NO.8.
4. AKT3 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of AKT3 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is SEQ ID NO.7 and SEQID NO8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110269773.6A CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110269773.6A CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102994618A CN102994618A (en) | 2013-03-27 |
| CN102994618B true CN102994618B (en) | 2014-06-18 |
Family
ID=47923724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110269773.6A Active CN102994618B (en) | 2011-09-13 | 2011-09-13 | AKT3 gene mutation detection specificity primer and liquid chip thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102994618B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010063300A1 (en) * | 2008-12-03 | 2010-06-10 | Università Degli Studi Di Torino | Isogenic human cell lines comprising mutated cancer alleles and process using the cell lines |
| CN101781684B (en) * | 2010-01-29 | 2013-04-24 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
-
2011
- 2011-09-13 CN CN201110269773.6A patent/CN102994618B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102994618A (en) | 2013-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102994619B (en) | NRAS gene mutation detection specificity primer and liquid chip thereof | |
| CN101984072B (en) | PDGFRA gene mutation detection liquid-phase chip | |
| CN102994617B (en) | HRAS gene mutation detection specificity primer and liquid chip thereof | |
| CN102533948B (en) | apoB (apolipoprotein B) gene SNP (Single Nucleotide Polymorphism) detection specific primer and liquid-phase chip | |
| CN102994621B (en) | PTPN11 gene mutation detection specificity primer and liquid chip thereof | |
| CN103374609B (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN102994620B (en) | AKT1 gene mutation detection specificity primer and liquid chip thereof | |
| CN103031369B (en) | CDKN2A gene mutation detection specific primer and liquid chip | |
| CN102994618B (en) | AKT3 gene mutation detection specificity primer and liquid chip thereof | |
| CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN102912006B (en) | CYP2A6 gene polymorphism detection specific primers and liquid chip | |
| CN103031368B (en) | FGFR1 gene mutation detection specific primer and liquid chip | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102994622B (en) | MET gene mutation detection specificity primer and liquid chip thereof | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN103031366B (en) | FGFR2 gene mutation detection specific primer and liquid chip | |
| CN102994616B (en) | MEK1 gene mutation detection specificity primer and liquid chip thereof | |
| CN103031371B (en) | CDH1 gene mutation detection specific primer and liquid chip | |
| CN102994625B (en) | PIK3R1 gene mutation detection specificity primer and liquid chip thereof | |
| CN102994624B (en) | PIK3R5 gene mutation detection specificity primer and liquid chip thereof | |
| CN102994623B (en) | STK11 gene mutation detection specificity primer and liquid chip thereof | |
| CN102304565B (en) | Specific primers and liquid phase chip for polymorphic detection of hemochromatosis (HFE) gene | |
| CN102912008B (en) | ABCG2 gene polymorphism detection specific primer and liquid phase chip | |
| CN102912007B (en) | CYP2B6 gene polymorphism detection specific primers and liquid chip | |
| CN103374611B (en) | LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB02 | Change of applicant information |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |