CN102747076B - Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof - Google Patents
Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof Download PDFInfo
- Publication number
- CN102747076B CN102747076B CN201210201464.XA CN201210201464A CN102747076B CN 102747076 B CN102747076 B CN 102747076B CN 201210201464 A CN201210201464 A CN 201210201464A CN 102747076 B CN102747076 B CN 102747076B
- Authority
- CN
- China
- Prior art keywords
- heart disease
- coronary heart
- allelotrope
- site
- single nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000002773 nucleotide Substances 0.000 title claims abstract description 16
- 125000003729 nucleotide group Chemical group 0.000 title claims abstract description 16
- 208000033692 susceptibility to 1 coronary heart disease Diseases 0.000 title abstract 3
- 208000029078 coronary artery disease Diseases 0.000 claims abstract description 115
- 208000010125 myocardial infarction Diseases 0.000 claims abstract description 20
- 238000001514 detection method Methods 0.000 claims description 17
- 238000012360 testing method Methods 0.000 claims description 16
- 239000003153 chemical reaction reagent Substances 0.000 claims description 15
- 206010002383 Angina Pectoris Diseases 0.000 claims description 14
- 238000002360 preparation method Methods 0.000 claims description 14
- 108700028369 Alleles Proteins 0.000 claims description 7
- 108090000623 proteins and genes Proteins 0.000 abstract description 26
- 102000054766 genetic haplotypes Human genes 0.000 abstract description 17
- 210000000349 chromosome Anatomy 0.000 abstract description 4
- 201000010099 disease Diseases 0.000 abstract description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 4
- 230000036541 health Effects 0.000 abstract description 3
- 238000012216 screening Methods 0.000 abstract description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 abstract 1
- 239000000523 sample Substances 0.000 description 25
- 238000000034 method Methods 0.000 description 15
- 239000013642 negative control Substances 0.000 description 8
- 238000004458 analytical method Methods 0.000 description 7
- 238000003205 genotyping method Methods 0.000 description 7
- 239000012530 fluid Substances 0.000 description 6
- 238000012252 genetic analysis Methods 0.000 description 6
- 238000003556 assay Methods 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 5
- 239000000203 mixture Substances 0.000 description 5
- 230000002759 chromosomal effect Effects 0.000 description 3
- 230000034994 death Effects 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 208000024891 symptom Diseases 0.000 description 3
- 208000024172 Cardiovascular disease Diseases 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 238000007405 data analysis Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 238000001415 gene therapy Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000007477 logistic regression Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 230000006798 recombination Effects 0.000 description 2
- 238000005215 recombination Methods 0.000 description 2
- 206010003210 Arteriosclerosis Diseases 0.000 description 1
- 201000001320 Atherosclerosis Diseases 0.000 description 1
- 208000031229 Cardiomyopathies Diseases 0.000 description 1
- 206010008190 Cerebrovascular accident Diseases 0.000 description 1
- 206010008479 Chest Pain Diseases 0.000 description 1
- 208000002330 Congenital Heart Defects Diseases 0.000 description 1
- 241001269238 Data Species 0.000 description 1
- 102000016911 Deoxyribonucleases Human genes 0.000 description 1
- 108010053770 Deoxyribonucleases Proteins 0.000 description 1
- 208000034826 Genetic Predisposition to Disease Diseases 0.000 description 1
- 206010019280 Heart failures Diseases 0.000 description 1
- 208000000563 Hyperlipoproteinemia Type II Diseases 0.000 description 1
- 108010044467 Isoenzymes Proteins 0.000 description 1
- 102100024640 Low-density lipoprotein receptor Human genes 0.000 description 1
- 108700008625 Reporter Genes Proteins 0.000 description 1
- 201000004239 Secondary hypertension Diseases 0.000 description 1
- 208000006011 Stroke Diseases 0.000 description 1
- 206010045261 Type IIa hyperlipidaemia Diseases 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000003143 atherosclerotic effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 230000000747 cardiac effect Effects 0.000 description 1
- 230000002490 cerebral effect Effects 0.000 description 1
- 208000026106 cerebrovascular disease Diseases 0.000 description 1
- 238000007621 cluster analysis Methods 0.000 description 1
- 208000028831 congenital heart disease Diseases 0.000 description 1
- 238000002586 coronary angiography Methods 0.000 description 1
- 210000004351 coronary vessel Anatomy 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000000875 corresponding effect Effects 0.000 description 1
- 230000001186 cumulative effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 208000022602 disease susceptibility Diseases 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000009509 drug development Methods 0.000 description 1
- 230000008030 elimination Effects 0.000 description 1
- 238000003379 elimination reaction Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 201000001386 familial hypercholesterolemia Diseases 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 230000014509 gene expression Effects 0.000 description 1
- 230000007407 health benefit Effects 0.000 description 1
- 208000019622 heart disease Diseases 0.000 description 1
- 208000018578 heart valve disease Diseases 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000011337 individualized treatment Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000000302 ischemic effect Effects 0.000 description 1
- 210000003734 kidney Anatomy 0.000 description 1
- 208000017169 kidney disease Diseases 0.000 description 1
- 230000002045 lasting effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 208000019423 liver disease Diseases 0.000 description 1
- 206010025482 malaise Diseases 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 210000004165 myocardium Anatomy 0.000 description 1
- 239000002547 new drug Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000004853 protein function Effects 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses single nucleotide polymorphisms (SNPs) associated with the susceptibility to diseases, particularly relates to SNPs of a susceptible area chr4q32 associated with the susceptibility to coronary heart disease and an application thereof in evaluating the susceptibility to coronary heart disease, belonging to the technical field of biology. The SNPs are a series of SNPs located at GUCY1A3-GUCY1B3 gene region down stream on the chromosome 4q32, that is, rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, and rs1123037. According to the invention, by using the chromosome 4q32's variation characters of haplotypes composing of a section of SNPs close to the GUCY1A3-GUCY1B3 gene region down stream and a series of SNPs to judge the susceptible population of coronary heart disease, non-invasive rapid and simple screening can be carried out on the people who have no early clinical signs of coronary heart disease, especially high risk group of coronary heart disease who have traditional risk factors, susceptible objects of coronary heart disease can be discovered early, corresponding health protection measures can be adopted, and the incidence of coronary heart disease and myocardial infarction can be reduced.
Description
Technical field
The present invention relates to the mononucleotide polymorphism site be associated with disease susceptibility, in particular to the mononucleotide polymorphism site of a kind of susceptibility regions chr4q32 associated with coronary disease susceptibility and assessing the application in coronary disease susceptibility, belong to biological technical field.
Background technology
Atherosclerotic Cardio-Cerebrovascular Diseases has become the major health concern that world wide is paid close attention to.The World Health Organization's report display of 2004, the annual cardiovascular disorder in the whole world takes the death toll Da Gaoda 1,720 ten thousand caused as the leading factor with coronary heart disease and cerebral apoplexy, account for 1/3rd of all death tolls.Estimate that this numeral of the year two thousand twenty will increase by 50% further, up to 2,500 ten thousand, cardiovascular disorder is global human " number one killer ".The extensive perspective study carried out in China also shows, and heart disease has become the major causes of death of Chinese population, apportion man, the 2nd and the 1st of women die reason.Myocardial infarction 500,000 people newly sends out every year in China, and the Hazard Factor of being correlated with along with living-pattern preservation and atherosclerosis continue to increase, and coronary heart disease and myocardial infarction are fallen ill yet will in lasting ascendant trend.
A large amount of research datas shows, coronary heart disease is a kind of complex disease, is caused by multiple minor gene and environmental factors interact for a long time.Therefore identify the tumor susceptibility gene relevant to coronary heart disease or Disease-causing gene, in crowd, further screening increases the tumor susceptibility gene determination susceptible individual of disease risks, will contribute to the onset risk prediction of coronary heart disease, new drug development, diagnosis and individualized treatment.From basis to clinical, people are to this has been large quantifier elimination, and a large amount of knowledge is have accumulated in the Hazard Factor and the pathogenetic physiopathology of coronary disease of coronary heart disease, but but know little about it about the definite genetic molecule mechanism that coronary heart disease and myocardial infarction occur, for how to identify inheritance susceptible gene and to identify the coronary heart disease genetic predisposition of experimenter, lack the effective recognition methods of comprehensive system always.
Summary of the invention
The object of the embodiment of the present invention is the defect for above-mentioned prior art, mononucleotide polymorphism site (SNP that is a series of and coronary disease susceptibility significant correlation is provided, single nucleotide polymorphism)), and find out and wherein associate the most significant representative site with coronary disease susceptibility, then provide the purposes of described mononucleotide polymorphism site for assessment of coronary disease susceptibility.
The technical scheme that the present invention takes to achieve these goals is:
First aspect, provides mononucleotide polymorphism site (SNP) that is a series of and the susceptibility regions chr4q32 of coronary disease susceptibility significant correlation.In Chinese han population, choose 1515 routine patients with coronary heart disease and the normal artificial research object of 5019 examples, use full-length genome chip (Affymetrix Axiom
tMgenome-Wide CHB 1 Array Plate) chip carries out gene type to SNP within the scope of full-length genome.Utilize the data that chip obtains, evaluate the incidence relation of genotype and phenotype, thus obtain may with there is the downstream that the potential region associated is the GUCY1A3-GUCY1B3 gene region on karyomit(e) 4q32 between coronary heart disease, the a series of mononucleotide polymorphism sites being positioned at this region with the mononucleotide polymorphism site that coronary disease susceptibility significantly associates, for: rs2625269, allelotrope is A/G; Rs1976041, allelotrope is A/G; Rs1905261, allelotrope is A/C; Rs1905262, allelotrope is A/T; Rs2705455, allelotrope is G/A; Rs1483041, allelotrope is A/G; Rs2200168, allelotrope is C/T; Rs716428, allelotrope is C/T; Rs990619, allelotrope is G/C; Rs1842896, allelotrope is G/T; Rs2625245, allelotrope is A/G; Rs1123037, allelotrope is A/T.
Second aspect, logistic regression analysis is used to assess the relation of each SNP site and coronary heart disease, calculate dangerous allelic relative risk (Odds ratio, the credibility interval of OR) and 95%, obtain the dangerous allelotrope of this series of SNP site respectively: rs2625269 pleomorphism site is A, rs1976041 pleomorphism site is G, rs1905261 pleomorphism site is A, rs1905262 pleomorphism site is A, rs2705455 pleomorphism site is G, rs1483041 pleomorphism site is A, rs2200168 pleomorphism site is C, rs716428 pleomorphism site is C, rs990619 pleomorphism site is G, rs1842896 pleomorphism site is T, rs2625245 pleomorphism site is G, rs1123037 pleomorphism site is T.
The third aspect, selects chr4q32 Regional Representative site rs1842896, uses linkage disequilibrium (Linkage disequilibrium, the LD) situation between Haploview computed in software chromosomal region site in data analysis.This region rs1842896 pleomorphism site and rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs2625245, rs1123037, have strong linkage disequilibrium.Use Fludigm@EP1 gene alaysis system (Fludigm@EP1 simultaneously
tMgENETIC ANALYSIS system), Taqman MGB probe method carries out gene type, verify in 15460 routine patients with coronary heart disease and 11472 routine check samples further, what merge all 16975 routine cases and 16491 check sample analyses display rs1842896 and coronary heart disease associates more significantly, this result further demonstrate that chr4q32 region polymorphic site and coronary heart disease closely related.
Fourth aspect, according to the above-mentioned mononucleotide polymorphism site with coronary disease susceptibility significant correlation, builds haplotype (haplotype) and compares its frequency difference between patient and normal control, in order to assess coronary disease susceptibility.
The beneficial effect that the technical scheme that the embodiment of the present invention provides is brought is:
Judged the method for coronary heart disease Susceptible population by the SNP site in one section of contiguous GUCY1A3-GUCY1B3 gene region downstream and the variation property of haplotype that is made up of a series of SNP site according to karyomit(e) 4q32 of the present invention, can to the crowd not occurring coronary heart disease early clinic symptom, especially there is the coronary heart disease high risk population of conventional risk factors, carry out without the fast and convenient examination of wound, early discovery coronary heart disease susceptible object, and take corresponding hygienic measures, reduce the sickness rate of coronary heart disease and myocardial infarction.
Also scientific basis can be provided for researching and developing coronary heart disease gene therapy targetedly according to the present invention.The present invention is the regulation and control of further gene expression detection, protein function, the mechanism of causing a disease of further investigation coronary heart disease, development of new medicine and gene therapy, realize having established important foundation based on the personalized medicines of genetic background, and bring important medical health benefit and economic benefit.
Accompanying drawing explanation
Fig. 1 is the correlation diagram of determined chr4q32 region SNP site and coronary heart disease in embodiment 1.
Fig. 2 is in the detection in the repeated authentication stage of embodiment 2, wherein the representative site rs1842896 genotypic results dendrogram of 96 samples (94 samples to be tested and 2 negative controls);
Fig. 3 carries out the sectional drawing of gene type for the representative site rs1842896 of using SNP Genotyping Analysis softgware version 3.0 software to the sample of 96 described in Fig. 2 (94 samples to be tested and 2 negative controls);
Fig. 4 represents the sectional drawing of site rs1842896 genotypic results derived data for the sample of 96 described in Fig. 2 (94 samples to be tested and 2 negative controls).
In Fig. 1: X-coordinate " Position on chr " is the position (unit Mb) on karyomit(e); Ordinate zou be mononucleotide polymorphism site with coronary heart disease associate significance P value (-log10 (p-value)), right side Recombination rate is recombination fraction, unit (CM/Mb); Represent site rs1842896 with ◆ represent.
In Fig. 2: X-axis represents VIC fluorescence intensity, Y-axis represents FAM fluorescence; Genotype results: red 1 is G/G homozygote, green 2 is T/T homozygote, and blue 3 is G/T heterozygote, and black 4 is negative control (NTC).
Wherein: X-coordinate X:Allele is allelotrope, VIC-MGB represents VIC fluorescent mark MGB probe; Ordinate zou Y:Allele is allelotrope, and FAM-MGB is FAM fluorescent mark MGB probe; Top represents SNP site, call rate is this site recall rate on this chip, Auto Confidence is the genotypic confidence level of automatic discrimination that software provides; Below Chip Run Name is the EP1 chip title adopted in experiment.
Embodiment
For making the object, technical solutions and advantages of the present invention clearly, below embodiment of the present invention is described further in detail.
Embodiment 1 determines the mononucleotide polymorphism site, allelotrope and the dangerous allelotrope thereof that significantly associate with coronary disease susceptibility:
One, method
First in Chinese han population, choose 1515 routine patients with coronary heart disease and the normal artificial research object of 5019 examples.Use full-length genome chip (the Affymetrix Axiom of Affymetrix company
tMgenome-Wide CHB 1 Array Plate) by Shanghai Communications University BIO-X Spot detection.Obtain the genotype data of 1515 routine patients with coronary heart disease and 5019 routine normal people's full-length genome chip SNP.Obtain each site in SNP chip by full-length genome association (GWAS) analytical calculation and associate significance level (P value) with coronary heart disease, find out according to significance level (P value is less than 0.001) and there is the potential chromosomal region associated between coronary heart disease, and obtain mononucleotide polymorphism site that coronary disease susceptibility significantly associates and allelotrope thereof.Adopt plink software to carry out logistic regression analysis during statistical study and assess the significance that each SNP site associates with coronary heart disease, calculate dangerous allelic relative risk (Odds ratio, the credibility interval of OR) and 95%, directly obtain OR value, credibility interval and P value in analysis, thus obtain the dangerous allelotrope in described site.
Two, case and check sample inclusion criteria
Coronary heart disease case comprises myocardial infarction patient and patient with angina pectoris, and the selected Case definition of myocardial infarction case is Diagnosis of AMI standard (according to the WHO Case definition of 1979): i.e. typical chest pain Symptoms last more than 30 minutes; Continuous 2 ST-segments of electrocardiogram(ECG (limb leads 0.1mv, chest leads 0.2mv) also have serial dynamic change; The serum marker substrate concentration of myocardial necrosis raises, and as troponin (TNT/TNI) raises, myocardium isozyme (CK-MB) raises 2 times that are greater than normal value high limit.Through coronary angiography, the selected Case definition of stenocardia case is for finding that at least one Main Branches of coronary artery is narrow in 70%.Valvular heart disease, congenital heart disease, heart failure, serious kidney and hepatic diseases, secondary hypertension, myocardosis, familial hypercholesterolemia and Suspected Coronary Heart Disease patient except every inspection.Control group inclusion criteria: previously without coronary heart disease or other Atheromatosis histories, without pectoralgia, the cardiac symptom such as uncomfortable in chest, electrocardiogram(ECG is without obvious ischemic change.Case group and control group are Chinese han population, and consanguinity-less relation.
Three, the essential characteristic of crowd is tested
Test crowd is that its essential characteristic of chip detection sample is as shown in table 1:
Table 1:
Four, result
A series of SNP site (the rs2625269 be positioned in one section of close linkage region of GUCY1A3-GUCY1B3 gene region downstream 76kb on karyomit(e) 4q32 are found by full-length genome association (GWAS) analysis, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, rs1123037) with coronary disease susceptibility significant correlation (see Fig. 1), the association results of itself and coronary heart disease is as shown in table 2.
This series of SNP site and allelotrope thereof are: rs2625269, and allelotrope is A/G; Rs1976041, allelotrope is A/G; Rs1905261, allelotrope is A/C; Rs1905262, allelotrope is A/T; Rs2705455, allelotrope is G/A; Rs1483041, allelotrope is A/G; Rs2200168, allelotrope is C/T; Rs716428, allelotrope is C/T; Rs990619, allelotrope is G/C; Rs1842896, allelotrope is G/T; Rs2625245, allelotrope is A/G; Rs1123037, allelotrope is A/T.Wherein dangerous allelotrope respectively: rs2625269 pleomorphism site is A, rs1976041 pleomorphism site is G, rs1905261 pleomorphism site be A, rs1905262 pleomorphism site is A, rs2705455 pleomorphism site is G, rs1483041 pleomorphism site is A, rs2200168 pleomorphism site be C, rs716428 pleomorphism site is C, rs990619 pleomorphism site is G, rs1842896 pleomorphism site is T, rs2625245 pleomorphism site be G, rs1123037 pleomorphism site is T.(see table 2).The relative risk of carrying these dangerous allelic individuality generation coronary heart disease is 1.22-1.24 times that does not have carrier.Wherein the incidence of coronary heart disease risk of rs1842896 pleomorphism site T allelotrope carrier is 1.23 times (OR=1.23,95%CI:1.11-1.37) of the allelic carrier of G, and P value significantly (see table 2).
The association results of table 2.Chr4q32 region SNP site and coronary heart disease
Wherein " region ", the karyomit(e) zone at this pleomorphism site place is represented; " Risk allele ", represents risk allelotrope; " Other allele ", represents with reference to allelotrope; " gene frequency " is risk gene frequency." OR(95%CI) ", represents and carries with reference to compared with allelic individuality, carrying the relative risk that coronary heart disease occurs risk allelic individuality.Chromosome position is with reference to Human Genome NCBI Build36.
Embodiment 2 is determined to associate the most significant representative mononucleotide polymorphism site with coronary disease susceptibility
One, method
Linkage disequilibrium (Linkage disequilibrium, LD) situation between the chromosomal region mononucleotide polymorphism site of use Haploview computed in software embodiment 1 gained, uses r
2represent (0-1).Select the representative site wherein having strong linkage disequilibrium, verify further in 15460 routine patients with coronary heart disease and 11472 routine check samples, the method for checking uses Fludigm@EP1 gene alaysis system (Fludigm@EP1
tMgENETIC ANALYSIS system), Taqman MGB probe method carries out gene type to 15460 cases and 11472 check samples, merge the genotyping result of all 16975 routine cases and 16491 check samples, analyze its associating with coronary heart disease, determine to associate the most significant representative mononucleotide polymorphism site with coronary disease susceptibility.
Two, case and check sample inclusion criteria
Case is identical with described in embodiment 1 with check sample inclusion criteria.
Three, the essential characteristic of crowd is tested
Test crowd attaches most importance to and reviews card sample, and its essential characteristic is as shown in table 3:
Table 3:
Four, result
In the mononucleotide polymorphism site associated with coronary disease susceptibility, rs1842896 pleomorphism site and rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs2625245, rs1123037 have strong linkage disequilibrium (r
2>0.8, in table 4).
Table 4.Chr4q32 region rs1842896 with region SNP site linkage disequilibrium relation (r
2)
| SNP polymorphic site | Region | Chromosome position | r 2 |
| rs2625269 | 4q32.1 | 156699160 | 1.00 |
| rs1976041 | 4q32.1 | 156705490 | 0.89 |
| rs1905261 | 4q32.1 | 156721728 | 1.00 |
| rs1905262 | 4q32.1 | 156721898 | 1.00 |
| rs2705455 | 4q32.1 | 156722307 | 1.00 |
| rs1483041 | 4q32.1 | 156722890 | 1.00 |
| rs2200168 | 4q32.1 | 156723970 | 0.89 |
| rs716428 | 4q32.1 | 156726319 | 0.89 |
| rs990619 | 4q32.1 | 156727128 | 1.00 |
| rs1842896 | 4q32.1 | 156730909 | 1.00 |
| rs2625245 | 4q32.1 | 156731096 | 1.00 |
| rs1123037 | 4q32.1 | 156734175 | 0.86 |
Chr4q32 region rs1842896 pleomorphism site is verified further in 15460 routine patients with coronary heart disease and 11472 routine check samples, and what merge all 16975 routine cases and 16491 check sample analyses display rs1842896 and coronary heart disease associates more remarkable (P=1.26 × 10
-11), this result further demonstrate that Chr4q32 region polymorphic site and coronary heart disease closely related (see table 5).
The association results of table 5.Chr4q32 Regional Representative site rs1842896 in 16975 routine cases and 16491 routine check samples
Wherein " region ", the karyomit(e) zone at this pleomorphism site place is represented; " Risk Allele (Freq) ", represents risk allelotrope and gene frequency thereof." OR(95%CI) ", represents and carries with reference to compared with allelic individuality, carrying the relative risk that coronary heart disease occurs risk allelic individuality.
The method of susceptibility loci is detected for the repeated authentication stage:
Experiment porch: Fludigm@EP1 gene alaysis system (Fludigm@EP1
tMgENETIC ANALYSIS system), this system is the high-throughput genotyping system of chip Fludigm company of U.S. exploitation, is made up of integrated fluid conduit (IFC) chip, integrated fluid track control unit (IFC controller), heat circulating system and fluorescence signal acquisition system (EP1 reader); Adopt Taqman gene type conventional reagent, gene type can be carried out to 96 samples, 96 SNP site or 48 samples, 48 SNP site simultaneously; It is a kind of high-throughout open genetic analysis platform.Taqman MGB probe method carries out 96 the SNP site gene type experiments comprising rs1842896.
One, instrument: Fludigm
@eP1(gene alaysis system)
Two, material:
1. reagent, sample:
*the detection site that this primer and probe are provided according to user by supplier and being equipped with.ROX is a kind of fluorescence dye.
Consumptive material:
| 96.96 gene typing chips | （96.96 Dynamic Array(138X)） |
| 96 hole PCR plate and disposable shrouding film | （96well plates and seal(one-off)） |
Three, experimental technique
(1) operation steps:
1. test fluid (Assay) preparation: in 96 hole PCR plate, prepares test mixing liquid (Assay mix) with reference to following table
| Component | Each well volume (μ l) |
| 40×Taqman Genotyping Assay | 1.25 |
| 2×Assay Loading Reagent | 2.5 |
| ROX(50×) | 0.25 |
| DNase/RNase-free water | 1.0 |
| Cumulative volume | 5.0 |
After adding, cover disposable shrouding film, microwell plate vibrator fully mix, on Microplate centrifuge about 2500 ~ 3000rpm(500g centrifugal force) centrifugal 30 seconds, be placed on ice.
2. sample (sample) preparation: in 96 orifice plate PCR plate, with reference to following table:
After adding, cover disposable shrouding film, microwell plate vibrator fully mix, on Microplate centrifuge about 2500 ~ 3000rpm(500g centrifugal force) centrifugal about 30 seconds, be placed on ice.
3. application of sample and amplification procedure
Chip in integrated fluid track control unit HX after initialize, application of sample (the application of sample amount of Assay is 4.2 μ l/ holes, and the application of sample amount of Sample is 5.2 μ l/ holes).To add excellent chip reapposes in integrated fluid track control unit HX, starts " Load Mix (138X) " program, carries out separatory and mixing.
After said process completes, chip takes out by (in one hour) from integrated fluid track control unit HX at once, remove pad pasting blue after chip, chip is placed in heat circulating system (Stand alone Thermo Cycler), start Thermo Cycler PCR instrument, choose built-in program curing PROGTM96, carry out PCR process.After PCR terminates, turn off vacuum pump below PCR instrument (Vacuum Pump), open PCR instrument upper cover, take off chip.
(2) data gathering: start fluorescence signal acquisition system (EP1 reader), application data acquisition software (
data Collection Software version 3) image data.
(3) data analysis: using SNP Genotyping Analysis 3.0 software, carries out cluster analysis and reporter gene type according to the not homoallelic fluorescence signal intensity of mononucleotide polymorphic site.
See Fig. 2, represent VIC fluorescence intensity with X-axis, Y-axis represents FAM fluorescence, and the relative height according to two kinds of fluorescent signals carries out cluster, and red 1 is G/G homozygote, and green 2 is T/T homozygote, and blue 3 is GG/T heterozygote, and black 4 is negative control (NTC); Be that using SNP Genotyping Analysis 3.0 software (Genotyping Analysis software version 3.0) represents to 96 samples (94 samples to be tested and 2 negative controls) sectional drawing that site rs1842896 carries out gene type see Fig. 3.Genotypic results is with excel Output of for ms (see Fig. 4).
Embodiment 3 and the purposes of the remarkable association table nucleotide polymorphic site of coronary disease susceptibility for assessment of coronary disease susceptibility
One, method
By 4q32 region rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, rs1123037 site builds 4 kinds of haplotypes.1515 cases obtained according to full-length genome chip and the genotype data of 5019 check samples, analyze these SNP site and haplotype frequency difference between patient and normal people of forming of a series of SNP site thus, can draw the concrete base in each site variation and consisting of haplotype difference and the relation of coronary disease susceptibility.Same application Fludigm
@eP1
tMgENETIC ANALYSIS system, TaqmanMGB probe method carries out gene type experiment to crowd to be checked, namely can determine coronary heart disease Susceptible population in crowd.
Two, result
1, the association results of Chr4q32 region SNP haplotype and coronary heart disease
In above-mentioned 4 kinds of haplotypes, haplotype AGAAGACCGTGT and GACTAGTTCGAA is the most common in crowd, and frequency is respectively 0.76 and 0.194.These two haplotypes are associated with the susceptibility of coronary heart disease, and its frequency exists significant difference (see table 6) between patients with coronary heart disease and normal controls.Coronary heart disease risk haplotype is AGAAGACCGTGT, and the frequency in coronary heart disease case is 0.7888, significantly higher than the frequency 0.753 of control group.
The association results of table 6.Chr4q32 region SNP haplotype and coronary heart disease
* haplotype is made up of rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, rs1123037 respectively.Wherein, P value is the significance level of haplotype in case-control medium frequency difference.
2, the assessment of coronary heart disease Susceptible population in crowd
According to the association results showing 2.Chr4q32 region SNP site and coronary heart disease in embodiment 1, and in the present embodiment, show the association results of 6.Chr4q32 region SNP haplotype and coronary heart disease, through with Fludigm
@eP1
tMgENETIC ANALYSIS system, after Taqman MGB probe method records the susceptibility loci of crowd to be checked, crowd as belonged to one of following characteristics is the Susceptible population of coronary heart disease: in karyomit(e) 4q32 region, the rs2625269 pleomorphism site of GUCY1A3-GUCY1B3 gene region downstream 76kb is A, rs1976041 pleomorphism site is G, rs1905261 pleomorphism site is A, rs1905262 pleomorphism site is A, rs2705455 pleomorphism site is G, rs1483041 pleomorphism site is A, rs2200168 pleomorphism site is C, rs716428 pleomorphism site is C, rs990619 pleomorphism site is G, rs1842896 pleomorphism site is T, rs2625245 pleomorphism site is G, rs1123037 pleomorphism site is T, and by being positioned at the SNP site rs2625269 of this gene region downstream 76kb, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, the individuality of the haplotype AGAAGACCGTGT of rs1123037 composition.
Chr4q32 region SNP site sequence:
As shown in the SEQ ID NO.1 in sequence table:
rs2625269 ATCATATATGGAATAAAGGAAAATAT[A/G]GGTAAAGATTTATACAATCTCAATA
As shown in the SEQ ID NO.2 in sequence table:
rs1976041 TACATGTGATAAATGTTGTAGGTATC[A/G]GGATGGAAAATAAAGCTATTCTCTT
As shown in the SEQ ID NO.3 in sequence table:
rs1905261 ggaacaagttgatttcagccctgatg[A/C]atgattttgaagggttcaaggccag
As shown in the SEQ ID NO.4 in sequence table:
rs1905262 tatgaatgagcaagaaaaggagtttc[A/T]tgagatacaatatagtcctggtgaa
As shown in the SEQ ID NO.5 in sequence table:
rs2705455 atatgatattagataagtcacgtgtt[g/a]ccgtaatttagaatttttttacctg
As shown in the SEQ ID NO.6 in sequence table:
rs1483041 TGTGCAGGCTGCTGTAGCAGATTGCT[A/G]TGCATAAAGGCCATTAGCTTCTAGG
As shown in the SEQ ID NO.7 in sequence table:
rs2200168 GAGCACAGGCAGGAAACTACGTAGCA[C/T]GTCAGGCTTTTGTTTATTTAACACC
As shown in the SEQ ID NO.8 in sequence table:
rs716428 TTTACTTGCACCCTATTATACTCTTC[C/T]AGTTTGGTTGATAAGTTATGCAATT
As shown in the SEQ ID NO.9 in sequence table:
rs990619 AAAGGACCGATATAGAGATCGAGGAA[G/C]TTATCACGAATCGTGTATCAACCGA
As shown in the SEQ ID NO.10 in sequence table:
rs1842896 AGTATTATTTAAAATAGCACCAAAAT[G/T]CATTCCCTTAAAAGCACTAGTTATC
As shown in the SEQ ID NO.11 in sequence table:
rs2625245 GAAAAATTTTATCTTTGTTCAAGAAA[A/G]TTACTGAGGGATAAATATAGTGTAA
As shown in the SEQ ID NO.12 in sequence table:
rs1123037 ATGGAGGAGAGAAGACTGGGGAAAGA[A/T]GTGACATTAAATTGGCCATGAAGTT
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (12)
1. the reagent detecting Chinese Han Population testing sample genomic rs2625269 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs2625269DNA sequence is as shown in SEQ ID NO.1 in sequence table, wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G, and described coronary heart disease comprises myocardial infarction and stenocardia.
2. the reagent detecting Chinese Han Population testing sample genomic rs1976041 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1976041DNA sequence is as shown in SEQ ID NO.2 in sequence table, wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A, and described coronary heart disease comprises myocardial infarction and stenocardia.
3. the reagent detecting Chinese Han Population testing sample genomic rs1905261 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1905261DNA sequence is as shown in SEQ ID NO.3 in sequence table, wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allele C, and described coronary heart disease comprises myocardial infarction and stenocardia.
4. the reagent detecting Chinese Han Population testing sample genomic rs1905262 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1905262DNA sequence is as shown in SEQ ID NO.4 in sequence table, wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope T, and described coronary heart disease comprises myocardial infarction and stenocardia.
5. the reagent detecting Chinese Han Population testing sample genomic rs2705455 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs2705455DNA sequence is as shown in SEQ ID NO.5 in sequence table, wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A, and described coronary heart disease comprises myocardial infarction and stenocardia.
6. the reagent detecting Chinese Han Population testing sample genomic rs1483041 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1483041DNA sequence is as shown in SEQ ID NO.6 in sequence table, wherein mononucleotide n is that the carrier of A suffers from the risk of coronary heart disease higher than allelotrope G, and described coronary heart disease comprises myocardial infarction and stenocardia.
7. the reagent detecting Chinese Han Population testing sample genomic rs2200168 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs2200168DNA sequence is as shown in SEQ ID NO.7 in sequence table, wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T, and described coronary heart disease comprises myocardial infarction and stenocardia.
8. the reagent detecting Chinese Han Population testing sample genomic rs716428 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs716428DNA sequence is as shown in SEQ ID NO.8 in sequence table, wherein mononucleotide n is that the carrier of C suffers from the risk of coronary heart disease higher than allelotrope T, and described coronary heart disease comprises myocardial infarction and stenocardia.
9. the reagent detecting Chinese Han Population testing sample genomic rs990619 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs990619DNA sequence is as shown in SEQ ID NO.9 in sequence table, wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allele C, and described coronary heart disease comprises myocardial infarction and stenocardia.
10. the reagent detecting Chinese Han Population testing sample genomic rs1842896 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1842896DNA sequence is as shown in SEQ ID NO.10 in sequence table, wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope G, and described coronary heart disease comprises myocardial infarction and stenocardia.
11. reagent detecting Chinese Han Population testing sample genomic rs2625245 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs2625245DNA sequence is as shown in SEQ ID NO.11 in sequence table, wherein mononucleotide n is that the carrier of G suffers from the risk of coronary heart disease higher than allelotrope A, and described coronary heart disease comprises myocardial infarction and stenocardia.
12. reagent detecting Chinese Han Population testing sample genomic rs1123037 single nucleotide polymorphism preparation detect or auxiliary detection, examination or prediction coronary heart disease product in application, rs1123037DNA sequence is as shown in SEQ ID NO.11 in sequence table, wherein mononucleotide n is that the carrier of T suffers from the risk of coronary heart disease higher than allelotrope A, and described coronary heart disease comprises myocardial infarction and stenocardia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210201464.XA CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210186553.1 | 2012-06-07 | ||
| CN201210186553 | 2012-06-07 | ||
| CN201210201464.XA CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102747076A CN102747076A (en) | 2012-10-24 |
| CN102747076B true CN102747076B (en) | 2014-12-24 |
Family
ID=47027567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210201464.XA Active CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747076B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404044B (en) * | 2014-12-04 | 2018-04-27 | 广东医学院 | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
| CN101294195A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | Coronary disease testing method and reagent kit |
-
2012
- 2012-06-15 CN CN201210201464.XA patent/CN102747076B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
| CN101294195A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | Coronary disease testing method and reagent kit |
Non-Patent Citations (3)
| Title |
|---|
| Large-scale SNP analysis reveals clustered and continuous patterns of human genetic variation;Mark D. Shriver, et al.;《HUMAN GENOMICS》;20050630;第2卷(第2期);81-89 * |
| PON 基因簇潜在功能多态位点与冠心病的关联研究;王晓玲等;《遗传学报》;20050731;第32卷(第7期);675-681 * |
| 冠心病全基因组关联研究进展;杨英等;《遗传》;20100228;第32卷(第2期);97-104 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102747076A (en) | 2012-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102757954B (en) | Combination of multiple genetic single nucleotide polymorphisms related to coronary heart disease and application of combination | |
| McCormick et al. | Molecular genetic testing for mitochondrial disease: from one generation to the next | |
| Lo | Non-invasive prenatal testing using massively parallel sequencing of maternal plasma DNA: from molecular karyotyping to fetal whole-genome sequencing | |
| CN102758010B (en) | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination | |
| CN105002286A (en) | Multiple single nucleotide polymorphic loca related to onset risks of hypertension and/or cardiovascular disease and associated application | |
| Seo et al. | Gene expression analysis of cardiovascular diseases: novel insights into biology and clinical applications | |
| IL194900A (en) | Hla alleles associated with adverse drug reactions and methods for detecting such | |
| CN104745710A (en) | SNP marker related to primary hepatocellular carcinoma auxiliary diagnosis and application of SNP marker | |
| CN104293952A (en) | Application of single nucleotide polymorphism rs10817758 in detection of a lepriasis susceptibility gene | |
| CN102747072B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof | |
| US7572576B2 (en) | Method of predicting genetic risk for hypertension | |
| CN109295229A (en) | Detection method is sequenced in the SNP fluorescence in situ hybridization of ABCB1 and SLCO1B1 | |
| CN102747076B (en) | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof | |
| CN102747073B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr2p24, and applications thereof | |
| Fu et al. | Haplotype-based case study of human CYP4A11 gene and cerebral infarction in Japanese subject | |
| Abboud et al. | Human platelet alloantigens HPA-1, HPA-2, and HPA-3 polymorphisms associated with extent of severe coronary artery disease | |
| CN106520987A (en) | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients | |
| CN102757955B (en) | Tag single nucleotide polymorphism at 12# chromosome susceptible area related to coronary heart disease, and haplotype and application of tag single nucleotide polymorphism | |
| Mani | Local ancestry association, admixture mapping, and ongoing challenges | |
| CN106520985A (en) | Application of single nucleotide polymorphism rs2178077 to screening of pemphigus foliaceus patients | |
| CN102747075B (en) | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes | |
| CN109439742A (en) | Nucleotide combination for Proton pump inhibitor metabolism and drug resistant gene SNP detection | |
| JP6788879B2 (en) | Peripheral artery disease test method and test reagent | |
| CN109182508A (en) | The fluorescence in situ hybridization sequencing approach of TCF7L2 gene mononucleotide polymorphism | |
| CN109295197A (en) | BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |