CN102747075B - Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes - Google Patents
Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes Download PDFInfo
- Publication number
- CN102747075B CN102747075B CN201210187897.4A CN201210187897A CN102747075B CN 102747075 B CN102747075 B CN 102747075B CN 201210187897 A CN201210187897 A CN 201210187897A CN 102747075 B CN102747075 B CN 102747075B
- Authority
- CN
- China
- Prior art keywords
- karyomit
- reagent
- site
- heart disease
- coronary heart
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of the sites and the haplotypes. The tagging single nucleotide polymorphism sites comprise sites of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 in a segment of a closely linked region in C6orf10-BTNL2 genes on a chromosome 6p21.32. The single nucleotides of the haplotype at the sites of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 are G, A, A, C, C and T respectively, A, G, G, T, T and C respectively, or A, A, A, C, C and T respectively. The tagging single nucleotide polymorphism sites and the haplotypes have important application prospects in the prevention and/or the diagnosis of the coronary heart disease.
Description
Technical field
The present invention relates to haplotype and the application of relevant to coronary heart disease No. 6 karyomit(e) susceptible region tagged single-nucleotide polymorphic locis and composition thereof, be specifically related to karyomit(e) 6p21.32 upper in the intergenic one section of close linkage region of C6orf10-BTNL2 the haplotype of a series of regions tagged single-nucleotide polymorphic loci, described mononucleotide polymorphism site composition and detection method thereof and for detection of the application in the ill risk of crowd's coronary heart disease.
Background technology
Atherosclerotic Cardio-Cerebrovascular Diseases has become the main health problem that world wide is paid close attention to.The World Health Organization (WHO) the report demonstration of 2004, the annual cardiovascular disorder in the whole world is taken the death toll Da Gaoda 1,720 ten thousand causing as the leading factor with coronary heart disease and cerebral apoplexy, account for 1/3rd of all death tolls.Estimate that this numeral of the year two thousand twenty will further increase by 50%, up to 2,500 ten thousand, cardiovascular disorder is global human " No.1 killer ".An extensive perspective study of carrying out in China also shows, heart disease has become the major causes of death of Chinese population, apportion man, women's cause of death the 2nd and the 1st.Annual new myocardial infarction 500,000 people of China, along with change and the relevant Hazard Factor of atherosclerosis of mode of life continue to increase, coronary heart disease and myocardial infarction morbidity yet will be lasting ascendant trend.
A large amount of research datas show, coronary heart disease is a kind of complex disease, be by multiple minor genes and environmental factors is long-term interact due to.Therefore identify the tumor susceptibility gene relevant to coronary heart disease or Disease-causing gene, in crowd, further the tumor susceptibility gene of screening increase disease risks is determined susceptible individual, will contribute to onset risk prediction, new drug development, diagnosis and the individualized treatment of coronary heart disease.From basis to clinical, people have carried out a large amount of research to this, and accumulating a large amount of knowledge aspect the Hazard Factor of coronary heart disease and the pathogenetic physiopathology of coronary disease, but the definite genetic molecule mechanism about coronary heart disease and myocardial infarction generation is but known little about it, for how to identify inheritance susceptible gene and to identify experimenter's coronary heart disease genetic predisposition, lack the effective recognition methods of comprehensive system always.
Summary of the invention
For the problems referred to above, an object of the present invention is to provide a kind of tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene; Another object of the present invention is to provide a kind of karyomit(e) 6p21.32 regional gene haplotype being made up of the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene, particularly provides a kind of karyomit(e) 6p21.32 regional gene being made up of the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene dangerous haplotype; Another object of the present invention is to provide a kind of method of the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene of the present invention; Another object of the present invention is to provide a kind of reagent of the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene in the application of preparing in preparation or the test kit that detects karyomit(e) 6p21.32 regional gene haplotype; Another object of the present invention is to provide a kind of method that detects karyomit(e) 6p21.32 regional gene haplotype; Another object of the present invention is to provide a kind of method of vitro detection coronary heart disease dependent genes; The application of the reagent that another object of the present invention is to provide a kind of tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene in preparation or the test kit for the preparation of vitro detection coronary heart disease dependent genes; Whether the reagent that another object of the present invention is to provide a kind of tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene contains the application in preparation or the test kit of the dangerous haplotype of karyomit(e) 6p21.32 regional gene in for the preparation of vitro detection testing sample; Another object of the present invention is to provide a kind of method that whether contains the dangerous haplotype of karyomit(e) 6p21.32 regional gene in vitro detection testing sample; Another object of the present invention is to provide a kind of vitro detection and predicts the application in individual dangerous preparation or test kit of suffering from coronary heart disease to be measured from the reagent of the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene in the sample of individuality to be measured in preparation; Another object of the present invention is to provide a kind of external prediction individual dangerous method of suffering from coronary heart disease to be measured; Another object of the present invention is to provide a kind of test kit of polymorphism of the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene.
First, the invention provides tagged single-nucleotide polymorphic loci (the tagging SNPs of karyomit(e) 6p21.32 regional gene, tSNPs), this site is respectively mononucleotide site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and the rs2076529 of karyomit(e) 6p21.32 regional gene.Above-mentioned pleomorphism site is to draw on the basis of great many of experiments.In the specific embodiment of the present invention, first use full genome chip (Affymetrix Axiom
tMgenome-Wide CHB 1Array Plate) chip carries out gene type to 1515 routine patients with coronary heart disease and 5019 routine normal peoples to SNP in full genome range, the data of utilizing chip to obtain, evaluate the incidence relation of genotype and phenotype, thus obtain may and coronary heart disease between there is potential associated chromosomal region; Secondly select the representational site of corresponding chromosomal region to use Fludigm@EP1
tMgENETIC ANALYSIS system, Taqman MGB probe method is carried out gene type experiment, further in 15460 routine patients with coronary heart disease and 11472 routine check samples, verifies.In data analysis, use linkage disequilibrium (Linkage disequilibrium, the LD) situation between Haploview computed in software chromosomal region site, use r
2represent (0-1), build relatively its haplotype difference between patient and normal control of haplotype (haplotype), the Susceptible population of checking definite coronary heart disease simultaneously.Use logistic regression analysis to assess the relation of each SNP site and coronary heart disease, the credibility interval of calculating dangerous allelic relative risk (Odds ratio, OR) and 95%.In the present invention, analyze first and draw by lot of experiments, (it is interregional that more particularly this region is positioned at the upper 32368kb～32520kb of karyomit(e) 6p21.32 above in the intergenic one section of close linkage region of C6orf10-BTNL2 to be positioned at karyomit(e) 6p21.32, Data Source: human genome database (Human, build36) series of SN-striking P site (rs9268402, rs442406, rs9268473, rs3817973, rs2076533, rs2076529, particularly rs9268402) and coronary disease susceptibility significant correlation, on abundant experimental results of the present invention basis, these SNPs can be used as the tag SNPs of karyomit(e) 6p21.32 regional gene, for research karyomit(e) 6p21.32 regional gene function provides new method, ensureing under the prerequisite of research power of a test, can effectively reduce research link, reduce research cost.
On abundant experimental results of the present invention basis, further research of the present invention is found, this a series of SNPs site and coronary disease susceptibility significant correlation, in table 1, the dangerous allelotrope of these SNPs respectively: rs9268402 pleomorphism site is G, and rs442406 pleomorphism site is A, rs9268473 pleomorphism site is A, rs3817973 pleomorphism site is C, and rs2076533 pleomorphism site is C, and rs2076529 pleomorphism site is T.Carrying these dangerous allelic individual relative risks that coronary heart disease occur and being does not have carrier's 1.14-1.17 doubly.Wherein karyomit(e) rs9268402 pleomorphism site G allelotrope carrier's incidence of coronary heart disease risk is the allelic carrier of A 1.17 times (OR=1.17,95%CI:1.07-1.27), and risk is the highest.Rs9268402 polymorphic site and rs442406, rs9268473, rs3817973, rs2076533, rs2076529 pleomorphism site have strong linkage disequilibrium (r
2> 0.7).Result of study of the present invention further confirmed Chr6p21.32 region polymorphic site and coronary heart disease closely related.
On the basis of above-mentioned Tag SNP, the present invention conducts in-depth research the haplotype being made up of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 again.Found that: built 3 kinds of haplotype: GAACCT, AGGTTC and AAACCT by Chr6p21.32 region rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529, wherein haplotype GAACCT and AGGTTC are the most common in crowd, frequency is respectively 0.597 and 0.331, these two haplotypes are associated with the susceptibility of coronary heart disease, and its frequency exists significant difference between patients with coronary heart disease and normal controls.Coronary heart disease risk haplotype (dangerous haplotype) is GAACCT, and the frequency in coronary heart disease case is 0.626, the significant frequency 0.589 higher than control group.
Thereby, on the one hand, the invention provides the karyomit(e) 6p21.32 regional gene haplotype being made up of tagged single-nucleotide polymorphic loci of the present invention, this haplotype is respectively G, A, A, C, C, T at the mononucleotide in rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site; A, G, G, T, T, C; Or A, A, A, C, C, T.Wherein, the haplotype that is respectively G, A, A, C, C, T at the mononucleotide in rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site is the dangerous haplotype of karyomit(e) 6p21.32 regional gene, the present invention has illustrated this problem by a large amount of definite experimental results, after proofreading and correct age, BMI, hypertension, smoking, drinking, the danger of carrying the individuality trouble coronary heart disease of this haplotype significantly raises than the danger of the individuality trouble coronary heart disease of carrying other haplotypes.
On the other hand, the invention provides a kind of method of the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene of the present invention.Available multiple technologies known in the art detect the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene of the present invention at DNA level, rna level.For example:
Can adopt the method for direct Sequencing, can directly disclose crt gene and carry the sequence difference between mutator gene by DNA direct Sequencing, can be specifically that traditional use business sequencing kit or automatic sequencer directly checks order to DNA, or the tetra-sodium of development in recent years order-checking (Pyrosequencing), micrometering order (SNaPshot) etc.Tetra-sodium sequencing technologies is suitable for the sequencing analysis to known short sequence, after its principle is primer and template DNA annealing, under the synergy of archaeal dna polymerase (DNA polymerase), ATP sulfurylase (ATP sulfurytase), luciferase (1uciferase) and 4 kinds of enzymes of apyrase (Apyrase), the release coupling of the polymerization of each dNTP on primer and first order fluorescence signal is got up, by detecting release and the intensity of fluorescence, reach the object of the real time measure DNA sequence dna.SnaPshot technology platform is Applied Biosystems, ABI company has released and has aimed at the analysis software and the test kit that detect SNP design, can carry out gene type to multiple SNP site simultaneously, be also referred to as minisequencing, after the primer SNaPshot reaction of the method for different mutational site design different lengthss, product is analyzed by electrophoretic separation, multicolored fluoroscopic examination, Gene mapper, can in a running gel, detect multiple SNP site.
Also can adopt the method based on hybridization, specifically comprise Taqman probe method, DNA chip method etc.TaqMan SNP gene type principle: utilize exonuclease to produce lasting inspection signal to the excision of 5 ' unique allele dye marker, reaction system comprises: taking genomic dna or PCR product as template; One couple of PCR primers, and use respectively two types of 2 MGB probe in detecting SNP of FAM and VIC mark; Read somatotype data at PCR reaction end.DNA chip technology: testing gene is after extracting, be cut into fragment different in size, after fluorescence chemical material mark, be expelled on the slide glass that is embedded with chip, because the degree of DNA and probe hybridization is relevant to fluorescence intensity, therefore by laser scanning, can measure according to fluorescence power the variation of detected sequence.
Can also adopt the method based on primer extension, as ground substance assistant laser is resolved ion flight time mass spectrum (MALDI-Tof-MS).Ground substance assistant laser is resolved ion flight time mass spectrum and is detected principle: one section of probe of adjacent SNP site design, in reaction system, substitute dNTP with ddNTP, make probe only extend a base in SNP site stops, according to the difference in SNP site, probe is in connection with different ddNTP, thereby have different molecular weight, mass spectrograph can detect this molecular weight difference, thereby realize the object of SNP somatotype.
Can also adopt the method based on conformation, concrete example is as restriction fragment length polymorphism (RFLP) is analyzed, single strand conformation polymorphism (single-strand conformational polymorphism, SSCP) analysis, denaturing gradient gel electrophoresis (denaturing gradient gel electrophoresis, DGGE) analytical technology such as analysis, sex change high-efficient liquid phase chromatogram technology (denaturing high performance liquid chromatography, dHPLC).Wherein, the principle of RFLP: some SNP polymorphic site is the recognition site place in restriction enzyme just in time, wherein a kind of pcr amplification segment of polymorphic correspondence can be cut by corresponding restriction endonuclease, and another kind can not, therefore analyze the genotype of known detection sample in this site by the fragment length after the PCR product electrophoresis after enzyme is cut; There is not suitable restriction enzyme site if detect SNP site, often can introduce restriction enzyme digestion sites by changing indivedual bases at PCR primer 3 ' end, can realize the somatotype in most SNP site by this Modify to primer method and can realize with rflp analysis.SSCP: under the condition of non-sex change, single stranded DNA has certain pleated sheet structure, this pleated sheet structure is to be determined by its nucleotide sequence, the susceptibility of SSCP depends on SNP to folding impact and the folding electrophoretic mobility that how to affect aim sequence, its strategy is, the fragment to be measured of pcr amplification is mixed with deionized formamide, and then 95 DEG C of sex change are unwind, be quenched to again in ice, then separate by native polyacrylamide gel electrophoresis; Under stable ideal conditions, the result that gel electrophoresis separates is that heterozygote comprises two very near bands of separation in a certain position range, and normal DNA fragmentation occupy a wherein band, and the DNA fragmentation of homozygous mutation SNP occupy another band.DGGE: utilize double chain DNA molecule when electrophoresis, can issue first portion in certain denaturing agent concentration and unwind in the gel of certain gradient sex change agent concentration, cause electrophoretic mobility to decline; Even if there is respectively the difference of only having a base pair between a kind of two kinds of DNA moleculars of SNP allelotype, also can divide and unwind in different time generating unit, thereby be separated into two bands.DHPLC: this technology is the mutating technology of a detection SNP who grows up on SSCP and DGGE basis, this technology is by mixed to unknown DNA fragmentation and wild-type DNA, after heat denatured, make again its cooling reannealing, if there is the DNA of sudden change, the duplex that now formed has two kinds, be homologous duplex and allos duplex, based on the difference of homologous duplex and allos duplex melting temperature(Tm), by controlling the temperature of DHPLC, it is maintained and approach operation under DNA molecular Tm value, then carry out wash-out, less DNA molecular and the avidity of post are less, just more easily elute, DNA after PCR expands, because the existence of base mismatch forms heteroduplex because single stranded DNA with charge ratio double-stranded few, be first eluted, and separate with normal pairing two strands, finally determine having of SNP or nothing according to the peak type of chromatographic peak or number.
Can also adopt high resolving power solubility curve analytical technology (HRM).This analytical technology is according in certain temperature range, the product of pcr amplification being carried out to sex change, during this time fluorescent signal in real-time detection system.Fluorescent value, along with temperature variation, can be drawn solubility curve.Every section of DNA has its unique sequence, thereby has also just had unique melting curve shape, as DNA fingerprinting, has very high specificity, stability and repeatability.Accurately distinguish wild-type homozygote, heterozygote and mutagenicity homozygote according to curve.
In the specific implementation, those skilled in the art can select according to practical situation the tagged single-nucleotide polymorphic loci of above-mentioned any technology vitro detection karyomit(e) 6p21.32 of the present invention regional gene.Also can adopt the combination of multiple technologies to come the mutational site of vitro detection karyomit(e) 6p21.32 regional gene sequence.For example, after restriction fragment length polymorphism analytical procedure is combined with PCR, detection sensitivity and specificity are higher.In the time that direct sequencing is combined with PCR, detection sensitivity improves greatly.In a specific embodiment of the present invention, application be Taqman MGB method, use be Fludigm@EP1
tMgENETIC ANALYSIS system platform, because this platform is the gene type platform that belongs to higher flux, in the time that sample number is 96 sites of 96 pattern detection (using 96.96 dynamic chips) or 48 sites of 48 pattern detection (using 48.48 dynamic chips), there is economical and efficient.And in the time being applied to the analyzing and testing of a small amount of testing sample specific to the solution of the present invention, adopt Fludigm@EP1
tMgENETIC ANALYSISsystem platform does not just possess the advantage in economy and efficiency, now can adopt real-time fluorescence quantitative PCR system, as the 7900HT of AppliedBiosystems (Fast) real time PCR system, 7500real time PCR system etc., application Taqman-MGB probe method is carried out gene type to Single locus; Also can apply other methods of genotyping such as PCR-RFLP, HRM.
On the basis of the method for the tagged single-nucleotide polymorphic loci of above-mentioned detection karyomit(e) 6p21.32 of the present invention regional gene, the reagent that the present invention also provides mononucleotide polymorphism site rs9268402, the rs442406, rs9268473, rs3817973, rs2076533 and/or the rs2076529 that detect karyomit(e) 6p21.32 regional gene detects the application in preparation or the test kit of karyomit(e) 6p21.32 regional gene haplotype in preparation.More specifically, the reagent of the mononucleotide polymorphism site of described detection karyomit(e) 6p21.32 regional gene can be: for the reagent of direct sequencing; Or the reagent of combine with restriction fragment length polymorphism analysis for polymerase chain reaction (PCR-RFLP); Or the reagent combining with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on method, the method based on primer extension, the method based on conformation or the high resolving power solubility curve analytical technology of hybridization.
On the other hand, the present invention also provides a kind of method of the dangerous haplotype that detects karyomit(e) 6p21.32 regional gene, and the method comprises the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene.
Detecting the method for any detection single nucleotide polymorphism that the method for the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene can be known in the art, for example, can be the above-mentioned direct sequencing of this specification sheets, the detection method such as method, the method based on primer extension, the method based on conformation or high resolving power solubility curve analytical technology based on hybridizing.In addition the method that, the present invention detects the dangerous haplotype of karyomit(e) 6p21.32 regional gene also can comprise the detected result of described tagged single-nucleotide polymorphic loci is carried out to statistical study.For example, in an embodiment of the invention, the method is utilized Haploview program, proofread and correct age, BMI, hypertension, smoking, drink after, result by tagged single-nucleotide polymorphic loci of the present invention is carried out to statistical study, especially the haplotype being made up of tagged single-nucleotide polymorphic loci of the present invention is carried out to statistical study, thereby drawn the dangerous haplotype of karyomit(e) 6p21.32 regional gene.
On the other hand, the present invention also provides a kind of method of vitro detection coronary heart disease dependent genes, and the method comprises the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene: rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529.The present invention is on the basis of great many of experiments and statistical study, choose the normal artificial research object of 16975 routine patients with coronary heart disease and 16491 examples, prove the relation of karyomit(e) 6p21.32 regional gene and coronary heart disease with definite experimental data, thereby coronary heart disease dependent genes is provided.
Thereby the present invention also provides the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene: the application of the reagent of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 in preparation or the test kit for the preparation of vitro detection coronary heart disease dependent genes.
The present invention also provides the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene: whether the reagent of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 contains the application in preparation or the test kit of the dangerous haplotype of karyomit(e) 6p21.32 regional gene in for the preparation of vitro detection testing sample, wherein, the dangerous haplotype of karyomit(e) 6p21.32 regional gene is G at the mononucleotide in rs9268402 site.Further, the dangerous haplotype of karyomit(e) 6p21.32 regional gene is respectively G, A, A, C, C, T at the mononucleotide in rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site.
On the other hand, the present invention also provides a kind of method that whether contains the dangerous haplotype of karyomit(e) 6p21.32 regional gene in vitro detection testing sample, and the method comprises:
1) DNA of extraction testing sample, the tagged single-nucleotide polymorphic loci for karyomit(e) 6p21.32 regional gene: rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 design primer carry out pcr amplification;
2) whole PCR products are analyzed;
3) mononucleotide polymorphic in qualification rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 site, whether the haplotype of its formation is: G-A-A-C-C-T, A-G-G-T-T-C or A-A-A-C-C-T.
On the other hand, the present invention also provides the tagged single-nucleotide polymorphic loci of a kind of vitro detection from karyomit(e) 6p21.32 regional gene in the sample of individuality to be measured: the application of the reagent of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 in preparation prediction individual dangerous preparation or test kit of suffering from coronary heart disease to be measured.From another angle, the present invention also provides a kind of external prediction the individual dangerous method of suffering from coronary heart disease to be measured, and the method comprises the tagged single-nucleotide polymorphic loci of vitro detection from karyomit(e) 6p21.32 regional gene in the sample of individuality to be measured: rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529.The danger of individuality individual or that carry haplotype G-A-A-C-C-T be made up of the mononucleotide of site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 suffers from coronary heart disease that wherein, to carry the mononucleotide in rs9268402 site be G significantly raises than the danger of the individuality trouble coronary heart disease of carrying the haplotype A-G-G-T-T-C that is made up of the mononucleotide of site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 or A-A-A-C-C-T.The testing sample that contains gene of the present invention can obtain from experimenter's cell, Tathagata autoblood, urine, saliva, gastric juice, hair, the cell of examination of living tissue and necrotomy material.Preferably carry out autoblood.Can first obtain from experimenter's cell the testing sample that contains gene of the present invention, then extract the DNA of gene according to ordinary method.Described individuality to be measured is preferably Chinese han population.The present invention is by a large amount of experiments, and after proofreading and correct age, BMI, hypertension, smoking, drinking, compared with haplotype A-G-G-T-T-C or A-A-A-C-C-T, the danger that the individuality that carries haplotype G-A-A-C-C-T is suffered from coronary heart disease significantly raises.On the basis of the statistical study of large sample of the present invention, can use separately method of the present invention, vitro detection is from the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene in the sample of individuality to be measured: rs9268402, rs442406, rs9268473, rs3817973, the haplotype that rs2076533 and rs2076529 form, with the external prediction individual danger of suffering from coronary heart disease to be measured, also can consider other environmental risk factors simultaneously, for example whether smoking, whether hypertension, whether diabetes, whether blood fat disorder and whether intentionally obstruct family history etc., to reach the external prediction individual object of suffering from risk of coronary heart disease to be measured.
On the other hand, the present invention also provides a kind of test kit of polymorphism of the tagged single-nucleotide polymorphic loci that detects karyomit(e) 6p21.32 regional gene, and test kit contains respectively:
1) primer in amplification rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 site;
2) pcr amplification enzyme and corresponding damping fluid;
3) measure rs9268402, rs442406, rs9268473, rs3817973, the polymorphic reagent of rs2076533 and/or rs2076529 site.
In described test kit, one or more containers can be housed, in-built one or more components that have in order to detect the karyomit(e) 6p21.32 regional gene that contains described pleomorphism site of container.According to the difference of concrete detection method and detection pleomorphism site, test kit can contain different components.What provide with it can be through medication management mechanism of government examination & verification, about medicine or biological products manufacture, the information that uses and sell simultaneously.Those of ordinary skill in the art are known, the primer of described pleomorphism site increases, can be according to the known nucleotide sequence design of the present invention, be generally 15-30 base, GC content is 45%-50% left and right, at suitable temperature, be combined with template specificity, it can utilize special computer programming, for example (Oligo 6.53 softwares).The enzyme of pcr amplification can be TaqDNA polysaccharase, Tth archaeal dna polymerase, and VENT archaeal dna polymerase etc. can be used in the enzyme of pcr amplification.The reagent that detects described polymorphism in test kit is according to the difference of detection method and difference.For example, adopt Taqman detecting probe method, in test kit, can contain the taqman-MGB probe for detection of special SNP site; Adopt MALDI-TOF-MS method, can be containing the single-basic extension primer for detection of special SNP site in test kit; While adopting polymerase chain reaction to detect described pleomorphism site with the restriction fragment length polymorphism analysis method of combining, in test kit, can contain restriction enzyme and corresponding restriction enzyme mapping.The test kit of the polymorphism of the tagged single-nucleotide polymorphic loci of described detection karyomit(e) 6p21.32 regional gene can be for vitro detection coronary heart disease dependent genes, and the vitro detection individual danger of suffering from coronary heart disease to be measured.
In sum, the present invention has found karyomit(e) 6p21.32 regional gene 6 important variant sites: rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and the rs2076529s relevant to coronary heart disease.The wherein particularly particular combinations in described 6 sites of rs9268402 site, has increased the individual risk of suffering from coronary heart disease greatly.This discovery has potential using value clinically: genotype identification is carried out in these 6 sites to karyomit(e) 6p21.32 regional gene, if find that certain individuality carries G-A-A-C-C-T haplotype, this individuality is compared with carrying the individuality of A-G-G-T-T-C or A-A-A-C-C-T haplotype, and the risk of suffering from coronary heart disease significantly raises.Accordingly, doctor can instruct this individuality to change bad life habits, reduces environmental factors bringing out disease.Visible, the haplotype of karyomit(e) 6p21.32 regional gene Tag SNP composition has important application prospect in the prediction and prevention of coronary heart disease.
Brief description of the drawings
Fig. 1 is the association diagram that shows SNP site, chr6p21.32 region and coronary heart disease.Wherein, X-coordinate is chromosome position, and ordinate zou is SNP site and the associated significance P value (log of coronary heart disease
10p), represent site rs9268402 with ◆ represent.
Fig. 2 uses Fludigm@EP1 in embodiment
tMgENETIC ANALYSIS system, when Taqman MGB probe method is carried out gene type experiment, carries out the application of sample process schematic diagram of Assay and Sample.
Fig. 3 shows that 96 samples (94 samples to be tested and 2 negative controls) represent site rs9268402 gene type result (dendrogram).Wherein, X-axis represents VIC fluorescence intensity, and Y-axis represents FAM fluorescence; Genotype result: 1, redness is A/A homozygote, 2, green is G/G homozygote, 3, blueness is A/G heterozygote, 4, the negative contrast of black (NTC).
Fig. 4 is the snapshot in using SNP Genotyping Analysis software version 3.0 softwares rs9268402 site while carrying out data analysis.
Fig. 5 is that 96 samples (wherein comprising two negative control NTC) rs9268402 gene type data derive result (part) sectional drawing.
Embodiment
In order more clearly to understand the present invention, further describe the present invention referring now to the following example and accompanying drawing.Embodiment does not only limit the present invention in any way for explanation.In embodiment, the experimental technique of unreceipted actual conditions is ordinary method and the normal condition that affiliated field is known, or the condition of advising according to manufacturers.
Selection and the detection of embodiment mono-chr6p21.32 gene label SNPs
One, case-control sample inclusion criteria
Coronary heart disease case comprises myocardial infarction patient and patient with angina pectoris.The selected Case definition of myocardial infarction case is Diagnosis of Acute Myocardial Infarction standard (according to the WHO Case definition of 1979): typical chest pain symptom continues more than 30 minutes; Continuous 2 ST-segments of electrocardiogram(ECG (limb leads 0.1mv, chest leads 0.2mv) also have serial dynamic change; The serum marker substrate concentration of myocardial necrosis raises, and as troponin (TNT/TNI) raises, myocardium isozyme (CK-MB) raises and is greater than 2 times of the high limit of normal value.The selected Case definition of stenocardia case exceedes 70% for finding that through coronary angiography at least one Main Branches of coronary artery is narrow.Valvular heart disease, congenital heart disease, heart failure, serious kidney and hepatic diseases, secondary hypertension, myocardosis, familial hypercholesterolemia and Suspected Coronary Heart Disease patient except every inspection.The case that meets above-mentioned diagnosis can enter anthology research.Control group inclusion criteria: previously without coronary heart disease or other Atheromatosis histories, without pectoralgia, the cardiac symptom such as uncomfortable in chest, electrocardiogram(ECG is without obvious ischemic change.Case group and control group are Chinese han population, and consanguinity-less relation.
Study population's essential characteristic: study population comprises the chip detection sample (comprising 1515 routine patients with coronary heart disease and 5019 example contrasts) in examination stage, essential characteristic is as following table:
Two, research experiment scheme
In Chinese han population, choose the normal artificial research object of 1515 routine patients with coronary heart disease and 5019 examples.Use full genome chip (Affymetrix Axiom
tMgenome-Wide CHB 1Array Plate) SNP in full genome range is carried out to gene type.The data of utilizing chip to obtain, evaluate the incidence relation of genotype and phenotype, thus obtain may and coronary heart disease between there is potential associated chromosomal region.In data analysis, use linkage disequilibrium (Linkage disequilibrium, the LD) situation between Haploview computed in software chromosomal region site, use r
2represent (0-1), build relatively its haplotype difference between patient and normal control of haplotype (haplotype), the Susceptible population of checking definite coronary heart disease simultaneously.Use logistic regression analysis to assess the relation of each SNP site and coronary heart disease, the credibility interval of calculating dangerous allelic relative risk (Odds ratio, OR) and 95%.
Chr6p21.32 region SNP site sequence
Three, experimental result
By each site strength of association (OR value) and the significance level (P value) of full genome association (GWAS) analytical calculation SNP chip, discovery be positioned at karyomit(e) 6p21.32 upper between C6orf10-BTNL2 gene (32368kb～32520kb is interregional) have a correlation signal (P value is less than 0.001) (see Fig. 1, provided the common 300K region all sites significance associated with coronary heart disease of rs9268402 upstream and downstream).Series of SN-striking P site (rs9268402, rs442406, rs9268473, rs3817973, rs2076533, rs2076529) and coronary disease susceptibility significant correlation in this section of close linkage region, in table 1.This series of SNP site and both wings correlated series thereof are as follows:
rs9268402：AAATCTTGAGAGGGATATGAACATCC[A/G]GATTGAAGACGATCAAAGCATCCCA(SEQIDNo.1)
rs4424066：ATGAAAGTGGACACACCATGACTGGA[A/G]ATACTATAGGACTTAATTTTAAGAA(SEQ IDNo.2)
rs9268473：CAAGAAAACTCCAAACAAGTTCATGG[A/G]TTTCTCATCTGTTTTCATGCTGAGT(SEQIDNo.3)
rs3817973：GTGGACTCTGACTAAAGAAGACTTGT[T/C]TTGTTCGCACACTAGGTACCTGTAA(SEQ IDNo.4)
rs2076533：CATAGAATGATGTATAAAATGTTTTC[T/C]GAGTAACAAAGTGTCACACAATAAT(SEQIDNo.5)
rs2076529：TACCGTCTCATGTCTCCCTCCTGACA[T/C]GACCACTCACTGCGGTAACTGCTCC(SEQ IDNo.6)
The dangerous allelotrope in above-mentioned SNP site is respectively: rs9268402 pleomorphism site is G, rs442406 pleomorphism site is A, and rs9268473 pleomorphism site is A, and rs3817973 pleomorphism site is C, rs2076533 pleomorphism site is C, and rs2076529 pleomorphism site is T.Carrying these dangerous allelic individual relative risks that coronary heart disease occur and being does not have carrier's 1.14-1.17 doubly, in table 1.Wherein karyomit(e) rs9268402 pleomorphism site G allelotrope carrier's incidence of coronary heart disease risk is the allelic carrier of A 1.17 times (OR=1.17,95%CI:1.07-1.27), and risk is the highest.This region rs9268402 polymorphic site and rs442406, rs9268473, rs3817973, rs2076533, rs2076529 pleomorphism site has strong linkage disequilibrium (r
2> 0.7, in table 2).
By Chr6p21.32 region rs9268402, rs442406, rs9268473, rs3817973, rs2076533, rs2076529 has built 3 kinds of haplotypes, and wherein haplotype GAACCT and AGGTTC are the most common in crowd, and frequency is respectively 0.597 and 0.331.These two haplotypes are associated with the susceptibility of coronary heart disease, and its frequency exists significant difference (in table 3) between patients with coronary heart disease and normal controls.Coronary heart disease risk haplotype is GAACCT, and the frequency in coronary heart disease case is 0.626, the significant frequency 0.589 higher than control group.
The association results of table SNP site, 1.Chr6p21.32 region and coronary heart disease
Region: the chromosomal region band that represents this pleomorphism site place; Risk allele: risk allelotrope; Other allele: with reference to allelotrope; Gene frequency is risk gene frequency.OR (95%CI) represents compared with carrying the allelic individuality of reference, carries the allelic individual relative risk that coronary heart disease occurs of risk.
Table 2.Chr6p21.32 region rs9268402 and other SNP linkage disequilibrium relations (r
2)
| SNP polymorphic site | Region | Chromosome position | r 2 |
| rs9268402 | 6p21.32 | 32449331 | 1.00 |
| rs4424066 | 6p21.32 | 32462406 | 0.74 |
| rs9268473 | 6p21.32 | 32463661 | 0.74 |
| rs3817973 | 6p21.32 | 32469089 | 0.74 |
| rs2076533 | 6p21.32 | 32471505 | 0.74 |
| rs2076529 | 6p21.32 | 32471933 | 0.74 |
The association results of table 3.Chr6p21.32 region SNP haplotype and coronary heart disease
* haplotype is respectively by rs9268402, rs442406, rs9268473, rs3817973, rs2076533, rs2076529 composition.
The detection of embodiment bis-chr6p21.32 gene label SNPs
In the present embodiment, further in 15460 routine patients with coronary heart disease and 11472 routine check samples, detect for the representational site of the selected corresponding chromosomal region of embodiment mono-, conduct is to implementing the checking of a selected tag SNPs simultaneously.
One, case-control sample inclusion criteria
Case-control sample inclusion criteria is with embodiment mono-.Study population's multiple detection validation sample (comprising 15460 routine patients with coronary heart disease and 11472 example contrasts) of attaching most importance to, essential characteristic is as following table:
Two, detection method
The duplicate detection checking of the present embodiment is to use Fludigm@EPl
tMgENETIC ANALYSIS system, this system is the high-throughput gene type system of chip Fludigm company of U.S. exploitation, is made up of integrated fluid pipeline (IFC) chip, integrated fluid conduit controller (IFC controller), heat circulating system and fluorescent signal acquisition system (EP1reader); Adopt the conventional reagent of Taqman gene type, can carry out gene type to 96 SNP sites of 96 samples simultaneously; A kind of high-throughout open genetic analysis platform (Wang, J., Lin, M., Crenshaw, A., Hutchinson, A., Hicks, B., Yeager, M., Berndt, S., Huang, W., Hayes, R.B., Chanock, S.J., Jones, R.C., and Ramakrishnan, R.2009Nov 28.High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays.BMC Genomics).
Taqman MGB probe method is carried out gene type experiment, and this gene type experiment is specific as follows: instrument, material
Instrument: Fludigm@EP1
tMgENETIC ANALYSIS system reagent, sample:
Consumptive material:
| 96.96 gene typing chips | 96.96Dynamic Array(138X) |
| 96 hole PCR plates and disposable shrouding film | 96well plates and seal(one-off) |
Experimental technique
(1) operation steps:
1.Assay preparation: on 96 hole PCR plates, prepare Assay mix with reference to following table
| Component | (μ l) for each well volume |
| 40×Taqman Genotyping Probe | 1.25 |
| 2×Assay Loading Reagent | 2.5 |
| ROX(50×) | 0.25 |
| DNase/RNase-free water | 1.0 |
| Cumulative volume | 5.0 |
After adding, cover disposable shrouding film, on microwell plate vibrator, fully mix, centrifugal 30 seconds of 2500～3000rpm on Microplate centrifuge (500g centrifugal force left and right), is placed on ice.
2.sample preparation: in 96 orifice plate PCR, Sample mix is prepared in reference below form:
| Component | (μ l) for each well volume |
| Master Mix(2×) | 3 |
| 20×GT Sample Loading Reagent | 0.3 |
| AmpliTaq Gold archaeal dna polymerase | 0.06 |
| Genomic DNA | 2.52 |
| DNase/RNase-free water | 0.12 |
| Cumulative volume | 6.0 |
After adding, cover disposable shrouding film, on microwell plate vibrator, fully mix, centrifugal about 30 seconds of 2500～3000rpm on Microplate centrifuge (500g centrifugal force left and right), is placed on ice.
3. application of sample and amplification procedure
Chip is in integrated fluid conduit controller HX after initialize, with reference to Fig. 2 application of sample.(the application of sample amount of Assay is 4.2 μ l/ holes, and the application of sample amount of Sample is 5.2 μ l/ holes).To add excellent chip and reappose in integrated fluid conduit controller HX, start " Load Mix (138X) " program, carry out separatory and mixing.
After said process completes, take out chip from integrated fluid conduit controller HX (in one hour) at once, remove pad pasting blue after chip, chip is placed in to heat circulating system (Stand alone Thermo Cycler), start Thermo Cycler PCR instrument, PROGTM96 program, carries out PCR process.After PCR finishes, turn off PCR instrument below vacuum pump (Vacuum Pump), open PCR instrument upper cover, take off chip.
(2) fluorescent signal data gathering: start fluorescent signal acquisition system (EPl reader),
dataCollection Software version 3 softwares, gather fluorescent signal data.
(3) gene data analysis mode and result output: by market demand SNP Genotyping Analysis software version 3.0 softwares that collect, carry out data analysis.Represent FAM fluorescence signal intensity with X-axis, Y-axis represents VIC fluorescence signal intensity, according to mononucleotide polymorphic site not two kinds of fluorescent signals of isoallele highly carry out relatively by force cluster, gene type result is with excel Output of for ms.Software parameter can designed, designed, as: represent VIC fluorescence signal intensity with X-axis, Y-axis represents FAM fluorescence signal intensity; Represent respectively XX, YY homozygote with red and green, blueness represents heterozygote, and black represents negative control (NTC).Gene type result is with excel Output of for ms.
Three, experimental result
The rs9268402 Genotyping dendrogram detecting is shown in Fig. 3.When using SNP Genotyping Analysis software version 3.0 softwares carry out data analysis, the screenshotss in rs9268402 site are referring to Fig. 4.96 samples (wherein comprising two negative control NTC) rs9268402 gene type data derive result (part) sectional drawing referring to Fig. 5.
In the present embodiment, 6p21.32 Regional Representative site rs9268402 further verifies in 15460 routine patients with coronary heart disease and 11472 routine check samples, remarkable associated (P=1.04 × 10 of rs9268402 and coronary heart disease
-12) in table 4, further merge all 16975 routine cases and associated more significantly (P=2.77 × 10 of 16491 check sample analyses demonstration rs9268402 with coronary heart disease
-15) (in table 5), this result further confirmed Chr6p21.32 region polymorphic site and coronary heart disease closely related.
The association results of table 4.Chr6p21.32 Regional Representative site rs9268402 in repeated authentication sample
HWE_P is the P value of HWE inspection.
The association results of table 5.Chr6p21.32 Regional Representative site rs9268402 in 16975 routine cases and 16491 routine check samples
Region: the chromosomal region band that represents this pleomorphism site place; Risk allele (Freq): represent risk allelotrope and gene frequency thereof.OR (95%CI) represents compared with carrying the allelic individuality of reference, carries the allelic individual relative risk that coronary heart disease occurs of risk.
By above-mentioned experimental study of the present invention, the analysis of the haplotype frequency difference between patient and normal people forming to described SNP site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and/or rs2076529 and by these SNP sites, can draw the variation of the concrete base in each site and consisting of haplotype difference and the relation of coronary disease susceptibility.As the crowd who belongs to one of following characteristics is the Susceptible population of coronary heart disease: in karyomit(e) 6p21.32 region, the intergenic rs9268402 pleomorphism site of C6orf10-BTNL2 is G, rs442406 pleomorphism site is A, rs9268473 pleomorphism site is A, rs3817973 pleomorphism site is C, rs2076533 pleomorphism site is C, rs2076529 pleomorphism site is T, and by the SNP site rs9268402 that is positioned at this gene region, rs442406, rs9268473, rs3817973, rs2076533, the individuality of the haplotype GAACCT of rs2076529 composition.
Judged the method for coronary heart disease Susceptible population by the variation property of the SNP site in mono-section of C6orf10-BTNL2 gene region of karyomit(e) 6p21.32 and the haplotype that formed by series of SN-striking P site according to the present invention, can be to there is not the crowd of coronary heart disease early clinic symptom, especially there is the coronary heart disease high risk population of conventional risk factors, carry out the examination fast and convenient without wound, early discovery coronary heart disease susceptible object, and take corresponding hygienic measures, reduce the sickness rate of coronary heart disease and myocardial infarction.This is an important use of the present invention.
Also can provide scientific basis for researching and developing coronary heart disease gene therapy targetedly according to the present invention.The present invention is further gene expression detection regulation and control, protein function, the mechanism of causing a disease of further investigation coronary heart disease, development of new medicine and gene therapy, important foundation has been established in the individuation diagnosis and treatment that realize based on genetic background, and brings important medical science health-benefiting and economic benefit.
Claims (8)
1. a karyomit(e) 6p21.32 regional gene haplotype, this haplotype is respectively G, A, A, C, C, T at the mononucleotide in rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site; A, G, G, T, T, C; Or A, A, A, C, C, T.
2. haplotype according to claim 1, wherein, described karyomit(e) 6p21.32 regional gene refers to and is positioned at the upper interregional gene of 32368kb～32520kb of karyomit(e) 6p21.32.
3. the reagent of mononucleotide polymorphism site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and a rs2076529 who detects karyomit(e) 6p21.32 regional gene detects the application in preparation or the test kit of the karyomit(e) 6p21.32 regional gene haplotype that Chinese han population is relevant to coronary heart disease in preparation; The reagent of mononucleotide polymorphism site rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and the rs2076529 of wherein said detection karyomit(e) 6p21.32 regional gene is: for the reagent of direct sequencing; Or the reagent combining with restriction fragment length polymorphism analysis for polymerase chain reaction; Or the reagent combining with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on method, the method based on primer extension, the method based on conformation or the high resolving power solubility curve analytical technology of hybridization.
4. detect the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene: the application of the reagent of rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 in the preparation or the test kit that whether contain the dangerous haplotype of the karyomit(e) 6p21.32 regional gene relevant to coronary heart disease for the preparation of vitro detection in from the testing sample of Chinese han population, wherein
The dangerous haplotype of karyomit(e) 6p21.32 regional gene is respectively G, A, A, C, C, T at the mononucleotide in rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site;
The reagent of the mononucleotide polymorphism site of the karyomit(e) 6p21.32 regional gene that wherein said detection is relevant to coronary heart disease is: for the reagent of direct sequencing; Or the reagent combining with restriction fragment length polymorphism analysis for polymerase chain reaction; Or the reagent combining with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on method, the method based on primer extension, the method based on conformation or the high resolving power solubility curve analytical technology of hybridization.
5. vitro detection is from the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene in the sample of Chinese han population individuality to be measured: rs9268402, rs442406, rs9268473, rs3817973, the application of the reagent of rs2076533 and rs2076529 in preparation prediction individual dangerous preparation or test kit of suffering from coronary heart disease to be measured, wherein, it is individual or carry by site rs9268402 that the mononucleotide that carries rs9268402 site is G, rs442406, rs9268473, rs3817973, the danger ratio that the individuality of the haplotype G-A-A-C-C-T of the mononucleotide composition of rs2076533 and rs2076529 is suffered from coronary heart disease carries by site rs9268402, rs442406, rs9268473, rs3817973, the danger that the haplotype A-G-G-T-T-C of mononucleotide composition of rs2076533 and rs2076529 or the individuality of A-A-A-C-C-T are suffered from coronary heart disease significantly raises,
The reagent of the mononucleotide polymorphism site of the karyomit(e) 6p21.32 regional gene that wherein said detection is relevant to coronary heart disease is: for the reagent of direct sequencing; Or the reagent combining with restriction fragment length polymorphism analysis for polymerase chain reaction; Or the reagent combining with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on method, the method based on primer extension, the method based on conformation or the high resolving power solubility curve analytical technology of hybridization.
6. according to the application described in claim 4 or 5, wherein said testing sample comes autoblood, urine, saliva, gastric juice, hair, examination of living tissue.
7. according to the application described in claim 4 or 5, wherein said testing sample is from necrotomy material.
8. a test kit that detects the polymorphism of the tagged single-nucleotide polymorphic loci of karyomit(e) 6p21.32 regional gene, this test kit contains respectively:
1) primer in amplification rs9268402, rs442406, rs9268473, rs3817973, rs2076533 and rs2076529 site;
2) pcr amplification enzyme and corresponding damping fluid;
3) measure rs9268402, rs442406, rs9268473, rs3817973, the polymorphic reagent of rs2076533 and rs2076529 site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210187897.4A CN102747075B (en) | 2012-06-07 | 2012-06-07 | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210187897.4A CN102747075B (en) | 2012-06-07 | 2012-06-07 | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102747075A CN102747075A (en) | 2012-10-24 |
| CN102747075B true CN102747075B (en) | 2014-07-23 |
Family
ID=47027566
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210187897.4A Active CN102747075B (en) | 2012-06-07 | 2012-06-07 | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747075B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112820349B (en) * | 2020-12-31 | 2023-05-23 | 融智生物科技（青岛）有限公司 | Single nucleotide polymorphism genotyping method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998040517A1 (en) * | 1997-03-10 | 1998-09-17 | Medical Science Systems, Inc. | Prediction of coronary artery disease |
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
-
2012
- 2012-06-07 CN CN201210187897.4A patent/CN102747075B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998040517A1 (en) * | 1997-03-10 | 1998-09-17 | Medical Science Systems, Inc. | Prediction of coronary artery disease |
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genome-wide association study in Han Chinese identifies four new susceptibility loci for coronary artery disease;Xiangfeng Lu et al.;《Nature Genetics》;20120701;第44卷(第8期);890–894 * |
| Xiangfeng Lu et al..Genome-wide association study in Han Chinese identifies four new susceptibility loci for coronary artery disease.《Nature Genetics》.2012,第44卷(第8期), |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102747075A (en) | 2012-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102757954B (en) | Combination of multiple genetic single nucleotide polymorphisms related to coronary heart disease and application of combination | |
| CN102758010B (en) | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination | |
| Abel et al. | Genome-wide SNP association: identification of susceptibility alleles for osteoarthritis | |
| CN106399479A (en) | SNP typing kit used for detecting susceptibility genes of type-II diabetes | |
| CN109295229A (en) | Detection method is sequenced in the SNP fluorescence in situ hybridization of ABCB1 and SLCO1B1 | |
| CN103642921B (en) | Selection, detection and application of catalase gene tagging single nucleotide polymorphic sites | |
| CN102747075B (en) | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes | |
| CN102757955B (en) | Tag single nucleotide polymorphism at 12# chromosome susceptible area related to coronary heart disease, and haplotype and application of tag single nucleotide polymorphism | |
| CN106520987A (en) | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients | |
| CN102747072B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof | |
| Hua et al. | Relationship between the regulatory region polymorphism of human tissue kallikrein gene and essential hypertension | |
| US20160053333A1 (en) | Novel Haplotype Tagging Single Nucleotide Polymorphisms and Use of Same to Predict Childhood Lymphoblastic Leukemia | |
| US10731219B1 (en) | Method for preventing progression to metabolic syndrome | |
| CN109439742A (en) | Nucleotide combination for Proton pump inhibitor metabolism and drug resistant gene SNP detection | |
| CN102747076B (en) | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof | |
| CN102747073B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr2p24, and applications thereof | |
| CN109182508A (en) | The fluorescence in situ hybridization sequencing approach of TCF7L2 gene mononucleotide polymorphism | |
| JP2006254735A (en) | Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes | |
| CN112080559B (en) | Application of SNP locus of PPP1CB gene in preparation of product for detecting susceptibility to psoriasis vulgaris | |
| CN109295171A (en) | The nucleic acid molecule combination and application of detection SNP are sequenced for fluorescence in situ hybridization | |
| CN1847257A (en) | Mononucleotide polymorphism related to hypertrophic degree of central muscle of hypertrophic cardiomyopathy and its use | |
| JP2006254739A (en) | Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes | |
| CN109182460A (en) | Fluorescence in situ hybridization sequencing approach and the application in the detection of TPMT gene SNP | |
| CN109266730A (en) | The method of fluorescence in situ hybridization sequencing detection ALDH2 gene mononucleotide polymorphism | |
| CN109337984A (en) | Nucleic acid molecule combination for fluorouracil metabolism related gene SNP detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |