CN102978213A - Gene segment for coding swine beta interferon and application thereof - Google Patents

Abstract

The invention discloses a new nucleotide sequence of a mature peptide of a swine beta interferon, wherein the new nucleotide sequence is designed and synthesized by selecting a high-expression codon according to the codon bias of a pichia pastoris expression system. A recombinant yeast expression plasmid pPICZalphaC-IFN-beta is constructed successfully, not only is the swine beta interferon expressed accurately in the pichia pastoris, but also the swine beta interferon is easier to express in the pichia pastoris and is higher in expression quantity, and a foundation is laid for large-scale production and fermentation in genetic engineering.

Description

Gene fragment and the application thereof of coding porcine beta interferon

The application is to be on March 26th, 2010 applying date, and application number is: 201010139485.4, and denomination of invention is divided an application for the patent application of gene fragment and the application thereof of porcine alpha-IFN " coding ".

Technical field

Gene fragment and the application thereof of porcine beta interferon the present invention relates to encode.

Background technology

The pig virus transmissible disease is spread unchecked day by day in recent years, is seriously threatening the sustainable development of China's livestock industry.The fast rapid change of immunosuppressive disease and virus antigen is different, often causes the vaccine immunity failure; New virus disease constantly appears in addition, at present also still manque vaccine inoculation prevention.On the other hand, vaccine only has prophylactic effect to disease, and treatment also depends on antibiotic use.And the appearance of some drug-fast strains brings great threat for human food prods and health, and some countries have prohibited and use some microbiotic and antiseptic-germicide in breeding production.Therefore, in the production in the urgent need to a kind of not only effectively but also environmentally friendly novel method come the prevention and control livestock and poultry.Facts have proved that Interferon, rabbit is having broad application prospects aspect the prevention and control of viral infectious as a kind of antiviral agent of wide spectrum.

Traditional production method: induce the generation Interferon, rabbit by inducers such as herbal medicine, the many factors such as complicated because of purifying process, output is few, effect mitigation and greatly limited application in clinical and scientific research.

Along with clone's success of porcine alpha-interferon gene, to clinical application and the also thereupon expansion of Research on the effect mechanism of its recombinant products.Nineteen ninety, the people such as Lefevre and LaBonnar at expression in escherichia coli PoIFN-α l gene, obtain one and contained 189 amino acid whose precursor proteins, remove its N end contain 23 amino acid whose signal peptides after, obtained having the product of complete natural PoIFN-α l biologic activity, and its antiviral activity on the sexual cell of pig source is 6 times that virus stimulates Interferon, rabbit that pig leucocyte produces at least.The research such as Pol JM (1991) is found: rPoIFN-α 1 can suppress the strong poison of Pseudorabies virus (PRV) and mesogenic virus in the propagation of hog snout chamber mucous membrane tissue stroma cellular layer, pig inoblast and porcine kidney cell that PRV inoculation Interferon, rabbit is processed, virus titer obviously descends.Horisberger MA(1992) restructuring PoIFN-α (rPoIFN-α) and restructuring PoIFN-γ (rPoIFN-γ) difference of antiviral activity in the cell of pig have been compared, find that rPoIFN-α can reduce the pathology that pig vesicular stomatitis virus (VSV) causes at pig PK-15 greatly, and can weaken pig vesicular stomatitis virus (VSV) and influenza virus copying in porcine kidney cell, but rPoIFN-α and rPoIFN-γ have antivirus action to encephalomyocardis virus (a kind of encephalomyocarditis virus).(1994) such as Jordan LT find that rPoIFN-α has good prophylactic effect to Transmissible gastroenteritis virus (TGEV).The propagation of PRV is suppressed behind the research such as Tonomura N (1996) discovery HuIFN-α processing Vero, the mRNA of the immediate early gene of PRV reduces in the Vero that Interferon, rabbit is processed, and the transient expression test shows that transcribing by selectivity of PRV IE promotor suppress.BuddaertW(1998) to rPoIFN-α in vivo, outer the pig breeding antiviral activity with disordered breathing syndrome virus (PRRSV) is studied, find PRRSV in vivo, outer all very sensitive to rPoIFN-α, rPoIFN-α can obviously suppress the output of PRRSV and the quantity of cells infected.(2001) human escherichia coli expression rPoIFN-α such as chinsangaram J. or rPolFN-β have also carried out respectively foot-and-mouth disease virus resistant (FMDV) experiment, find that rPoIFN-α and rPoIFN-β suppress FMDV and copy on the protein translation level, mainly be the result who activates double-stranded RNA-dependent protein kinase (PKR) effect: add PKR inhibitor 2-aminopurine in cell after, the output of virus will rise; And the cell of RNase L and PKR genetically deficient still can infect FMDV under the effect of Interferon, rabbit, and this has proved absolutely that PKR works in suppressing virus replication.

Chinese scholar has also been carried out multinomial research to porcine alpha-IFN.Cao Ruibing etc. (2004) have cloned a kind of new pig IFN-α gene and carried out the simple expression of its maturation protein in intestinal bacteria, and expression product has higher antiviral activity.Du Yijun etc. utilize the mature protein gene of pig IFN-α to make up recombinant adenovirus plasmid pAd-PoIFN-α transfection HEK-293A cell, and titre is 10 ⁷TCID ₅₀/ mL.But RT-PCR proof goal gene effective expression on the mRNA level; It is active to detect stronger anti-swine foot-and-mouth disease virus on the PK-15 cell, thereby has established important foundation for studying Schweineseuche immune protection new technology.Thank (2004) such as petrels and cloned pig IFN-α gene, made up prokaryotic expression carrier, tentatively it has been carried out prokaryotic expression research; Chinese scholar Xia Chun etc. (2005) have reported with the pQE30 expression vector can significantly suppress the propagation of CSFV, PRRSV and VSV at the rPoIFN-of escherichia coli prokaryotic expression α on pig source cell and non-pig cell lines, proved prokaryotic expression PoIFN-α feasibility and with the PoIFN-α of genetically engineered prokaryotic expression really for the production of in the practice as the anti-virus formulation feasibility.Cao Ruibing etc. transform pig IFN-α 1 gene, when keeping coding protein sequence, used the preference codon of escherichia coli, synthetic pig IFN-α 1 maturation protein encoding gene is inserted among the simple expression vector pRLC of protokaryon, realized pig IFN-α 1 efficiently expressing in escherichia coli, and Recombinant Swine IFN-α 1 has higher antiviral activity, is about 6.4 * 10 ⁶U/mg.In addition, Ge Li etc. (2005) have cloned pig IFN-α gene, have made up carrier for expression of eukaryon, tentatively it have been done the research of pichia spp secreting, expressing.Liu Zhantong etc. are in vain long to pellet and the genealogy of law is long in vain, English is that Da Bai and genealogy of law Large White IFN-α gene are cloned, obtained the pig IFN-α gene of above-mentioned 4 strains, the proof nucleotide homology is all more than 97.2%, and amino acid identity is all more than 92.8%.

Aspect the porcine beta interferon gene studies, Xia Chun in 2000 etc. carry out molecular cloning and order-checking to pig interferon β gene first, long 668 Nucleotide of cloned sequence, 186 amino acid of encoding.Wherein, 76～636 contain 1 ORF, and molecular weight of albumen is 21.8Ku.In addition, winner phase (2005) and Peng Guiqing (2005) have also carried out molecular cloning and order-checking to the gene of pig interferon β, and detect its biological activity.

Aspect expression, Cao Ruibing (2004) He Wuyang (2006) has carried out prokaryotic expression to the gene of porcine beta interferon respectively, and expression amount is respectively 17.3% and 18%, and expression product is fusion rotein.After wherein Cao Rui soldier processes porcine kidney cell PK-15 with the Recombinant Swine interferon-β, cytopathic-effect inhibition assay (CPE ₅₀) measurement result shows that the Recombinant Swine interferon-β can significantly suppress the infection of Porcine epidemic diarrhea virus (Porcine Epidemic Diarrhea Virus, PEDV).Then, in order to develop highly active Recombinant Swine interferon-β, Cao Ruibing (2006) carries out the inclined to one side preferendum transformation of pichia spp and has made up expression plasmid of yeast pPICZ α A-PIB pig interferon β, pPICZ α A-PIB electricity transforms and imports Pichi strain X-33 by methanol induction fermentation high yield secreting, expressing pig IFN-β, wherein the IFN-β output of B1 strain yeast is the highest, is about 2.5 * 10 ⁵U/mL, its expression amount are about 60 μ g/mL, and specific activity is 4.17 * 10 ⁶U/mg.Carry out SDS-PAGE after fermented supernatant fluid is concentrated with PEG20000 and Western-blot detects, the result shows that expression product is the mixture that molecular weight is about 28Ku and 25Ku albumen, both all can with the positive antiserum(antisera) generation of pig IFN-β specific reaction.Expression product is larger than the theoretical deduced molecular weight of pig IFN-β (about 20.8Ku), and supposition may be that glycosylation has in various degree occured expression product.Recombinant Swine IFN-β breeds in cell Pseudorabies virus can present restraining effect, and pig IFN-β is the most obvious in the inhibition of the upper early stage propagation of bovine kidney cells (MadenDarby Bovine Kidney cells, MDBK) to Pseudorabies virus.

Aspect the pig gamma interferon gene studies, although IFN-γ only has a kind of gene, its structure is more complicated, is about 6Kb such as the gene of encoding human and mouse IFN-γ, respectively includes 4 exons and 3 introns.IFN-γ and I type Interferon, rabbit (IFN-α and IFN-β) field does not have obvious dependency (DeGrado, et a1,1991) at gene and protein level.Although IFN-γ has the most biologic activity of other Interferon, rabbit, lower 10-100 times than IFN-α and IFN-β aspect the specificity antivirus activity, and aspect immunoregulatory activity, want high 100-10000 doubly (Pace, et al, 1985).166 amino-acid residues of the full genes encoding of porcine IFN γ are comprising the signal peptide (Dijkmans, et al, 1990) of 20aa.After the signal peptide excision, produce 146 amino acid whose IFN-γ monomers, molecular weight is 17.3ku, and the IFN-γ of natural radioactivity state is through the non-covalent homodimer glycoprotein that is cross-linked to form ((Boehm, etal, 1997) by two IFN-γ monomers.The IFN-γ of porcine IFN γ and people, mouse, cat and dog has respectively 60%, 41%, 72% and 72% homology, and does not have obvious homology (Farrar and Schreiber, 1993) with IFN-β and IFN-α family.

External carried out research to pig gamma interferon by Roger etc. from gene level early than nineteen ninety, they are take the cDNA of human gamma-interferon as probe, cloned the pig gamma interferon gene, finding has respectively 75% and 59% homology (Dijkmans et al., 1990) with human gamma-interferon on DNA and amino acid whose level.Subsequently, Vandenbroeck etc. have utilized prokaryotic expression pig gamma interferon (Vandenbroeck et al., 1991).

In China, Guo's sickle army equals calendar year 2001 and clones first and reported pig gamma interferon gene order (Guo Jiajun etc., 2001).Up to now, Xia Chun, Cao Ruibing (Wu Wenxue etc., 2002; Cao Ruibing etc., 2003; Cao Ruibing etc., 2004) etc. people's Interferon, rabbit of expressing with prokaryotic system has preferably biologic activity.Cao Ruibing etc. insert prokaryotic expression carrier pRLC, and have realized efficiently expressing in intestinal bacteria from amplify porcine interferon-gamma in the pig peripheral blood white corpuscle of concanavalin A (Concanavalin A, ConA) inducing culture after transforming.Expression product exists with the inclusion body form, processes through sex change, renaturation, desalination, gel chromatography, and the restructuring porcine IFN γ has higher interferon activity.Zhao Yingjie etc. have successfully made up the colon bacillus engineering strain of expressing the restructuring porcine IFN γ, Subcellular Localization shows, target protein mainly exists with insoluble inclusion body form behind prokaryotic expression, and other a small amount of solubility target proteins are present in the cytoplasm.It is to prokaryotic expression and the analysis of landrace IFN-r Gene, illustrate that the local porcine IFN γ of several China not there are differences and suddenlys change, and has also confirmed correct, the complete clone of landrace interferon-γ gene simultaneously on the amino acid levels of the Nucleotide of gene and albumen.In order to study and use the prevention of pig rIFN-γ and treatment viral blight, Xia Chun is inserted into yeast integration plasmid pHIL-S1 with Large White IFN-γ gene, has made up restructuring GS115 engineering bacteria.Analyze and anti-vesicular stomatitis virus (VSV) determination of activity through SDS-PAGE, Western-blot, confirm that the porcine IFN γ molecular weight is 18Ku, the expression amount in GS115 is 18%, has the activity of anti-VSV.After processing the pig pulmonary macrophage and be Marc-145 with porcine IFN γ, measure through cytopathic-effect inhibition assay, porcine IFN γ can be resisted PRRS virus (PorcineReproductive and Respiratory Syndrome Virus, PRRSV) and infect.

But above technology all has the defective that the expression amount of protogene codon is low, antiviral activity is low.

Summary of the invention

The objective of the invention is the inclined to one side preferendum according to the pichia yeast expression system codon, select the high expression level codon that pig α, β and IFN-γ mature peptide nucleotide sequence are carried out genetic modification and transformation, and constructing expression of recombinant yeast plasmid pPICZ α C-IFN-α, pPICZ α C-IFN-β and pPICZ α C-IFN-γ, it is can be in pichia spp correct and efficiently express to pig α, β and IFN-γ.Albumen Interferon, rabbit secreted behind the codon modify has better antiviral activity.

Interferon, rabbit has very high biological activity, and 1mg namely has 100,000,000 activity units.Gene recombination pig α, interferon-β all belong to interferon type Ⅰ, have the broad-spectrum disease resistance cytotoxic activity; The gene recombination pig gamma interferon belongs to interferon type Ⅱ, has good immunoregulation effect.Pass through gene engineering method, according to the inclined to one side preferendum of codon, again synthesize pig α, β, three kinds of interferon gene nucleotide sequences of γ, on the basis of optimizing the abduction delivering condition, improve the expression amount of interferon protein in Pichia yeast, for large scale fermentation production is laid a good foundation.Therefore, on basis of the present invention, pig α, β, three kinds of Interferon, rabbit popularizing application prospects of γ are wide.

The invention provides a kind of gene fragment of the porcine alpha-IFN of encoding, it has the nucleotide sequence shown in SEQ IDNO.1.The upstream primer P α that is used for its sequence of amplification ₁Has the nucleotide sequence shown in SEQID NO.2; Downstream primer P α ₂Has the nucleotide sequence shown in SEQ ID NO.3.Described gene fragment can be used for making up the recombinant yeast pichia pastoris that can express porcine alpha-IFN.

The present invention also provides a kind of gene fragment of the porcine beta interferon of encoding, and it has the nucleotide sequence shown in SEQID NO.4.The upstream primer P β that is used for its sequence of amplification ₁Has the nucleotide sequence shown in SEQ ID NO.5; Downstream primer P β ₂Has the nucleotide sequence shown in SEQ ID NO.6.Described gene fragment can be used for making up the recombinant yeast pichia pastoris that can express porcine beta interferon.

The present invention also provides a kind of gene fragment of the pig gamma interferon of encoding, and it has the nucleotide sequence shown in SEQ IDNO.7.The upstream primer P γ that is used for its sequence of amplification ₁Has the nucleotide sequence shown in SEQID NO.8; Downstream primer P γ ₂Has the nucleotide sequence shown in SEQ ID NO.9.Described gene fragment can be used for making up the recombinant yeast pichia pastoris that can express pig gamma interferon.

When making up recombination yeast, the expression vector of employing is pPICZ α C preferably, and recombinant plasmid is pMD-IFN-α, pMD-IFN-β and pMD-IFN-γ preferably.

Compare with the Interferon, rabbit of the expression of traditional method; the present invention is by research; it is high to have reached expression amount; cost is lower; it is higher to tire, and therefore steady quality has created prerequisite for product transforms; have good market potential and the stronger market competitiveness, easier in large-scale pig farm wide popularization and application.The porcine alpha-IFN of gene recombination has good antivirus action, can use separately the multiple porcine viral diseases for the treatment of; The pig gamma interferon of expressing as vaccine adjuvant, from different vaccine associatings, can be developed the better new generation vaccine of immune effect, will produce active influence to the porcine viral diseases control.Therefore, the present invention has a good application prospect in market.Has potential using value aspect prevention and the treatment porcine viral diseases.The present invention has carried out genetic modification and transformation by well-designed to three kinds of Interferon, rabbit of pig, shows that through indicating system three kinds of Interferon, rabbit of secreted albumen pig have better antiviral activity behind the codon modify.

Description of drawings

Fig. 1 is the aminoacid sequence cognation before and after the PoIFN-α of the embodiment of the invention transforms;

Fig. 2 is the base sequence cognation before and after the PoIFN-α of the embodiment of the invention transforms;

Fig. 3 is the aminoacid sequence cognation before and after the PoIFN-β of the embodiment of the invention transforms;

Fig. 4 is the base sequence cognation before and after the PoIFN-β of the embodiment of the invention transforms;

Fig. 5 is the aminoacid sequence cognation before and after the PoIFN-γ of the embodiment of the invention transforms;

Fig. 6 is the base sequence cognation before and after the PoIFN-γ of the embodiment of the invention transforms.

Embodiment

Below in conjunction with drawings and Examples, the specific embodiment of the present invention is described in further detail.Following examples are used for explanation the present invention, but are not used for limiting the scope of the invention.

(1) genetic modification

Use DNASTAR(Version 5.0) genetic analysis software, with reference to the porcine interferon alpha gene mature peptide nucleotide sequence (AY331298) that publishes on the NCBI GenBank, pig interferon β gene mature peptide nucleotide sequence (S41178) and Porcine interferon-gamma gene mature peptide sequence (EU249804), with reference to the Analysis of Codon Usage of the Pichia yeasts such as Zhao Xiang and the Pichia yeast password sublist of TaKaRa company etc., constant according to this sequence amino-acid sequence, the protein of therefore expressing does not change, while is according to the inclined to one side preferendum of pichia yeast expression system codon, select the high expression level codon to redesign new sequence, send by the precious biotechnology in Dalian company limited again composition sequence.

1, the new sequence of porcine alpha-IFN shown in SEQ ID NO.1, is total to 501bp; 166 amino acid of encoding are shown in SEQ ID NO.10.

Primer:

Pα ₁（SEQ?ID?NO2）：CG ?GAATTCCTGTGACTTGCCACAAACCCACT

(indicating the underscore place is EcoR I restriction enzyme)

Pα ₂（SEQ?ID?NO.3）：GG? GGTACC?TTACTCCTTCTTTCTCAATCTG

(indicating the underscore place is Kpn I restriction enzyme)

It is 518bp that the theory of upstream and downstream primer is striden the width of cloth, annealing temperature: 58 ℃

2, the new sequence of porcine beta interferon shown in SEQ ID NO.4, is total to 498bp; 165 amino acid of encoding are shown in SEQ ID NO.11.

Pβ ₁（SEQ?ID?NO.5）：CG ?GAATTC?CATGTCCTACGACGTCT

(indicating the underscore place is EcoR I restriction enzyme)

Pβ ₂（SEQ?ID?NO.6）：GG? GGTACC?TTAGTTTCTCAAGTAGTCG

(indicating the underscore place is Kpn I restriction enzyme)

It is 513bp that the theory of upstream and downstream primer is striden the width of cloth, annealing temperature: 52 ℃

3, the new sequence of pig gamma interferon shown in SEQ ID NO.7, is total to 432bp; 143 amino acid of encoding are shown in SEQ ID NO.12.

Pγ ₁（SEQ?ID?NO.8）：CG ?GAATTC?CCAG?GCT?CCA?TTT?TTC?AA

(indicating the underscore place is EcoR I restriction enzyme)

Pγ ₂（SEQ?ID?NO.9）：GG GGTACC?TTA?CTT?GGA?GGC?TCT?CTG?AC

(indicating the underscore place is Kpn I restriction enzyme)

It is 449bp that the theory of upstream and downstream primer is striden the width of cloth, annealing temperature: 50.7 ℃

(2) structure of recombinant expression plasmid (take pPICZ α C-IFN-α as example, pPICZ α C-IFN-β, pPICZ α C-IFN-γ are identical therewith)

1, the double digestion of recombinant plasmid and expression vector

Recombinant plasmid pMD-IFN-α is carried out EcoR I and Kpn I double digestion, and the double digestion reaction system is as follows:

Mentioned component is added in the Eppendorf pipe of 0.5mL, mixing, 37 ℃ of enzymes are cut and are spent the night.-20 ℃ save backup.Simultaneously expression vector pPICZ α C is carried out EcoR I and Kpn I double digestion, the double digestion reaction system is the same.

2, enzyme is cut recovery and the purifying of product

With reference to the dna gel of OMEGA company reclaim test kit (

GelExtraction Kit I) working instructions carry out.Concrete steps are as follows:

100 μ L enzymes are cut product electrophoresis in low-melting sepharose of 1.0%.Electrophoresis downcuts the purpose fragment rapidly with clean blade under ultraviolet lamp after finishing from sepharose, place the Eppendorf pipe of a new 1.5mL.Add and wait doubly to the Binding of gel volume Buffer, at 55～65 ℃ of about 7min of water-bath incubation, mix once every 1～2min, until sepharose dissolves fully.Liquid is moved to yellow HiBind ^TMIn the DNAMinicolumn pipe, the 2mL Collection Tubes that traps, the centrifugal 1min of 12,000r/min discards the waste liquid among the Collection Tubes.Toward HiBind ^TMAdd 300 μ L Binding Buffer in the DNA Minicolumn pipe, the centrifugal 1min of 12,000r/min discards the waste liquid among the Collection Tubes.Toward HiBind ^TMAdd the DNA Wash Buffer of 700 μ L in the DNA Minicolumn pipe, leave standstill 2～3min, 12,000r/min is centrifugal, and 1min washes post, abandons filtrate.Repeating step (5) once, the centrifugal 1min of blank pipe.With HiBind ^TMThe DNAMinicolumn pipe moves in the new 1.5mLEppendorf pipe.The ElutionBuffer that adds 30 μ L, the centrifugal 1min of 12,000r/min, centrifugal gained solution is in-20 ℃ of preservations.

3, goal gene fragment and vector plasmid is connected

Above-mentioned each component is added in the 0.5mLEppendorf pipe, and centrifugal mixing is put 16 ℃ of connections of spending the night in the incubator.

4, connect the conversion of product

Get top connection product 10 μ L and be added in the competent cell suspension of 50 μ L bacillus coli DH 5 alphas, blow gently even, ice bath 30min, the competent cell suspension that other gets 50 μ L does not add plasmid and makes blank.42 ℃ of heat stress 90s, rapidly ice bath 5min.Add 1mL LB Z ^-Nutrient solution, 120～130r/min cultivates 45min on 37 ℃ of shaking tables.The centrifugal 5min of 5,000r/min, supernatant discarded 800 μ L, remaining resuspended bacterium mud is also coated LB Zeocin ⁺On the substratum plate, put and place about 30min in 37 ℃ of incubators to surface liquid absorption fully, be inverted and cultivate 16～18h.Control group is set: the A group is Zeocin ^-Control group does not contain Zeocin in the substratum ^TM, inoculation DH5 α observes the bacterial growth situation; The B group is Zeocin ⁺Control group contains Zeocin in the substratum ^TM(25 μ g/mL), inoculation DH5 α observes bacterium to Zeocin ^TMDrug susceptibility.

5, the PCR of recombinant expression plasmid identifies

To the suspicious bacterium colony that grows on the LB Zeocin+ substratum plate, be inoculated in 2mL and contain ZeocinTM(25 μ g/mL) in the less salt LB liquid nutrient medium, 37 ℃ of 250r/min jolting overnight incubation, extracting plasmid from bacterium liquid.Take recombinant plasmid dna as template, the Auele Specific Primer that adds the purpose fragment carries out PCR to be identified.Take recombinant plasmid dna as template, in the Eppendorf of 0.5mL pipe, add successively following composition:

The instantaneous centrifugal mixing of above-mentioned mixed solution, positive plasmid called after pPICZ α C-IFN-α.

6, the single endonuclease digestion of recombinant plasmid pPICZ alpha C-IFN-α is identified

With restriction enzyme Sac I the recombinant plasmid through the PCR test positive is carried out single endonuclease digestion and identifies that reaction system is as follows:

After the endonuclease reaction system places 37 ℃ of waters bath with thermostatic control to spend the night, in 0.8% sepharose mesolow electrophoresis detection result.

7, the double digestion of recombinant plasmid pPICZ alpha C-IFN-α is identified

With restriction enzyme EcoR I and Kpn I the recombinant expression plasmid through the PCR test positive is carried out double digestion and identifies that reaction system is as follows:

Above-mentioned each component is added in the EP pipe of 0.5mL, mixing, 37 ℃ of enzymes are cut 4h in the placement water-bath, detect through 0.8% agarose gel electrophoresis.

8, the sequencing of recombinant expression plasmid pPICZ α C-IFN-α goal gene

(3) carry the structure of the recombination yeast of goal gene

1, the preparation of pichia pastoris X-33 competent cell

Carry out according to Invitrogen company laboratory manual, be inoculated in the YPD nutrient solution of 5mL with aseptic toothpick picking list bacterium colony PichiaPastoris X-33,28～30 ℃ of shaking culture are spent the night.Get part overnight culture (ratio in 0.1%) and be re-seeded in the YPD nutrient solution of 50mL, 28～30 ℃ of shaking culture are until bacterium liquid OD ₆₀₀=1.2～1.5.4 ℃, the centrifugal 5min of 8,500r/min collects thalline, with the resuspended thalline of aqua sterilisa of 50mL precooling.Same centrifugal collection thalline is with the resuspended thalline of aqua sterilisa of 25mL precooling.The centrifugal rear resuspended thalline of sorbyl alcohol of using the 1mol/L of 2mL precooling, 4 ℃, the centrifugal 5min of 8,500r/min collects thalline.Use at last the resuspended thalline of sorbyl alcohol of the 1mol/L of 50～80 μ L precoolings, namely obtain the competence yeast cell, be used for transforming when atmospheric electricity, not freeze-stored cell.

2, the linearizing of recombinant plasmid pPICZ alpha C-IFN-α and recovery

Carry out according to Invitrogen company laboratory manual, with Sac I single endonuclease digestion pPICZ α C-IFN-α, make it linearizing, the endonuclease reaction system is as follows:

Simultaneously empty carrier pPICZ α C is also carried out linearizing, system is the same.

Above-mentioned each component is added in the Eppendorf pipe, mixing, 37 ℃ of enzymes are cut 8h in the placement water-bath.After the electrophoresis detection linearizing fully, carry out the recovery purifying of goal gene.

3, the electric shock of recombinant plasmid pPICZ alpha C-IFN-α transforms

Get gently mixing of the competence yeast cell of the fresh preparation of 80 μ L and the linearizing recombinant plasmid of 20 μ L.Change the middle ice bath 5min of electric revolving cup (Eppendorf company, 100 μ L) of precooling over to.Setting electric Transformation Parameters is 1500V.The sorbyl alcohol that adds immediately the 1mol/L of 1mL precooling after electricity transforms behind the mixing moves into conversion product the culture tube of 5mL gently.30 ℃ leave standstill cultivation 1.0h, then add 1mL YPD liquid, and 30 ℃, 200r/min shaking culture 1.0h.Centrifugal collection thalline, resuspended and be laid on that the YPDS of fresh preparation is dull and stereotyped (to contain 100 μ g/mL Zeocin with 50～200 μ L YPD ^TM) on, flat board is inverted, in 30 ℃ of incubators, cultivate 3～5d.

4, recombination microzyme bacterium liquid PCR identifies

With the Zeocin that has that grows on the tall and slender YPDS flat board of sterilizing toothpick ^TMSingle bacterium colony of resistance is inoculated in the YPDS liquid nutrient medium of 1mL and (contains 200 μ g/mL Zeocin ^TM), 30 ℃, the 200r/min shaking culture is spent the night.

The recombination yeast that pPICZ α C-IFN-α is transformed, the recombination yeast that pPICZ α C transforms and unconverted yeast X-33 after the YPD liquid nutrient medium is cultivated 16～20h, ice bath 5min, supernatant discarded behind the centrifugal 5min of 5,000r/min; Bacterium mud is resuspended with broken bacterium damping fluid, after the same centrifugal supernatant discarded, adds the resuspended bacterium mud of 200 μ L yeast lysates, and adds isopyknic 0.5mm pickling glass pearl and the saturated phenol of isopyknic Tris, and 3min vibrates on the wortex device; Get supernatant behind the centrifugal 10min of 12,000r/min, add isopyknic Virahol in the supernatant, 4 ℃ act at least 10min, precipitation DNA; The centrifugal supernatant of abandoning of 12,000r/min dries behind 75% ethanol and the absolute ethanol washing, adds 40 μ L distilled waters (containing RNase) and dissolves for subsequent use.

This method is also used in this experiment of rapid extraction of recombination yeast DNA: the restructuring height that screening is obtained copies bacterial strain, get in single bacterium colony a small amount of bacterium and put into the Eppendorf pipe, the aqua sterilisa that adds 100 μ L, 100 ℃ are boiled 10min, clear up the yeast cell wall, then put into liquid nitrogen and freeze 30min, 100 ℃ are boiled 10min, 12,000r/min centrifuging and taking supernatant liquor, make template with a small amount of genomic dna wherein, carry out PCR and identify.

PoIFN-alpha reaction program: 94 ℃ of denaturation 4min, and then the following circulation of beginning: 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s move 30 circulations, and last 72 ℃ are extended 10min.After PCR finishes, respectively get 5 μ LPCR products with 0.8% agarose gel electrophoresis, observations in the ultraviolet transilluminator.

(4) the preliminary abduction delivering of high resistance integron

With the Zeocin that has that grows on the tall and slender YPDS flat board of sterilizing toothpick ^TMSingle bacterium colony of resistance is chosen in the YPDS of 1mL liquid nutrient medium and (is contained 200 μ g/mLZeocin ^TM), 30 ℃, the 200r/min shaking culture is spent the night.

With the Zeocin that has that grows on the tall and slender YPDS flat board of sterilizing toothpick ^TMSingle bacterium colony of resistance is chosen in the BMGY of 20mL liquid nutrient medium and is activated cultivation, and 30 ℃, the 200r/min shaken overnight is to OD ₆₀₀=2～6, this moment, cell was in logarithmic phase.The centrifugal 5min collecting precipitation of 1500～3000r/min room temperature is resuspended among the BMMY of 1mL, continues shaking culture, adds two-layer newspaper wrapping, shaking culture in the test tube of 15mL with four layers of clean gauze.It is 1% that every interval 24h adds 100% methyl alcohol to final concentration, carries out inducing culture.Be cultured to 96h and collect sample, centrifugal, get supernatant and do immediately the SDS-PAGE analysis or place-70 ℃ of preservations.

(5) check of expression product

1, the SDS-PAGE of expression product analyzes

Be cultured to 96h and collect sample, centrifugal, get supernatant and do immediately the SDS-PAGE analysis.

2, the Western-blot of expression product analyzes (on the interferon-β market without commercial monoclonal antibody)

Get supernatant and carry out Western-blot and analyze, respectively take the anti-pig α of mouse, IFN-γ monoclonal antibody as primary antibodie, goat anti-mouse-IgG-HRP is two anti-, the expressing protein of transferring on the nitrocellulose membrane is processed the DAB colour developing.

(6) detection of pig α, β and IFN-γ protein content

Abduction delivering product supernatant is carried out the SDS-PAGE protein electrophoresis, then carry out dyeing-decolorzing, place thin layer chromatography scanner to carry out gray scale scanning, analyze by the Labwork software system, utilize bovine serum albumin to do quantitative contrast, come the effective content of pig interferon in calculation sample total protein content and the total protein thereof, the measurement result of the gray scale scanning relative value of different samples.

The result is as follows:

PoIFN-α swimming lane total protein total protein concentration is 77.654mg/L

The effective protein concentration of PoIFN-α is 54.105mg/L

The effective content of pig IFN-α accounts for the per-cent of sample total protein content in the sample

PoIFN-α：54.105／77.654×100%≈69.67%

PoIFN-β swimming lane total protein concentration is 84.75mg/L

The effective protein concentration of PoIFN-β is 66.98mg/L

The effective content of pig IFN-β accounts for the per-cent of sample total protein content in the sample:

PoIFN-β：66.98／84.75×100%≈79.03%

PoIFN-γ swimming lane total protein concentration is 100.44mg/L

The effective protein concentration of PoIFN-γ is 79.976mg/L

The effective content of porcine IFN γ accounts for the per-cent of sample total protein content in the sample:

PoIFN-γ：79.976／100.44×100%≈79.63%

The mensuration 10 of VSV titre ^5.5TCID ₅₀/ mL

The porcine alpha-IFN of expressing is tired: be 1.817x10 without transformation ⁶U/L is 5.87 * 10 through tiring of transformation ⁷U/L.

The porcine beta interferon of expressing is tired: be 3.52x10 without transformation ⁶U/L is 1.02 * 10 through tiring of transformation ⁸U/L

The pig gamma interferon of expressing is tired: be 1.01x10 without transformation ⁶U/L is 1.60 * 10 through tiring of transformation ⁷U/L.

(7) whole serial correlation

The aminoacid sequence of expressing before and after PoIFN-α transforms does not change, and the just base of Nucleotide of variation puts in order (codon modify), by Fig. 1 and Fig. 2 as can be known, before and after transforming, the albumen of expressing does not change, and the base sequence similarity only has 78.6%, and changing has 25.8%.

The aminoacid sequence of expressing before and after PoIFN-β transforms does not change, and the just base of Nucleotide of variation puts in order (codon modify), by Fig. 3 and Fig. 4 as can be known, before and after transforming, the albumen of expressing does not change, and the base sequence similarity only has 78.5%, and changing has 25.8%.

The aminoacid sequence of expressing before and after PoIFN-γ transforms does not change, and the just base of Nucleotide of variation puts in order (codon modify), by Fig. 5 and Fig. 6 as can be known, before and after transforming, the albumen of expressing does not change, and the base sequence similarity only has 75.5%, and changing has 30.7%.

The above only is preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the technology of the present invention principle; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Claims (9)

1. the gene fragment of the porcine beta interferon of encoding is characterized in that, has the nucleotide sequence shown in SEQ IDNO.4.

2. gene fragment as claimed in claim 1 is characterized in that, is used for the upstream primer P β of its sequence of amplification ₁Has the nucleotide sequence shown in SEQ ID NO.5; Downstream primer P β ₂Has the nucleotide sequence shown in SEQ ID NO.6.

3. gene fragment as claimed in claim 2 is characterized in that, the annealing temperature that is used for the PCR method of its sequence of amplification is 52 ℃.

4. the application of the described gene fragment of claim 1 ~ 3 in making up the recombinant yeast pichia pastoris that to express porcine beta interferon.

5. application as claimed in claim 4 is characterized in that, the expression vector of employing is pPICZ α C, and recombinant plasmid is pMD-IFN-β.

6. a porcine beta interferon is characterized in that, it has the aminoacid sequence shown in SEQ ID NO.11.

7. the application of porcine beta interferon claimed in claim 6 in the preparation antiviral.

8. application as claimed in claim 7 is characterized in that, described antiviral is the medicine of anti-porcine viral diseases.

9. an antiviral is characterized in that, contains porcine beta interferon claimed in claim 6.

Images