CN102978213B - Gene segment for coding swine beta interferon and application thereof - Google Patents

Abstract

The invention discloses a new nucleotide sequence of a mature peptide of a swine beta interferon, wherein the new nucleotide sequence is designed and synthesized by selecting a high-expression codon according to the codon bias of a pichia pastoris expression system. A recombinant yeast expression plasmid pPICZalphaC-IFN-beta is constructed successfully, not only is the swine beta interferon expressed accurately in the pichia pastoris, but also the swine beta interferon is easier to express in the pichia pastoris and is higher in expression quantity, and a foundation is laid for large-scale production and fermentation in genetic engineering.

Description

Gene fragment and the application thereof of coding porcine beta interferon

The application is to be on March 26th, 2010 applying date, and application number is: 201010139485.4, and denomination of invention is the divisional application of the patent application of " gene fragment and the application thereof of coding porcine alpha-IFN ".

Technical field

Gene fragment and the application thereof of porcine beta interferon the present invention relates to encode.

Background technology

Pig virus transmissible disease is spread unchecked day by day in recent years, is seriously threatening the sustainable development of China's livestock industry.The fast rapid change of immunosuppressive disease and virus antigen is different, often causes vaccine immunity failure; In addition constantly there is new virus disease, also there is no at present successful vaccine inoculation prevention.On the other hand, vaccine only has prophylactic effect to disease, and treatment also depends on antibiotic use.And the appearance of some drug-fast strains brings great threat to human food prods and health, some countries have prohibited and in breeding production, have applied some microbiotic and antiseptic-germicide.Therefore, in production in the urgent need to one not only effectively but also environmentally friendly novel method carry out prevention and control livestock and poultry.Facts have proved, Interferon, rabbit, as a kind of antiviral agent of wide spectrum, is having broad application prospects aspect the prevention and control of viral infectious.

Traditional production method: produce Interferon, rabbit by the induction of the inducer such as herbal medicine, many factors such as because of purifying process complexity, output is few, effect mitigation and greatly limited the application in clinical and scientific research.

Along with clone's success of porcine alpha-interferon gene, the clinical application to its recombinant products and the research of the mechanism of action also launch thereupon.Nineteen ninety, the people such as Lefevre and LaBonnar at expression in escherichia coli PoIFN-α l gene, obtain one containing 189 amino acid whose precursor proteins, remove its N end containing after 23 amino acid whose signal peptides, obtained having the product of complete natural PoIFN-α l biologic activity, and its antiviral activity on the sexual cell of pig source is at least 6 times of Interferon, rabbit that virus stimulates pig leucocyte to produce.Pol JM etc. (1991) study discovery: rPoIFN-α 1 can suppress the strong poison of Pseudorabies virus (PRV) and the mesogenic virus propagation at hog snout chamber mucous membrane tissue stroma cellular layer, pig inoblast and the porcine kidney cell of the processing of PRV inoculation Interferon, rabbit, virus titer obviously declines.Horisberger MA(1992) compare restructuring PoIFN-α (rPoIFN-α) and PoIFN-γ (rPoIFN-γ) difference of antiviral activity in the cell of pig of recombinating, find that rPoIFN-α can reduce the pathology that pig vesicular stomatitis virus (VSV) causes on pig PK-15 greatly, and can weaken pig vesicular stomatitis virus (VSV) and influenza virus copying in porcine kidney cell, but rPoIFN-α and rPoIFN-γ have antivirus action to encephalomyocardis virus (a kind of encephalomyocarditis virus).Jordan LT etc. (1994) find that rPoIFN-α has good prophylactic effect to Transmissible gastroenteritis virus (TGEV).After Tonomura N etc. (1996) research discovery HuIFN-α processing Vero, the propagation of PRV is suppressed, the mRNA of the immediate early gene of PRV reduces in the Vero of Interferon, rabbit processing, and transient expression test shows that transcribing by selectivity of PRV IE promotor suppress.BuddaertW(1998) to rPoIFN-α in vivo, outer pig breeding and the antiviral activity of disordered breathing syndrome virus (PRRSV) are studied, find PRRSV in vivo, outer all very sensitive to rPoIFN-α, rPoIFN-α can obviously suppress the output of PRRSV and the quantity of cells infected.(2001) people such as chinsangaram J. are with escherichia coli expression rPoIFN-α or rPolFN-β and carried out respectively foot-and-mouth disease virus resistant (FMDV) experiment, find that rPoIFN-α and rPoIFN-β suppress FMDV and copy in protein translation level, mainly the result that activates double-stranded RNA-dependent protein kinase (PKR) effect: in cell, add after PKR inhibitor 2-aminopurine, the output of virus will rise; And the cell of RNase L and PKR genetically deficient still can infect FMDV under the effect of Interferon, rabbit, this has absolutely proved that PKR works in inhibition virus replication.

Chinese scholar has also been carried out multinomial research to porcine alpha-IFN.Cao Ruibing etc. (2004) have cloned a kind of new pig IFN-α gene and in intestinal bacteria, have carried out the simple expression of its maturation protein, and expression product has higher antiviral activity.Du Yijun etc. utilize the mature protein gene of pig IFN-α to build recombinant adenovirus plasmid pAd-PoIFN-α transfection HEK-293A cell, and titre is 10 ⁷tCID ₅₀/ mL.RT-PCR proves that goal gene can effective expression in mRNA level; Stronger anti-swine foot-and-mouth disease virus activity on PK-15 cell, can be detected, thereby establish important foundation for studying Schweineseuche immune protection new technology.Thank (2004) such as petrels and cloned pig IFN-α gene, built prokaryotic expression carrier, tentatively it has been carried out to prokaryotic expression research; Chinese scholar Xia Chun etc. (2005) have reported the propagation that can significantly suppress CSFV, PRRSV and VSV with pQE30 expression vector at the rPoIFN-of escherichia coli prokaryotic expression α on pig source cell and non-pig cell lines, proved the feasibility of prokaryotic expression PoIFN-α and using the PoIFN-α of genetically engineered prokaryotic expression really for the production of practice in as anti-virus formulation feasibility.Cao Ruibing etc. transform pig IFN-α 1 gene, in retaining coding protein sequence, use the preference codon of escherichia coli, synthetic pig IFN-α 1 maturation protein encoding gene is inserted in the simple expression vector pRLC of protokaryon, realize the high efficient expression of pig IFN-α 1 in escherichia coli, and Recombinant Swine IFN-α 1 has higher antiviral activity, is about 6.4 × 10 ⁶u/mg.In addition, Ge Li etc. (2005) have cloned pig IFN-α gene, have built carrier for expression of eukaryon, tentatively it have been done to the research of pichia spp secreting, expressing.Liu Zhantong etc. are in vain long to pellet and the genealogy of law is long in vain, English is that great Bai and genealogy of law Large White IFN-α gene are cloned, obtain the pig IFN-α gene of above-mentioned 4 strains, proof nucleotide homology is all more than 97.2%, and amino acid identity is all more than 92.8%.

Aspect porcine beta interferon gene studies, Xia Chun in 2000 etc. carry out molecular cloning and order-checking to pig interferon β gene first, long 668 Nucleotide of cloned sequence, 186 amino acid of encoding.Wherein, 76～636 contain 1 ORF, and molecular weight of albumen is 21.8Ku.In addition, winner phase (2005) and Peng Guiqing (2005) have also carried out molecular cloning and order-checking to the gene of pig interferon β, and detect its biological activity.

Aspect expression, Cao Ruibing (2004) He Wuyang (2006) has carried out prokaryotic expression to the gene of porcine beta interferon respectively, and expression amount is respectively 17.3% and 18%, and expression product is fusion rotein.Wherein Cao Rui soldier processes after porcine kidney cell PK-15 by Recombinant Swine interferon-β, cytopathic-effect inhibition assay (CPE ₅₀) measurement result shows, Recombinant Swine interferon-β can significantly suppress the infection of Porcine epidemic diarrhea virus (Porcine Epidemic Diarrhea Virus, PEDV).Then, in order to develop highly active Recombinant Swine interferon-β, Cao Ruibing (2006) carries out the inclined to one side preferendum of pichia spp to pig interferon β and transforms and built expression plasmid of yeast pPICZ α A-PIB, pPICZ α A-PIB electricity transforms and imports after Pichi strain X-33 through methanol induction fermentation high yield secreting, expressing pig IFN-β, wherein the IFN-β output of B1 strain yeast is the highest, is about 2.5 × 10 ⁵u/mL, its expression amount is about 60 μ g/mL, and specific activity is 4.17 × 10 ⁶u/mg.After fermented supernatant fluid is concentrated with PEG20000, carry out SDS-PAGE and Western-blot detects, result shows that expression product is the mixture that molecular weight is about 28Ku and 25Ku albumen, both all can with the positive antiserum(antisera) generation of pig IFN-β specific reaction.Expression product is larger than the theoretical deduced molecular weight of pig IFN-β (about 20.8Ku), and supposition may be that glycosylation has in various degree occurred expression product.Recombinant Swine IFN-β breeds and can present restraining effect in cell Pseudorabies virus, and pig IFN-β is the most obvious in the inhibition of the upper early stage propagation of bovine kidney cells (MadenDarby Bovine Kidney cells, MDBK) to Pseudorabies virus.

Aspect pig gamma interferon gene studies, although IFN-γ only has a kind of gene, its structure is more complicated, as the gene of encoding human and mouse IFN-γ is about 6Kb, respectively includes 4 exons and 3 introns.IFN-γ and I type Interferon, rabbit (IFN-α and IFN-β) field does not have obvious dependency (DeGrado, et a1,1991) on gene and protein level.Although IFN-γ has the most biologic activity of other Interferon, rabbit, specificity antivirus active aspect than IFN-α and the low 10-100 of IFN-β doubly, and aspect immunoregulatory activity, want doubly (Pace, et al, 1985) of high 100-10000.166 amino-acid residues of the full genes encoding of porcine IFN γ, comprising the signal peptide (Dijkmans, et al, 1990) of 20aa.After signal peptide excision, produce 146 amino acid whose IFN-γ monomers, molecular weight is 17.3ku, and the IFN-γ of natural radioactivity state is through non-covalent homodimer the glycoprotein ((Boehm being cross-linked to form by two IFN-γ monomers, etal, 1997).The IFN-γ of porcine IFN γ and people, mouse, cat and dog has respectively 60%, 41%, 72% and 72% homology, and there is no obvious homology (Farrar and Schreiber, 1993) with IFN-β and IFN-α family.

Carry out research to pig gamma interferon by Roger etc. from gene level early than nineteen ninety abroad, they are take the cDNA of human gamma-interferon as probe, clone pig gamma interferon gene, find has respectively 75% and 59% homology (Dijkmans et al., 1990) with human gamma-interferon in DNA and amino acid whose level.Subsequently, Vandenbroeck etc. have utilized prokaryotic expression pig gamma interferon (Vandenbroeck et al., 1991).

In China, Guo Lian army equals calendar year 2001 and clones first and reported pig gamma interferon gene order (Guo Jiajun etc., 2001).Up to now, Xia Chun, Cao Ruibing (Wu Wenxue etc., 2002; Cao Ruibing etc., 2003; Cao Ruibing etc., 2004) Interferon, rabbit that etc. people expresses with prokaryotic system has good biologic activity.Cao Ruibing etc., from amplify porcine interferon-gamma in the pig peripheral blood white corpuscle of concanavalin A (Concanavalin A, ConA) inducing culture, insert prokaryotic expression carrier pRLC, and have realized the high efficient expression in intestinal bacteria after transformation.Expression product exists with inclusion body form, and through sex change, renaturation, desalination, gel chromatography processing, restructuring porcine IFN γ has higher interferon activity.Zhao Yingjie etc. have successfully built the colon bacillus engineering strain of expressing restructuring porcine IFN γ, Subcellular Localization shows, target protein mainly exists with insoluble inclusion body form after prokaryotic expression, and other a small amount of solubility target proteins are present in cytoplasm.Its prokaryotic expression and analysis to landrace IFN-r Gene, illustrate that the local porcine IFN γ of several China not there are differences and suddenlys change on the Nucleotide of gene and the amino acid levels of albumen, has also confirmed correct, the complete clone of landrace interferon-γ gene simultaneously.In order to study and apply the prevention of pig rIFN-γ and treatment viral blight, Large White IFN-γ gene is inserted into yeast integration plasmid pHIL-S1 by Xia Chun, built restructuring GS115 engineering bacteria.Analyze and anti-vesicular stomatitis virus (VSV) determination of activity through SDS-PAGE, Western-blot, confirm that porcine IFN γ molecular weight is 18Ku, the expression amount in GS115 is 18%, has the activity of anti-VSV.After being Marc-145 with porcine IFN γ processing pig pulmonary macrophage, measure through cytopathic-effect inhibition assay, porcine IFN γ can be resisted PRRS virus (PorcineReproductive and Respiratory Syndrome Virus, PRRSV) and infect.

But above technology all has the defect that the expression amount of protogene codon is low, antiviral activity is low.

Summary of the invention

The object of the invention is the inclined to one side preferendum according to pichia yeast expression system codon, select high expression level codon to carry out genetic modification and transformation to pig α, β and IFN-γ mature peptide nucleotide sequence, and construct expression of recombinant yeast plasmid pPICZ α C-IFN-α, pPICZ α C-IFN-β and pPICZ α C-IFN-γ, its can be in pichia spp to pig α, β with IFN-γ is correct and high efficient expression.Albumen Interferon, rabbit secreted after codon modify has better antiviral activity.

Interferon, rabbit has very high biological activity, and 1mg has 100,000,000 activity units.Gene recombination pig α, interferon-β all belong to interferon type Ⅰ, have broad-spectrum disease resistance cytotoxic activity; Gene recombination pig gamma interferon belongs to interferon type Ⅱ, has good immunoregulation effect.Pass through gene engineering method, according to the inclined to one side preferendum of codon, synthetic pig α, β, tri-kinds of interferon gene nucleotide sequences of γ again, are optimizing on the basis of abduction delivering condition, improve the expression amount of interferon protein in Pichia yeast, produce and lay a good foundation for large scale fermentation.Therefore,, on basis of the present invention, pig α, β, tri-kinds of Interferon, rabbit popularizing application prospects of γ are wide.

The invention provides a kind of gene fragment of the porcine alpha-IFN of encoding, it has the nucleotide sequence as shown in SEQ IDNO.1.For the upstream primer P α of its sequence that increases ₁there is the nucleotide sequence as shown in SEQID NO.2; Downstream primer P α ₂there is the nucleotide sequence as shown in SEQ ID NO.3.Described gene fragment can be used for building the recombinant yeast pichia pastoris that can express porcine alpha-IFN.

The present invention also provides a kind of gene fragment of the porcine beta interferon of encoding, and it has the nucleotide sequence as shown in SEQID NO.4.For the upstream primer P β of its sequence that increases ₁there is the nucleotide sequence as shown in SEQ ID NO.5; Downstream primer P β ₂there is the nucleotide sequence as shown in SEQ ID NO.6.Described gene fragment can be used for building the recombinant yeast pichia pastoris that can express porcine beta interferon.

The present invention also provides a kind of gene fragment of the pig gamma interferon of encoding, and it has the nucleotide sequence as shown in SEQ IDNO.7.For the upstream primer P γ of its sequence that increases ₁there is the nucleotide sequence as shown in SEQID NO.8; Downstream primer P γ ₂there is the nucleotide sequence as shown in SEQ ID NO.9.Described gene fragment can be used for building the recombinant yeast pichia pastoris that can express pig gamma interferon.

While building recombination yeast, the expression vector of employing is pPICZ α C preferably, and recombinant plasmid is pMD-IFN-α, pMD-IFN-β and pMD-IFN-γ preferably.

Compared with the Interferon, rabbit of the expression of traditional method; the present invention is by research; reach expression amount high; cost is lower; tire higher, steady quality, has therefore created prerequisite for product transforms; there is good market potential and the stronger market competitiveness, more easily wide popularization and application in large-scale pig farm.The porcine alpha-IFN of gene recombination has good antivirus action, can use separately the multiple porcine viral diseases for the treatment of; Using the pig gamma interferon of expressing as vaccine adjuvant, from different vaccine associatings, can develop the better new generation vaccine of immune effect, will produce active influence to porcine viral diseases control.Therefore, the present invention has a good application prospect on market.Aspect prevention and treatment porcine viral diseases, there is potential using value.The present invention, by well-designed, has carried out genetic modification and transformation to three kinds of Interferon, rabbit of pig, shows through indicating system, and after codon modify, three kinds of Interferon, rabbit of secreted albumen pig have better antiviral activity.

Accompanying drawing explanation

Fig. 1 is the aminoacid sequence cognation of the PoIFN-α transformation front and back of the embodiment of the present invention;

Fig. 2 is the base sequence cognation of the PoIFN-α transformation front and back of the embodiment of the present invention;

Fig. 3 is the aminoacid sequence cognation of the PoIFN-β transformation front and back of the embodiment of the present invention;

Fig. 4 is the base sequence cognation of the PoIFN-β transformation front and back of the embodiment of the present invention;

Fig. 5 is the aminoacid sequence cognation of the PoIFN-γ transformation front and back of the embodiment of the present invention;

Fig. 6 is the base sequence cognation of the PoIFN-γ transformation front and back of the embodiment of the present invention.

Embodiment

Below in conjunction with drawings and Examples, the specific embodiment of the present invention is described in further detail.Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.

(1) genetic modification

Application DNASTAR(Version 5.0) genetic analysis software, with reference to the porcine interferon alpha gene mature peptide nucleotide sequence (AY331298) publishing on NCBI GenBank, pig interferon β gene mature peptide nucleotide sequence (S41178) and Porcine interferon-gamma gene mature peptide sequence (EU249804), with reference to the Analysis of Codon Usage of the Pichia yeasts such as Zhao Xiang and the Pichia yeast password sublist of TaKaRa company etc., constant according to this sequence amino-acid sequence, the protein of therefore expressing does not change, simultaneously according to the inclined to one side preferendum of pichia yeast expression system codon, select high expression level codon to redesign new sequence, send the composition sequence again by the precious biotechnology company limited in Dalian.

1, the new sequence of porcine alpha-IFN, as shown in SEQ ID NO.1,501bp altogether; 166 amino acid of encoding, as shown in SEQ ID NO.10.

Primer:

Pα ₁（SEQ?ID?NO2）：CG ?GAATTCCTGTGACTTGCCACAAACCCACT

(indicating underscore place is EcoR I restriction enzyme)

Pα ₂（SEQ?ID?NO.3）：GG? GGTACC?TTACTCCTTCTTTCTCAATCTG

(indicating underscore place is Kpn I restriction enzyme)

The theory of upstream and downstream primer is 518bp across width, annealing temperature: 58 ℃

2, the new sequence of porcine beta interferon, as shown in SEQ ID NO.4,498bp altogether; 165 amino acid of encoding, as shown in SEQ ID NO.11.

Pβ ₁（SEQ?ID?NO.5）：CG ?GAATTC?CATGTCCTACGACGTCT

(indicating underscore place is EcoR I restriction enzyme)

Pβ ₂（SEQ?ID?NO.6）：GG? GGTACC?TTAGTTTCTCAAGTAGTCG

(indicating underscore place is Kpn I restriction enzyme)

The theory of upstream and downstream primer is 513bp across width, annealing temperature: 52 ℃

3, the new sequence of pig gamma interferon, as shown in SEQ ID NO.7,432bp altogether; 143 amino acid of encoding, as shown in SEQ ID NO.12.

Pγ ₁（SEQ?ID?NO.8）：CG ?GAATTC?CCAG?GCT?CCA?TTT?TTC?AA

(indicating underscore place is EcoR I restriction enzyme)

Pγ ₂（SEQ?ID?NO.9）：GG GGTACC?TTA?CTT?GGA?GGC?TCT?CTG?AC

(indicating underscore place is Kpn I restriction enzyme)

The theory of upstream and downstream primer is 449bp across width, annealing temperature: 50.7 ℃

(2) structure of recombinant expression plasmid (take pPICZ α C-IFN-α as example, pPICZ α C-IFN-β, pPICZ α C-IFN-γ are identical therewith)

1, the double digestion of recombinant plasmid and expression vector

Recombinant plasmid pMD-IFN-α is carried out to EcoR I and Kpn I double digestion, and double digestion reaction system is as follows:

Mentioned component is added in the Eppendorf pipe of 0.5mL, mix, 37 ℃ of enzymes are cut and are spent the night.-20 ℃ save backup.Expression vector pPICZ α C is carried out to EcoR I and Kpn I double digestion, double digestion reaction system is the same simultaneously.

2, enzyme is cut recovery and the purifying of product

With reference to the DNA gel of OMEGA company reclaim test kit ( gelExtraction Kit I) working instructions carry out.Concrete steps are as follows:

100 μ L enzymes are cut to electrophoresis in the sepharose of the low melting point of product in 1.0%.After electrophoresis finishes, under ultraviolet lamp, rapidly object fragment is cut from sepharose with clean blade, be placed in the Eppendorf pipe of a new 1.5mL.Add etc. doubly to the Binding of gel volume Buffer, at 55～65 ℃ of about 7min of water-bath incubation, mix once every 1～2min, until sepharose dissolves completely.Liquid is moved to yellow HiBind ^tMin DNAMinicolumn pipe, the 2mL Collection Tubes that traps, the centrifugal 1min of 12,000r/min, discards the waste liquid in Collection Tubes.Toward HiBind ^tMin DNA Minicolumn pipe, add 300 μ L Binding Buffer, the centrifugal 1min of 12,000r/min, discards the waste liquid in Collection Tubes.Toward HiBind ^tMin DNA Minicolumn pipe, add the DNA Wash Buffer of 700 μ L, leave standstill 2～3min, 12,000r/min is centrifugal, and 1min washes post, abandons filtrate.Repeating step (5) once, the centrifugal 1min of blank pipe.By HiBind ^tMdNAMinicolumn pipe moves in new 1.5mLEppendorf pipe.Add the ElutionBuffer of 30 μ L, the centrifugal 1min of 12,000r/min, centrifugal gained solution is in-20 ℃ of preservations.

3, being connected of goal gene fragment and vector plasmid

Above-mentioned each component is added in 0.5mLEppendorf pipe, and centrifugal mixing, puts 16 ℃ of connections of spending the night in incubator.

4, connect the conversion of product

The connection product 10 μ L that get are above added in the competent cell suspension of 50 μ L bacillus coli DH 5 alphas, blow gently even, ice bath 30min, the competent cell suspension of separately getting 50 μ L does not add plasmid and makes blank.42 ℃ of heat stress 90s, rapidly ice bath 5min.Add 1mL LB Z ^-nutrient solution, on 37 ℃ of shaking tables, 120～130r/min cultivates 45min.The centrifugal 5min of 5,000r/min, supernatant discarded 800 μ L, remaining resuspended bacterium mud is also coated LB Zeocin ⁺on substratum plate, put in 37 ℃ of incubators and place about 30min to surface liquid absorption completely, be inverted and cultivate 16～18h.Control group is set: A group is Zeocin ^-control group, does not contain Zeocin in substratum ^tM, inoculation DH5 α, observes bacterial growth situation; B group is Zeocin ⁺control group, contains Zeocin in substratum ^tM(25 μ g/mL), inoculation DH5 α, observes bacterium to Zeocin ^tMdrug susceptibility.

5, the PCR of recombinant expression plasmid identifies

To the suspicious bacterium colony growing on LB Zeocin+ substratum plate, be inoculated in 2mL containing ZeocinTM(25 μ g/mL) in less salt LB liquid nutrient medium, 37 ℃ of 250r/min jolting overnight incubation, extracting plasmid from bacterium liquid.Take recombinant plasmid dna as template, add the Auele Specific Primer of object fragment to carry out PCR evaluation.Take recombinant plasmid dna as template, in the Eppendorf of 0.5mL pipe, add successively following composition:

Instantaneous centrifugal the mixing of above-mentioned mixed solution, positive plasmid called after pPICZ α C-IFN-α.

6, the single endonuclease digestion of recombinant plasmid pPICZ alpha C-IFN-α is identified

By restriction enzyme Sac I, the recombinant plasmid through PCR test positive is carried out to single endonuclease digestion evaluation, reaction system is as follows:

Endonuclease reaction system is placed in after 37 ℃ of waters bath with thermostatic control spend the night, in 0.8% sepharose mesolow electrophoresis detection result.

7, the double digestion of recombinant plasmid pPICZ alpha C-IFN-α is identified

By restriction enzyme EcoR I and Kpn I, the recombinant expression plasmid through PCR test positive is carried out to double digestion evaluation, reaction system is as follows:

Above-mentioned each component is added in the EP pipe of 0.5mL, mix, place 37 ℃ of enzymes in water-bath and cut 4h, detect through 0.8% agarose gel electrophoresis.

8, the sequencing of recombinant expression plasmid pPICZ α C-IFN-α goal gene

(3) carry the structure of the recombination yeast of goal gene

1, the preparation of pichia pastoris X-33 competent cell

Carry out according to Invitrogen company laboratory manual, be inoculated in the YPD nutrient solution of 5mL with aseptic toothpick picking list bacterium colony PichiaPastoris X-33,28～30 ℃ of shaking culture are spent the night.Get part overnight culture (in 0.1% ratio) and be re-seeded in the YPD nutrient solution of 50mL, 28～30 ℃ of shaking culture are until bacterium liquid OD ₆₀₀=1.2～1.5.4 ℃, the centrifugal 5min of 8,500r/min collects thalline, with the resuspended thalline of aqua sterilisa of 50mL precooling.Same centrifugal collection thalline, with the resuspended thalline of aqua sterilisa of 25mL precooling.The resuspended thalline of sorbyl alcohol of the centrifugal rear 1mol/L with 2mL precooling, 4 ℃, the centrifugal 5min of 8,500r/min collects thalline.The resuspended thalline of sorbyl alcohol of finally using the 1mol/L of 50～80 μ L precoolings, obtains competence yeast cell, for transforming when atmospheric electricity, and not freeze-stored cell.

2, the linearizing of recombinant plasmid pPICZ alpha C-IFN-α and recovery

Carry out according to Invitrogen company laboratory manual, with Sac I single endonuclease digestion pPICZ α C-IFN-α, make it linearizing, endonuclease reaction system is as follows:

Empty carrier pPICZ α C is also carried out to linearizing, system is the same simultaneously.

Above-mentioned each component is added in Eppendorf pipe, mix, place 37 ℃ of enzymes in water-bath and cut 8h.After electrophoresis detection linearizing completely, carry out the recovery purifying of goal gene.

3, the electric shock of recombinant plasmid pPICZ alpha C-IFN-α transforms

Competence yeast cell and the linearizing recombinant plasmid of 20 μ L of getting the fresh preparation of 80 μ L mix gently.Proceed to the middle ice bath 5min of electric revolving cup (Eppendorf company, 100 μ L) of precooling.Setting electric Transformation Parameters is 1500V.Electricity adds the sorbyl alcohol of the 1mol/L of 1mL precooling immediately after transforming, after mixing gently, conversion product is moved into the culture tube of 5mL.30 ℃ leave standstill cultivation 1.0h, then add 1mL YPD liquid, and 30 ℃, 200r/min shaking culture 1.0h.Centrifugal collection thalline, and the YPDS flat board that be laid on fresh preparation resuspended with 50～200 μ L YPD is (containing 100 μ g/mL Zeocin ^tM) upper, flat board is inverted, in 30 ℃ of incubators, cultivate 3～5d.

4, recombination microzyme bacterium liquid PCR identifies

With the Zeocin that has growing on the tall and slender YPDS flat board of sterilizing toothpick ^tMsingle bacterium colony of resistance, is inoculated in the YPDS liquid nutrient medium of 1mL (containing 200 μ g/mL Zeocin ^tM), 30 ℃, 200r/min shaking culture is spent the night.

The recombination yeast that pPICZ α C-IFN-α is transformed, recombination yeast and the unconverted yeast X-33 that pPICZ α C transforms cultivate after 16～20h on YPD liquid nutrient medium, ice bath 5min, supernatant discarded after the centrifugal 5min of 5,000r/min; Bacterium mud is resuspended with broken bacterium damping fluid, after same centrifugal supernatant discarded, adds the resuspended bacterium mud of 200 μ L yeast lysate, and adds isopyknic 0.5mm pickling glass pearl and the saturated phenol of isopyknic Tris, and 3min vibrates on wortex device; After the centrifugal 10min of 12,000r/min, get supernatant, add isopyknic Virahol in supernatant, 4 ℃ act at least 10min, precipitation DNA; The centrifugal supernatant of abandoning of 12,000r/min, dries after 75% ethanol and absolute ethanol washing, adds 40 μ L distilled waters (containing RNase) to dissolve for subsequent use.

This method is also used in this experiment of rapid extraction of recombination yeast DNA: the high copy of the restructuring bacterial strain that screening is obtained, get a small amount of bacterium in single bacterium colony and put into Eppendorf pipe, add the aqua sterilisa of 100 μ L, 100 ℃ are boiled 10min, clear up yeast cell wall, then put into liquid nitrogen and freeze 30min, 100 ℃ are boiled 10min, 12,000r/min centrifuging and taking supernatant liquor, make template with a small amount of genomic dna wherein, carry out PCR evaluation.

PoIFN-alpha reaction program: 94 ℃ of denaturation 4min, and then start following circulation: 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s, move 30 circulations, and last 72 ℃ are extended 10min.After PCR finishes, respectively get 5 μ LPCR products, 0.8% agarose gel electrophoresis, observations in ultraviolet transilluminator.

(4) the preliminary abduction delivering of high resistance integron

With the Zeocin that has growing on the tall and slender YPDS flat board of sterilizing toothpick ^tMsingle bacterium colony of resistance, chooses in the YPDS of 1mL liquid nutrient medium (containing 200 μ g/mLZeocin ^tM), 30 ℃, 200r/min shaking culture is spent the night.

With the Zeocin that has growing on the tall and slender YPDS flat board of sterilizing toothpick ^tMsingle bacterium colony of resistance, chooses in the BMGY of 20mL liquid nutrient medium and activates cultivation, and 30 ℃, 200r/min shaken overnight, to OD ₆₀₀=2～6, now cell is in logarithmic phase.The centrifugal 5min collecting precipitation of 1500～3000r/min room temperature, is resuspended in the BMMY of 1mL, continues shaking culture, by four layers of additional two-layer newspaper wrapping of clean gauze, shaking culture in the test tube of 15mL.Adding 100% methyl alcohol to final concentration at interval of 24h is 1%, carries out inducing culture.Be cultured to 96h and collect sample, centrifugal, get supernatant and do immediately SDS-PAGE analysis or be placed in-70 ℃ of preservations.

(5) check of expression product

1, the SDS-PAGE of expression product analyzes

Be cultured to 96h and collect sample, centrifugal, get supernatant and do immediately SDS-PAGE analysis.

2, the Western-blot of expression product analyzes (on interferon-β market without commercial monoclonal antibody)

Get supernatant and carry out Western-blot analysis, respectively take the anti-pig α of mouse, IFN-γ monoclonal antibody as primary antibodie, goat anti-mouse-IgG-HRP is two anti-, the expressing protein of transferring on nitrocellulose membrane is processed to DAB colour developing.

(6) detection of pig α, β and IFN-γ protein content

Abduction delivering product supernatant is carried out to SDS-PAGE protein electrophoresis, then carry out dyeing-decolorzing, be placed in thin layer chromatography scanner and carry out gray scale scanning, analyze by Labwork software system, utilize bovine serum albumin to do quantitative contrast, carry out the effective content of pig interferon in calculation sample total protein content and total protein thereof, the measurement result of the gray scale scanning relative value of different samples.

Result is as follows:

PoIFN-α swimming lane total protein total protein concentration is 77.654mg/L

The effective protein concentration of PoIFN-α is 54.105mg/L

In sample, the effective content of pig IFN-α accounts for the per-cent of sample total protein content

PoIFN-α：54.105／77.654×100%≈69.67%

PoIFN-β swimming lane total protein concentration is 84.75mg/L

The effective protein concentration of PoIFN-β is 66.98mg/L

In sample, the effective content of pig IFN-β accounts for the per-cent of sample total protein content:

PoIFN-β：66.98／84.75×100%≈79.03%

PoIFN-γ swimming lane total protein concentration is 100.44mg/L

The effective protein concentration of PoIFN-γ is 79.976mg/L

In sample, the effective content of porcine IFN γ accounts for the per-cent of sample total protein content:

PoIFN-γ：79.976／100.44×100%≈79.63%

The mensuration 10 of VSV titre ^5.5tCID ₅₀/ mL

The porcine alpha-IFN of expressing is tired: be 1.817x10 without transformation ⁶u/L is 5.87 × 10 through tiring of transformation ⁷u/L.

The porcine beta interferon of expressing is tired: be 3.52x10 without transformation ⁶u/L is 1.02 × 10 through tiring of transformation ⁸u/L

The pig gamma interferon of expressing is tired: be 1.01x10 without transformation ⁶u/L is 1.60 × 10 through tiring of transformation ⁷u/L.

(7) whole serial correlation

The aminoacid sequence of expressing before and after PoIFN-α transformation does not change, and the just base of Nucleotide of variation puts in order (codon modify), from Fig. 1 and Fig. 2, before and after transformation, the albumen of expressing does not change, and base sequence similarity only has 78.6%, changes and has 25.8%.

The aminoacid sequence of expressing before and after PoIFN-β transformation does not change, and the just base of Nucleotide of variation puts in order (codon modify), from Fig. 3 and Fig. 4, before and after transformation, the albumen of expressing does not change, and base sequence similarity only has 78.5%, changes and has 25.8%.

The aminoacid sequence of expressing before and after PoIFN-γ transformation does not change, and the just base of Nucleotide of variation puts in order (codon modify), from Fig. 5 and Fig. 6, before and after transformation, the albumen of expressing does not change, and base sequence similarity only has 75.5%, changes and has 30.7%.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, do not departing under the prerequisite of the technology of the present invention principle; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Claims (2)

1. the encode gene fragment of porcine beta interferon, is characterized in that, its nucleotide sequence is as shown in SEQ ID NO.4; For the upstream primer P β of this sequence that increases ₁the nucleotide sequence of nucleotide sequence as shown in SEQ ID NO.5; Downstream primer P β ₂the nucleotide sequence of nucleotide sequence as shown in SEQ ID NO.6; The annealing temperature of PCR method for this sequence that increases is 52 ℃.

2. gene fragment claimed in claim 1 is in the application building in the recombinant yeast pichia pastoris that can express porcine beta interferon.

Images