CN102758010B - Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination - Google Patents
Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination Download PDFInfo
- Publication number
- CN102758010B CN102758010B CN2012101893902A CN201210189390A CN102758010B CN 102758010 B CN102758010 B CN 102758010B CN 2012101893902 A CN2012101893902 A CN 2012101893902A CN 201210189390 A CN201210189390 A CN 201210189390A CN 102758010 B CN102758010 B CN 102758010B
- Authority
- CN
- China
- Prior art keywords
- heart disease
- coronary heart
- measured
- risk
- allelotrope
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a combination of multiple genetic single nucleotide polymorphisms and environmental factors related to a coronary heart disease and application of the combination. The genetic single nucleotide polymorphisms comprise the following locus: rs2123536, rs18422896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280; and the environmental factors comprise individual smoking, drinking and body mass index information, and blood gloucose and high density lipoprotein cholesterol value in venous blood. Based on the combination factors, a prediction model for individual level coronary heart disease is established, and the combination of the multiple genetic single nucleotide polymorphisms and the environmental factors related to the coronary heart disease has an important application prospect in assessing the coronary heart disease risk for people.
Description
Technical field
The present invention relates to a plurality of gene mononucleotide polymorphisms site relevant to coronary heart disease and environmental factors combination and application thereof, the combination that inherited genetic factors and the individual environmental exposure factor to be measured that is specifically related to comprise the mononucleotide polymorphism site of rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 comprise smoking, drink etc., and based on the application of such blocking factor in the ill risk of assessment crowd's coronary heart disease.
Background technology
Atherosclerotic Cardio-Cerebrovascular Diseases has become the main health problem that world wide is paid close attention to.The World Health Organization of 2004 (WHO) report demonstration, the annual cardiovascular disorder in the whole world is taken the death toll Da Gaoda 1,720 ten thousand caused as the leading factor with coronary heart disease and cerebral apoplexy, account for 1/3rd of all death tolls.Estimate that this numeral of the year two thousand twenty will further increase by 50%, up to 2,500 ten thousand, cardiovascular disorder is global human " No.1 killer ".An extensive perspective study of carrying out in China also shows, heart disease has become the major causes of death of Chinese population, apportion man, women's cause of death the 2nd and the 1st.Annual new myocardial infarction 500,000 people of China, the Hazard Factor of being correlated with along with change and the atherosclerosis of mode of life continue to increase, and coronary heart disease and myocardial infarction morbidity yet will be lasting ascendant trend.
Current confirmed coronary heart disease environmental risk factors comprises: smoking, drink, obesity and hyperlipemia etc.A large amount of research datas show, coronary heart disease is a kind of complex disease, be by a plurality of minor genes and environmental factors is long-term interact due to.Therefore identify the tumor susceptibility gene relevant to coronary heart disease or Disease-causing gene and combine with environmental risk factors, further the tumor susceptibility gene of screening increase disease risks is determined susceptible individual in the crowd, will help onset risk prediction, new drug development, diagnosis and the individualized treatment of coronary heart disease.From basis to clinical, people have carried out a large amount of research to this, and accumulating a large amount of knowledge aspect the Hazard Factor of coronary heart disease and the pathogenetic physiopathology of coronary disease, but the definite genetic molecule mechanism about coronary heart disease and myocardial infarction generation is but known little about it, for how to identify inheritance susceptible gene and the coronary heart disease genetic predisposition of identifying the experimenter, lack the effective recognition methods of comprehensive system always.
EARLY RECOGNITION coronary heart disease high risk population, take mode of life intervention targetedly, be to reduce coronary heart disease to occur, thereby the containment medical expense increases, extends the key of life expectancy.At present, everybody generally believes that in individual level, adopting the individual conventional risk factors level of model method utilization is identification coronary heart disease high risk population's effective ways.Risk prediction is for disease prevention, government decision and health program scheme effect assessment, simultaneously also can for clinical treatment provide can reference information.The biological study that is integrated into mankind's complex disease or proterties of full genomics technology and epidemiological method has brought brand-new visual angle.The individual risk assessment is an important component part of its clinical decision, if take accordingly more morning or stronger intervening measure, the patient likely benefits from it.Find at present, the genetic predisposition locus that coronary heart disease is relevant can be to incidence of coronary heart disease risk performance independent effect, the effect of these heritable variations in the disease risks prediction of therefore should reappraising.Effectively to improve the ability of disease risks prediction, thereby on the basis of conventional risk factors, further strengthen the understanding to disease risks.
Summary of the invention
For the problems referred to above, an object of the present invention is to provide the combination of a kind of a plurality of gene mononucleotide polymorphisms site and environmental factors; Another object of the present invention is to provide the application of described a plurality of gene mononucleotide polymorphisms site and environmental factors combination, specifically its application in the proofing unit of the individual trouble coronary heart disease risk to be measured for the preparation of assessment; Another object of the present invention is to provide a kind of method that detects a plurality of gene mononucleotide polymorphisms site of the present invention and environmental factors; Another object of the present invention is to provide the method for the relevant a plurality of gene mononucleotide polymorphisms site of a kind of vitro detection coronary heart disease and environmental factors; Another object of the present invention is to provide a kind of application of agent combination in the preparation for the preparation of the vitro detection risk factors of coronary heart disease, test kit or proofing unit or model that detects a plurality of gene mononucleotide polymorphisms site of the present invention and environmental factors; The agent combination that another object of the present invention is to provide a plurality of gene mononucleotide polymorphisms site and environmental factors in the sample of a kind of vitro detection from individuality to be measured is in preparation, test kit or the proofing unit of the preparation prediction individual danger of suffering from coronary heart disease to be measured or the application in model; Another object of the present invention is to provide a kind of external prediction individual method of suffering from the danger of coronary heart disease to be measured.
Another object of the present invention is to provide a kind of for assessment of individual proofing unit of suffering from coronary heart disease risk to be measured, according to gene pleiomorphism and the individual incidence of coronary heart disease risk of the Environmental Factor Prediction, can be good at identifying the high risk population of coronary heart disease, thereby intervene targetedly, reach and delay and prevent the pathogenetic purpose of coronary disease.
At first, the invention provides a kind of a plurality of gene mononucleotide polymorphisms site and environmental factors combination, wherein, described a plurality of gene mononucleotide polymorphisms site comprises following site: rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280; Described environmental factors comprises individual smoking, drinks, blood glucose value and high density lipoprotein cholesterol value in weight index information and venous blood.
In the present invention, described a plurality of gene mononucleotide polymorphisms site: rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280, and described environmental factors: whether smoking of individuality, whether drink, the information such as blood glucose value and high density lipoprotein cholesterol value in weight index information and venous blood, be to draw on the basis of great many of experiments.In the specific embodiment of the present invention, utilize Fludigm@EP1
TMGENETIC ANALYSIS system, Taqman MGB probe method is carried out the gene type experiment to 7012 routine patients with coronary heart disease and 8579 routine check samples, data are carried out to the lot of experiments analysis, draw first above-mentioned 9 SNP site (rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280) and the coronary disease susceptibility significant correlation, and proposition environmental factors: whether smoking of individuality, whether drink, the dependency of the information such as blood glucose value and high density lipoprotein cholesterol value and coronary disease susceptibility in weight index information and venous blood.
On abundant experimental results of the present invention basis, further research discovery of the present invention, the dangerous allelotrope of these SNPs is respectively: the rs2123536 pleomorphism site is that T, rs1842896 pleomorphism site are that T, rs9349379 pleomorphism site are that G, rs9268402 pleomorphism site are that G, rs12524865 pleomorphism site are that C, rs10757274 pleomorphism site are that G, rs1333042 pleomorphism site are that G, rs7136259 pleomorphism site are that T, rs11066280 pleomorphism site are A.The relative risk of carrying these dangerous allelic individual coronary heart diseases is there is no 1.13 to 1.36 times of carrier.On the other hand, in described environmental factors, individual smoking, drink, blood glucose value is all relevant to coronary disease susceptibility with high density lipoprotein cholesterol value etc. in weight index information and venous blood.
Thereby, on the one hand, the invention provides a kind of method that detects a plurality of mononucleotide polymorphism site of the present invention and environmental factors.Wherein, detect that described environmental factors comprises individual smoking, drinks, the method for blood glucose value and high density lipoprotein cholesterol value is all the ordinary methods in affiliated field in weight index information and venous blood, the present invention repeats no more.Detect a plurality of mononucleotide polymorphism site of the present invention also available multiple technologies known in the art at DNA level, rna level, detect a plurality of mononucleotide polymorphism sites of the present invention.For example:
Can adopt the method for direct Sequencing, by the DNA direct Sequencing, can directly disclose crt gene and carry the sequence difference between mutator gene, can be specifically that traditional use business sequencing kit or automatic sequencer directly checks order to DNA, or the tetra-sodium of development in recent years order-checking (Pyrosequencing), micrometering order (SNaPshot) etc.The tetra-sodium sequencing technologies is suitable for the sequencing analysis to known short sequence, after its principle is primer and template DNA annealing, under the synergy of archaeal dna polymerase (DNA polymerase), ATP sulfurylase (ATP sulfurytase), luciferase (luciferase) and 4 kinds of enzymes of apyrase (Apyrase), the release coupling of the polymerization of each dNTP on primer and first order fluorescence signal is got up, by detecting release and the intensity of fluorescence, reach the purpose of the real time measure DNA sequence dna.The SnaPshot technology platform is Applied Biosystems, ABI company has released and has aimed at analysis software and the test kit that detects the SNP design, can carry out simultaneously gene type to a plurality of SNP site, be also referred to as minisequencing, after the primer SNaPshot reaction of the method for different mutational site design different lengthss, product is analyzed by electrophoretic separation, multicolored fluoroscopic examination, Gene mapper, can in a running gel, detect a plurality of SNP site.
Also can adopt the method based on hybridization, specifically comprise the Taqman probe method, DNA chip method etc.TaqMan SNP gene type principle: utilize exonuclease the excision of 5 ' unique allele dye marker to be produced to the check signal continued, reaction system comprises: take genomic dna or PCR product is template; One couple of PCR primers, and two types of 2 MGB probe in detecting SNP of using respectively FAM and VIC mark; At the PCR reaction end, read the somatotype data.The DNA chip technology: testing gene is after extracting, be cut into fragment different in size, after fluorescence chemical material mark, be expelled on the slide glass that is embedded with chip, because the degree of DNA and probe hybridization is relevant to fluorescence intensity, therefore by laser scanning, can measure according to the fluorescence power variation of detected sequence.
Can also adopt the method based on primer extension, resolve ion flight time mass spectrum (MALDI-Tof-MS) as ground substance assistant laser.Ground substance assistant laser is resolved the ion flight time mass spectrum and is detected principle: one section probe of adjacent SNP site design, in reaction system, substitute dNTP with ddNTP, making probe only in the SNP site, extend a base namely stops, difference according to the SNP site, probe is in connection with different ddNTP, thereby have different molecular weight, mass spectrograph can detect this molecular weight difference, thereby realize the purpose of SNP somatotype.
Can also adopt the method based on conformation, concrete example such as restriction fragment length polymorphism (RFLP) are analyzed, single strand conformation polymorphism (single-strand conformational polymorphism, SSCP) analysis, denaturing gradient gel electrophoresis (denauring gradient gel electrophoresis, DGGE) the analysis technology such as analysis, sex change high-efficient liquid phase chromatogram technology (denaturing high performance liquid chromatography, dHPLC).Wherein, the principle of RFLP: some SNP polymorphic site just in time is in the recognition site place of restriction enzyme, wherein a kind of pcr amplification segment of polymorphic correspondence can be cut by corresponding restriction endonuclease, and another kind can not, therefore by the fragment length after the PCR product electrophoresis after enzyme is cut, analyze the genotype of detection sample as can be known in this site; If detect the SNP site, there do not is suitable restriction enzyme site, often can introduce restriction enzyme digestion sites by PCR primer 3 ' end, changing indivedual bases, can realize that by this Modify to primer method the somatotype in most SNP site can be realized with rflp analysis.SSCP: under the condition of non-sex change, single stranded DNA has certain pleated sheet structure, this pleated sheet structure is to be determined by its nucleotide sequence, the susceptibility of SSCP depends on SNP to folding impact and the folding electrophoretic mobility that how to affect aim sequence, its strategy is, the fragment to be measured of pcr amplification is mixed with deionized formamide, and then 95 ℃ of sex change are unwind, be quenched to again in ice, then by native polyacrylamide gel electrophoresis, separate; Under stable ideal conditions, the result that gel electrophoresis separates is that heterozygote comprises two very near bands of separation in a certain position range, and normal DNA fragmentation occupy a wherein band, and the DNA fragmentation of homozygous mutation SNP occupy another band.DGGE: utilize double chain DNA molecule during electrophoresis, can issue first portion in certain denaturing agent concentration and unwind in the gel of certain gradient sex change agent concentration, cause electrophoretic mobility to descend; Even have respectively the difference of only having a base pair between a kind of two kinds of DNA moleculars of SNP allelotype, also can divide and unwind in the different time generating unit, thereby be separated into two bands.DHPLC: this technology is the mutating technology of a detection SNP who grows up on SSCP and DGGE basis, this technology is mixed by unknown DNA fragmentation and wild-type DNA, after heat denatured, make again its cooling reannealing, if the DNA of sudden change is arranged, now formed duplex has two kinds, be homologous duplex and allos duplex, difference based on homologous duplex and allos duplex melting temperature(Tm), by controlling the temperature of DHPLC, it is maintained near the lower operation of DNA molecular Tm value, then carry out wash-out, less DNA molecular and the avidity of post are less, just more easily elute, DNA after PCR expands, because the existence of base mismatch forms heteroduplex because single stranded DNA with charge ratio double-stranded few, first be eluted, and separate with normal pairing two strands, finally according to peak type or the number of chromatographic peak, determine having or nothing of SNP.
Can also adopt high resolving power solubility curve analytical technology (HRM).This analytical technology is according in certain temperature range, the product of pcr amplification being carried out to sex change, during fluorescent signal in detection system in real time.Fluorescent value, along with temperature variation, can be drawn solubility curve.Every section of DNA has its unique sequence, thereby unique melting curve shape has also just been arranged, and as DNA fingerprinting, has very high specificity, stability and repeatability.According to curve, accurately distinguish wild-type homozygote, heterozygote and mutagenicity homozygote.
In the specific implementation, those skilled in the art can select any above-mentioned technology vitro detection a plurality of gene label mononucleotide polymorphism sites of the present invention according to practical situation.Also can adopt the combination of multiple technologies to carry out the described a plurality of gene label mononucleotide polymorphism sites of vitro detection.For example, after PCR was combined, detection sensitivity and specificity were higher when the restriction fragment length polymorphism analytical procedure.When direct sequencing was combined with PCR, detection sensitivity improved greatly.In a specific embodiment of the present invention, application be Taqman MGB method, use be Fludigm
@EP1
TMGENETIC ANALYSIS system platform, it due to this platform, is the gene type platform that belongs to higher flux, when sample number is 96 sites of 96 pattern detection (using 96.96 dynamic chips) or 48 sites of 48 pattern detection (using 48.48 dynamic chips), has advantages of economical and efficient.And, when specific to the solution of the present invention, being applied to the analyzing and testing of a small amount of testing sample, adopt Fludigm
@EP1
TMGENETIC ANALYSIS system platform does not just possess the advantage on economy and efficiency, now can adopt the real-time fluorescence quantitative PCR system, as 7900HT (Fast) the real time PCR system of Applied Biosystems, 7500real time PCR system etc., application Taqman-MGB probe method is carried out gene type to Single locus; Also can apply other methods of genotyping such as PCR-RFLP, HRM.
In addition, the present invention also can further comprise the detected result of described a plurality of mononucleotide polymorphism sites is carried out to statistical study.For example, in an embodiment of the invention, result by tagged single-nucleotide polymorphic loci of the present invention is carried out to statistical study, and set up for assessment of individual model of suffering from coronary heart disease risk to be measured, and then provide a kind of for assessment of individual proofing unit of suffering from coronary heart disease risk to be measured.
According to provided by the present invention, comprise detecting unit and data analysis unit for assessment of individual proofing unit of suffering from coronary heart disease risk to be measured, wherein:
Described detecting unit is for detection of idiogenetics information to be measured and environmental factors, obtains detected result, wherein detect the genetic information situation and comprise the dangerous allelotrope situation that individuality to be measured carries described 9 mononucleotide polymorphism sites that detects, the dangerous allelotrope of described 9 mononucleotide polymorphism sites is respectively: the rs2123536 pleomorphism site is T, the rs1842896 pleomorphism site is T, the rs9349379 pleomorphism site is G, the rs9268402 pleomorphism site is G, the rs12524865 pleomorphism site is C, the rs10757274 pleomorphism site is G, the rs1333042 pleomorphism site is G, the rs7136259 pleomorphism site is T, the rs11066280 pleomorphism site is A, testing environment factor situation comprise detect whether smoking of individuality to be measured, whether drink, blood glucose value and high density lipoprotein cholesterol value in weight index information and venous blood,
Described data analysis unit is to carry out analyzing and processing for the detected result to detecting unit, comprising:
According to following formula, calculate individual coronary heart disease genetic risk factor scoring to be measured:
Genetic risk factor scoring=∑ log (OR
i) * N
i, OR wherein
iThe relative risk that refers to i mononucleotide polymorphism site, N
iThe dangerous allelotrope number that refers to entrained i the mononucleotide polymorphism site of individuality to be measured;
According to score value judgement individual packets to be measured, the 1st group of G1:0.115～1.200, the 2nd group of G2:1.201～1.473, the 3rd group of G3:1.474～1.737, the 4th group of G4:1.738～2.021, the 5th group of G5:2.022～2.972;
According to following formula, calculate and suffer from the relatively ill risk score of coronary heart disease:
Suffer from the relatively ill risk score=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222; Smoking, drink for "Yes" or "No", "Yes" is 1, and "No" is 0; Weight index is BMI=body weight/height
2, unit is Kg/m
2Blood sugar, determine cholesterol with high density lipoprotein method are 12 hours on an empty stomach, and unit is mg/dl.
Of the present invention for assessment of individual proofing unit of suffering from coronary heart disease risk to be measured, can be virtual bench, as long as can realize the function of described detecting unit and data analysis unit.Described detecting unit can be to comprise various detection reagent, test kit or detecting instrument; Described data analysis unit can be that any can realization carried out analyzing and processing and drawn computing instrument, module or the virtual unit of individual coronary heart disease genetic risk factor scoring to be measured the detected result of detecting unit, can be for example the data drawing list of formulating according to above-mentioned genetic risk factor evaluate formula in advance, the detected result of detecting unit be contrasted to this data drawing list and can draw genetic risk factor score value.
According to the specific embodiment of the invention scheme, in the present invention, the height of the relatively ill risk score of described trouble coronary heart disease reflection individual height of suffering from risk of coronary heart disease to be measured.
In the specific embodiment of the present invention, for the individual coronary heart disease risk of suffering to be measured of convenient assessment in practical application, detected the dangerous allelotrope situation that 8579 Healthy Peoples and 7012 patients with coronary heart disease carry described 9 SNP gene mononucleotide polymorphism sites, according to following formula, calculated each research object and carry out the scoring of coronary heart disease genetic risk factor: genetic risk factor scoring=∑ log (OR
i) * N
i, OR wherein
iThe relative risk that refers to i SNP, N
iThe dangerous allelotrope number that refers to entrained i the SNP of research object (individuality to be measured); And according to all research object coronary heart disease genetic risk factor scorings, research object is divided into to 5 groups, set up the ill risk comparison model of coronary heart disease.In concrete real-time mode of the present invention, described 5 groups are respectively the 1st group 0.115～1.200, the 2nd group 1.201～1.473, the 3rd groups 1.474～1.737, the 4th groups 1.738～2.021 and the 5th groups 2.022～2.972; Minimum group to the highest group of coronary heart disease genetic risk factor scoring, the ill risk of coronary heart disease raises gradually.On this basis, further combined with environmental factors, set up predictive model, can calculate and suffer from the relatively ill risk score of coronary heart disease: suffer from the relatively ill risk score=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222.
In the present invention, described a plurality of gene mononucleotide polymorphism Sites Combination state can provide the individual coronary heart disease risk rate information of suffering to be measured, and described rs2123536 carries T allelotrope, rs1842896 and carries T allelotrope, rs9349379 and carry G allelotrope, rs9268402 and carry G allelotrope, rs12524865 and carry C allelotrope, rs10757274 and carry G allelotrope, rs1333042 and carry G allelotrope, rs7136259 and carry T allelotrope and rs11066280 and carry the allelic individual risk of suffering from coronary heart disease of A and raise 1.13 to 1.36 times.The risk that described environmental factors is suffered from coronary heart disease for individuality also has certain dependency.
Thereby on the other hand, the present invention also provides described a plurality of gene mononucleotide polymorphisms site and environmental factors to be combined in for the preparation of assessment individual the suffer from proofing unit of coronary heart disease risk and the application in model to be measured.
On the other hand, the present invention's agent combination of the reagent that detects mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 also being provided and having detected described environmental factors is for the preparation of the vitro detection risk factors of coronary heart disease preparation of (comprising coronary heart disease dependent genes, environmental factors), test kit or for assessment of individual the suffer from proofing unit of coronary heart disease risk or the application in model to be measured.The reagent that the reagent of wherein said detection mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 is used in can preceding method is for example: for the reagent of direct sequencing; Or the reagent combined with the restriction fragment length polymorphism analysis for polymerase chain reaction; Or the reagent combined with direct sequencing for polymerase chain reaction; Or the reagent combined with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on the method for hybridization, based on the method for primer extension, based on method or the high resolving power solubility curve analytical technology of conformation.The reagent that detects described environmental factors can be the conventional reagent in affiliated field.
On the other hand, the present invention also provides vitro detection from mononucleotide polymorphism site: rs2123536 in the sample of individuality to be measured, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, the reagent of rs7136259 and rs11066280 and the agent combination that detects described environmental factors are at preparation prediction individual preparation of suffering from the danger of coronary heart disease to be measured, application in test kit or proofing unit, wherein, described rs2123536 carries T allelotrope, rs1842896 carries T allelotrope, rs9349379 carries G allelotrope, rs9268402 carries G allelotrope, rs12524865 carries C allelotrope, rs10757274 carries G allelotrope, rs1333042 carries G allelotrope, rs7136259 carries T allelotrope and rs11066280 and carries the allelic individual danger of suffering from coronary heart disease of A and significantly raise.
The testing sample that contains gene of the present invention can obtain from experimenter's cell, Tathagata autoblood, urine, saliva, gastric juice, hair or examination of living tissue.Preferably carry out autoblood.Can first from experimenter's cell, obtain the testing sample that contains gene of the present invention, then according to ordinary method, extract the DNA of gene.Described individuality to be measured is preferably Chinese han population.
On the basis of the statistical study of large sample of the present invention, can use separately method of the present invention, vitro detection is from the allelotrope situation of carrying and the described environmental factors of mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 in the sample of individuality to be measured, with the external prediction individual danger of suffering from coronary heart disease to be measured, reach the external prediction individual purpose of suffering from risk of coronary heart disease to be measured.
According to the specific embodiment of the invention scheme, when utilizing technical evaluation of the present invention individual trouble coronary heart disease risk to be measured, can carry out according to following operation:
(1) collection research object (individuality to be measured) environmental exposure factor comprise smoking, drink, weight index information, wherein weight index equal body weight (Kg) divided by height (m) square.Venous blood samples, measure blood sugar and high density lipoprotein cholesterol.
(2) obtain the scoring of idiogenetics Hazard Factor.(rs9349379,6p21.32 zone, rs1842896,6p24.1 zone, rs2123536,4q32.1 zone, 2p24.1 zone rs12524865,9p21.3 zone, rs9268402,6q23.2 zone rs10757274,9p21.3 zone rs1333042,12q21.33 zone rs7136259 and 12q24.13 zone rs11066280 carry out gene type to the pleomorphism site (SNP) of 9 ill risks of coronary heart disease.Comprehensive individuality carries the dangerous allelotrope situation in 9 SNP sites, carry out the scoring of coronary heart disease genetic risk factor, methods of marking is that research object is carried the allelic number of risk and risk allelotrope effect value (log (OR)) and multiplied each other and obtain each SNP site hereditary effect, then the hereditary effect summation of 9 SNP is obtained the coronary heart disease genetic risk factor scoring of this research object.According to the grouping of score value judgement research object, the 1st group 0.115～1.200 (G1), the 2nd group 1.201～1.473 (G2), the 3rd group 1.474～1.737 (G3), the 4th group 1.738～2.021 (G4) and the 5th group 2.022～2.972 (G5).
(3) above-mentioned genetic information is put into to the predictive model established with environmental factors exposure information: suffer from the relative ill risk=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222.
(4) calculate ill risk: according to model, calculate and obtain the relative risk that this research object is suffered from coronary heart disease, judge whether this research object is the high risk population of coronary heart disease.
(5) complete the report of individuation health guidance, the height that the report research object is suffered from coronary heart disease risk.The report of individuation health guidance is on the basis of genotype result, in conjunction with coronary heart disease mode of life hazard factor assessment research object, suffers from the risk of coronary heart disease, and makes for the healthy action scheme of the individuation of research object.
In sum, the present invention has found 9 important variant sites: rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and the rs11066280s relevant to coronary heart disease, the particular combinations in these sites, greatly increased the individual risk of suffering from coronary heart disease, on this basis further combined with environmental factors, for assessment of the individual coronary heart disease risk of suffering to be measured, can be good at identifying the high risk population of coronary heart disease.Accordingly, the doctor can calculate the scoring of coronary heart disease genetic risk factor, complete the report of research object genotype detection and the report of individuation health guidance, and the height of report research object trouble coronary heart disease risk, make for the healthy action scheme of the individuation of research object.Further can intervene targetedly, instruct this individuality to change bad life habits, reduce environmental factors to the bringing out of disease, delay and prevent the pathogenetic purpose of coronary disease thereby reach.Visible, technology of the present invention has important application prospect in the prediction and prevention of coronary heart disease.
The accompanying drawing explanation
Fig. 1 is the dangerous allelotrope Genetic Contributions quick checking of coronary heart disease chart.
Fig. 2 is coronary heart disease genetic risk factor scoring grouping quick checking chart.
Fig. 3 is the ROC curve that genetic risk factor scoring grouping and environmental factors expose the information prediction coronary heart disease risk.
Embodiment
In order more clearly to understand the present invention, further describe the present invention referring now to the following example and accompanying drawing.Embodiment does not only limit the present invention in any way for explanation.In embodiment, the experimental technique of unreceipted actual conditions is ordinary method and the normal condition that affiliated field is known, or the condition of advising according to manufacturers.
Embodiment mono-
At first in Chinese han population, choose the normal artificial research object of 7012 routine patients with coronary heart disease and 8579 examples, gather fasting blood and collect age, sex, blood pressure level, blood lipid level, height, body weight, smoking, drink and the relevant information such as history of disease, specific as follows:
Case-control sample inclusion criteria: the coronary heart disease case comprises myocardial infarction patient and patient with angina pectoris.The selected Case definition of myocardial infarction case is Diagnosis of Acute Myocardial Infarction standard (according to the WHO Case definition of 1979): namely the typical chest pain symptom continues more than 30 minutes; Continuous 2 ST-segments of electrocardiogram(ECG (limb leads 0.1mv, chest leads 0.2mv) also have serial dynamic change; The serum marker substrate concentration of myocardial necrosis raises, and raises as troponin (TNT/TNI), and myocardium isozyme (CK-MB) raises and is greater than 2 times of the high limit of normal value.The selected Case definition of stenocardia case surpasses 70% for finding that through coronary angiography at least one Main Branches of coronary artery is narrow.Valvular heart disease, congenital heart disease, heart failure, serious kidney and hepatic diseases, secondary hypertension, myocardosis, familial hypercholesterolemia and Suspected Coronary Heart Disease patient except every inspection.The case that meets above-mentioned diagnosis can enter anthology research.The control group inclusion criteria: previously without coronary heart disease or other Atheromatosis histories, without pectoralgia, the cardiac symptom such as uncomfortable in chest, electrocardiogram(ECG is without obvious ischemic change.Case group and control group are Chinese han population, and consanguinity-less relation.
The study population comprises 7012 routine patients with coronary heart disease and 8579 routine normal peoples, its essential characteristic such as following table:
| Case | Contrast | |
| Sample size | 7012 | 8579 |
| Male/female | 5887/1125 | 5865/2714 |
| Age | 51.65±8.03 | 55.31±8.80 |
| BMI(kg/m 2) | 26.27±3.64 | 24.65±3.64 |
| Systolic pressure (mmHg) | 124.09±17.80 | 140.23±22.86 |
| Diastolic pressure (mmHg) | 77.33±11.42 | 86.23±12.89 |
| Blood sugar (mg/dL) | 107.02±33.73 | 94.56±30.07 |
| TC(mg/dL) | 173.35±41.65 | 182.53±34.58 |
| TG(mg/dL) | 161.13±101.04 | 145.99±106.07 |
| HDLC(mg/dL) | 39.48±10.05 | 50.74±12.43 |
| LDLC(mg/dL) | 95.10±32.62 | 103.68±29.21 |
| Hypertension (%) | 57.06 | 56.52 |
| Diabetes (%) | 24.57 | 3.76 |
| Smoking (%) | 67.61 | 37.87 |
| (%) drinks | 44.41 | 32.51 |
The Forecasting Methodology of the ill risk of analysis coronary heart disease of the present embodiment, binding object genetic information and environmental factors expose the comprehensive assessment research object to suffer from the height of coronary heart disease risk, and this Forecasting Methodology comprises the following steps:
(1) set up the coronary heart disease information database, comprise that genotype information and environmental factors expose information.
(2) (rs9349379,6p21.32 zone, rs1842896,6p24.1 zone, rs2123536,4q32.1 zone, 2p24.1 zone rs12524865,9p21.3 zone, rs9268402,6q23.2 zone rs10757274,9p21.3 zone rs1333042,12q21.33 zone rs7136259 and 12q24.13 zone rs11066280 carry out the gene type acquisition to genotype information by the pleomorphism site to 9 ill risks of coronary heart disease (SNP).9 mononucleotide polymorphic sites and both wings sequence thereof are as follows:
rs2123536AAAGAGGGACGGGGAATCAGAAAGTG[T/C]GCGTCGTATTTCAGACATCAAACGT(SEQ ID No.1)
rs1842896AGTATTATTTAAAATAGCACCAAAAT[G/T]CATTCCCTTAAAAGCACTAGTTATC(SEQ ID No.2)
rs9349379GTCTATGCCCTTGAGATCATATAAAA[G/A]TAGCTTAAAATCATTGGCCATAGTT(SEQ ID No.3)
rs9268402aaatcttgagagggatatgaacatcc[A/G]gattgaagacgatcaaagcatccca(SEQ ID No.4)rs 12524865GAAGGTGAATGGGAAAAATAACTTAA[A/C]GTCAGTCCCAAAGGCTAAAGTGGTA(SEQ ID No.5)
rs10757274GTGGGTCAAATCTAAGCTGAGTGTTG[A/G]GACATAATTGAAATTCACTAGATAG(SEQ ID No.6)
rs1333042GGCAAGGGGACATACCAAACACTAAC[A/G]GGCACATTGGGGTTTTCTGGCTATT(SEQ ID No.7)
rs7136259aggtttgtgtagtacactgtgtgaat[C/T]tgcacaataacgaaattgcaacgca(SEQ ID No.8)
rs11066280GAGAGGTTCTTTCCTTTGAAAACCAT[A/T]CTTCTGTGGAAATAGCTGACAAATT(SEQ IDNo.9)
The analytical results demonstration, above-mentioned 9 genotype polymorphism sites (rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280) are significantly associated with the ill risk of coronary heart disease.Wherein, rs2123536 carries T allelotrope, rs1842896 and carries T allelotrope, rs9349379 and carry G allelotrope, rs9268402 and carry G allelotrope, rs12524865 and carry C allelotrope, rs10757274 and carry G allelotrope, rs1333042 and carry G allelotrope, rs7136259 and carry T allelotrope and rs11066280 and carry the allelic individual risk of suffering from coronary heart disease of A and obviously raise, the ill risk of coronary heart disease 1.13 to 1.36 times (in Table 1) that raises.
Incidence relation between table 1.9 mononucleotide polymorphic site and coronary heart disease are ill
OR (95%CI) means to compare with carrying the allelic individuality of reference, carries the relative risk of the allelic individual coronary heart disease of risk.
Comprehensive each individuality carries the dangerous allelotrope situation in 9 SNP sites, each research object is carried out to the scoring of coronary heart disease genetic risk factor, methods of marking is that research object is carried the allelic number of risk and risk allelotrope effect value (log (OR)) and multiplied each other and obtain each SNP site hereditary effect, then the hereditary effect summation of 9 SNP is obtained coronary heart disease genetic risk factor scoring (the genetic risk factor scoring=∑ log (OR of this research object
i) * N
i, OR wherein
iThe relative risk that refers to i mononucleotide polymorphism site, N
iThe dangerous allelotrope number that refers to entrained i the mononucleotide polymorphism site of individuality to be measured).According to all research object coronary heart disease genetic risk factor scorings, research object is divided into to 5 groups.Be respectively the 1st group 0.115～1.200 (G1), the 2nd group 1.201～1.473 (G2), the 3rd group 1.474～1.737 (G3), the 4th group 1.738～2.021 (G4) and the 5th group 2.022～2.972 (G5).
In the present embodiment, also according to 8579 Healthy Peoples that detect and 9 pleomorphism site (rs2123536 of 7012 patients with coronary heart disease, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280) situation, the dangerous allelotrope Genetic Contributions quick checking chart (Fig. 1) of coronary heart disease and coronary heart disease genetic risk factor scoring grouping quick checking chart (Fig. 2) have been formulated, while being beneficial to actual detection idiogenetics information, contrast this data drawing list according to detected result and can comparatively promptly draw genetic risk factor score value and grouping.
(3) genotype information (genetic risk factor scoring grouping) and environmental factors exposure information index are carried out to single factor analysis, corresponding statistical procedures method is as follows: continuous variable adopts independent sample T check; Two classified variables adopt chi square test or the accurate stochastic method of Fisher; Inspection level is 0.05, and result filters out the variable index that difference has statistical significance.
The variable that (4) will filter out is do the logistic analysis of reaching the same goal, carry out model testing, obtain the corresponding β value of each factor, the foundation equation of reaching the same goal, ln (p/ (1-p))=-0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value), calculate the relative risk of each factor: OR=Exp (β), in Table 2.The ln (p/ (1-p)) of Equation for Calculating without heredity and environmental risk factors individuality (mark at first group by the genetic risk factor according to reaching the same goal, non-smoking and not drinking, BMI, the individuality of fasting plasma glucose and the normal mean level (ML) of high density lipoprotein cholesterol) be 0.222, so certain individual relative is hereditary in nothing and the risk forecast model of environmental risk factors individuality: suffer from the relative ill risk=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222, the relatively ill value-at-risk of calculating is for marking at first group with respect to the genetic risk factor, non-smoking and not drinking, BMI, the multiple of the individual coronary heart disease risk of fasting plasma glucose and the normal mean level (ML) of high density lipoprotein cholesterol.This value shows that more greatly ill risk is higher.
Table 3-table 6 is to obtain in smoking population, non-smokers, drink crowd and non-drink the crowd relative risk (OR value) of h and E factor accordingly according to after smoking and the grouping of drinking, calculating.
The relative risk of the factor of the ill risk of table 2. coronary heart disease
The relative risk of the factor of the ill risk of table 3. smoking population coronary heart disease
The relative risk of the factor of the ill risk of table 4. non-smokers coronary heart disease
The drink relative risk of factor of the ill risk of crowd's coronary heart disease of table 5.
The relative risk of the factor of the non-ill risk of crowd's coronary heart disease of drinking of table 6.
(5) genetic risk factor scoring grouping is put into to the relative ill risk of trouble coronary heart disease that risk forecast model calculates every research object with environmental factors exposure information, the relatively ill risk of trouble coronary heart disease of take is test variable, whether the research object of take is ill is state variables, do experimenter's performance curve (ROC) analysis, according to area under curve, estimate the value of this Forecasting Methodology.The detailed process of ROC tracing analysis is as follows: according to a series of ill risk truncation points, research object is divided into to two groups (predicting ill group and prediction normal group), then whether binding object actual diseased, calculate sensitivity and specific degree, the sensitivity of take represents True Positive Rate as ordinate zou, take (1-specific degree) as ordinate zou represents false positive rate, draw the ROC curve as shown in Figure 3.Under ROC, area is 0.80.Show that this model prediction is functional, can well identify the coronary heart disease high risk population.
By above-mentioned experimental study of the present invention, show, the invention provides a kind of according to the model of gene pleiomorphism prediction in conjunction with individual level incidence of coronary heart disease risk, can be good at identifying the high risk population of coronary heart disease, thereby intervene targetedly, reach and delay and prevent the pathogenetic purpose of coronary disease.Utilize research object genotype result to calculate the coronary heart disease risk score, complete the report of research object genotype detection and the report of individuation health guidance, and the height of report research object trouble coronary heart disease risk.The report of individuation health guidance is on the basis of genotype result, in conjunction with coronary heart disease mode of life hazard factor assessment research object, suffers from the risk of coronary heart disease, and makes for the healthy action scheme of the individuation of research object.
Embodiment bis-
For example Zhang San seeks advice from its trouble coronary heart disease risk height.To analyze in accordance with the following steps:
(1) carry out questionnaire and somatometry
Collect Zhang San's age, sex, smoking and the situation of drinking; Measure and raise and body weight, calculate weight index.Obtain following information: Zhang San, the male sex, 55 years old, non-smoking, drank, height 172cm, body weight 75KG.The weight index that obtains calculated is 25.35.
(2) extract limosis vein blood (anti-freezing, non-anti-freezing), measure blood sugar, high density lipoprotein cholesterol in serum
Zhang San's glucose level is 90mg/dl, and high density lipoprotein cholesterol is 45mg/dl.
(3) separate DNA in anticoagulation, detect the genotype in 9 sites and calculate the scoring of genetic risk factor
The genotype in 9 sites of Zhang San is respectively: rs2123536 is CT, rs1842896 is GG, rs9349379 is AA, rs9268402 is AG, and rs12524865 is AA, and rs10757274 is GG, rs1333042 is AG, rs7136259 is CC, and rs11066280 is AT, and the allelic number of its risk is respectively: 1,0,0,1,0,2,1,0 and 1.Contrast the dangerous allelotrope Genetic Contributions quick checking of coronary heart disease shown in Figure 1 chart, calculate genetic risk factor scoring=1 * 0.122+0 * 0.140+0 * 0.174+1 * 0.148+0 * 0.122+2 * 0.307+1 * 0.293+0 * 0.131+1 * 0.231=1.41, contrast coronary heart disease genetic risk factor scoring grouping zoom table shown in Figure 2, belong to the G2 grouping.
(4) scoring of genetic risk factor and environmental risk factors, calculate the relative risk of changing coronary heart disease
Relative risk=the exp of Zhang San's coronary heart disease (0.220+0.232 * 1+0.403 * 0+0.534 * 0+0.852 * 0+0.178 * 1+1.110 * 0+0.010 * 90+0.074 * 25.35+ (0.080) * 45)/0.222=2.39, show Zhang San with respect to without heredity and the individuality of environmental risk factors (the genetic risk factor mark at first group, non-smoking and do not drink, BMI, fasting plasma glucose and high density lipoprotein cholesterol be normal mean level (ML)), 2.39 times of coronary heart disease risk, belong to the high risk population.
(5) complete the report of research object genotype detection and the report of individuation health guidance
Zhang San self has higher genetic predisposition, adds the bad life habits of smoking, and the risk of therefore suffering from coronary heart disease is higher.Should abstinence from alcohol, keep on a diet simultaneously and body weight, reduce the ill risk of coronary heart disease.
Claims (7)
1. detect the reagent of mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 and detect the agent combination that individual environmental factors comprises blood glucose value and high density lipoprotein cholesterol value in venous blood, the application in the individual proofing unit of suffering from coronary heart disease risk to be measured for the preparation of assessment;
Wherein, described proofing unit for assessment of individual trouble coronary heart disease risk to be measured comprises detecting unit and data analysis unit;
Described detecting unit is for detection of idiogenetics information to be measured and environmental factors, obtains detected result, wherein detect the genetic information situation and comprise the dangerous allelotrope situation that individuality to be measured carries described 9 mononucleotide polymorphism sites that detects, the dangerous allelotrope of described 9 mononucleotide polymorphism sites is respectively: the rs2123536 pleomorphism site is T, the rs1842896 pleomorphism site is T, the rs9349379 pleomorphism site is G, the rs9268402 pleomorphism site is G, the rs12524865 pleomorphism site is C, the rs10757274 pleomorphism site is G, the rs1333042 pleomorphism site is G, the rs7136259 pleomorphism site is T, the rs11066280 pleomorphism site is A, testing environment factor situation comprise detect whether smoking of individuality to be measured, whether drink, blood glucose value and high density lipoprotein cholesterol value in weight index information and venous blood,
Described data analysis unit is to carry out analyzing and processing for the detected result of detecting unit detection individuality to be measured being carried to the dangerous allelotrope situation of described 9 mononucleotide polymorphism sites, comprising:
According to following formula, calculate individual coronary heart disease genetic risk factor scoring to be measured, methods of marking is that individuality to be measured carries the allelic number of risk and risk allelotrope effect value log (OR) and multiplies each other and obtain each mononucleotide polymorphism site hereditary effect, then the hereditary effect summation of 9 mononucleotide polymorphism sites is obtained the coronary heart disease genetic risk factor scoring of this individuality to be measured:
Genetic risk factor scoring=∑ log(OR
i) * N
i, OR wherein
iThe relative risk that refers to i mononucleotide polymorphism site, N
iThe dangerous allelotrope number that refers to entrained i the mononucleotide polymorphism site of individuality to be measured; Wherein each mononucleotide polymorphism site OR is: rs2123536:1.13; Rs1842896:1.15; Rs9349379:1.19; Rs9268402:1.16; Rs12524865:1.13; Rs10757274:1.36; Rs1333042:1.34; Rs7136259:1.14; Rs11066280:1.26;
According to score value judgement individual packets to be measured, the 1st group of G1:0.115～1.200, the 2nd group of G2:1.201～1.473, the 3rd group of G3:1.474～1.737, the 4th group of G4:1.738～2.021, the 5th group of G5:2.022～2.972;
According to following formula, calculate and suffer from the relatively ill risk score of coronary heart disease:
Suffer from the relatively ill risk score=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222; Smoking, drink for "Yes" or "No", "Yes" is 1, and "No" is 0; Weight index is BMI=body weight/height
2, unit is Kg/m
2Blood sugar, determine cholesterol with high density lipoprotein method are 12 hours on an empty stomach, and unit is mg/dl;
The height reflection individual height of suffering from risk of coronary heart disease to be measured of wherein, suffering from the relatively ill risk score of coronary heart disease.
2. application according to claim 1, wherein, described a plurality of gene mononucleotide polymorphism Sites Combination state provides the individual coronary heart disease risk rate information of suffering to be measured, described rs2123536 carries T allelotrope, rs1842896 carries T allelotrope, rs9349379 carries G allelotrope, rs9268402 carries G allelotrope, rs12524865 carries C allelotrope, rs10757274 carries G allelotrope, rs1333042 carries G allelotrope, rs7136259 carries T allelotrope and rs11066280 and carries the allelic individual risk of suffering from coronary heart disease of A and raise 1.13 to 1.36 times.
3. vitro detection is from mononucleotide polymorphism site: rs2123536 in the sample of individuality to be measured, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, the reagent of rs7136259 and rs11066280, and the agent combination that detects blood glucose value and high density lipoprotein cholesterol value in individual venous blood, at preparation prediction individual preparation of suffering from the danger of coronary heart disease to be measured, application in test kit or proofing unit, wherein, described rs2123536 carries T allelotrope, rs1842896 carries T allelotrope, rs9349379 carries G allelotrope, rs9268402 carries G allelotrope, rs12524865 carries C allelotrope, rs10757274 carries G allelotrope, rs1333042 carries G allelotrope, rs7136259 carries T allelotrope and rs11066280 and carries the allelic individual danger of suffering from coronary heart disease of A and significantly raise.
4. application according to claim 1, wherein said individuality to be measured is Chinese han population.
5. application according to claim 4, wherein, testing sample is from blood, urine, saliva, gastric juice, hair or the examination of living tissue of individuality to be measured.
6. according to the described application of claim 1 or 3, the reagent of wherein said detection mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280 is: for the reagent of direct sequencing; Or the reagent combined with the restriction fragment length polymorphism analysis for polymerase chain reaction; Or the reagent combined with direct sequencing for polymerase chain reaction; Or the reagent combined with direct sequencing for polymerase chain reaction; Or for the reagent of following any SNP classifying method: based on the method for hybridization, based on the method for primer extension, based on method or the high resolving power solubility curve analytical technology of conformation.
7. one kind for assessment of individual proofing unit of suffering from coronary heart disease risk to be measured, and this device comprises detecting unit and data analysis unit, wherein:
Described detecting unit is for detection of idiogenetics information to be measured and environmental factors, obtains detected result, wherein detect the genetic information situation and comprise the dangerous allelotrope situation that individuality to be measured carries described 9 mononucleotide polymorphism sites that detects, the dangerous allelotrope of described 9 mononucleotide polymorphism sites is respectively: the rs2123536 pleomorphism site is T, the rs1842896 pleomorphism site is T, the rs9349379 pleomorphism site is G, the rs9268402 pleomorphism site is G, the rs12524865 pleomorphism site is C, the rs10757274 pleomorphism site is G, the rs1333042 pleomorphism site is G, the rs7136259 pleomorphism site is T, the rs11066280 pleomorphism site is A, testing environment factor situation comprise detect whether smoking of individuality to be measured, whether drink, blood glucose value and high density lipoprotein cholesterol value in weight index information and venous blood, described detecting unit comprises detection reagent, test kit or the detecting instrument that detects mononucleotide polymorphism site rs2123536, rs1842896, rs9349379, rs9268402, rs12524865, rs10757274, rs1333042, rs7136259 and rs11066280,
Described data analysis unit is can realize to the detected result of detecting unit is carried out analyzing and processing and drawn computing instrument, module or the virtual unit of individual coronary heart disease genetic risk factor scoring to be measured, this data analysis unit is used for the detected result of detecting unit is carried out to analyzing and processing, comprising:
According to following formula, calculate individual coronary heart disease genetic risk factor scoring to be measured, methods of marking is that individuality to be measured carries the allelic number of risk and risk allelotrope effect value log (OR) and multiplies each other and obtain each mononucleotide polymorphism site hereditary effect, then the hereditary effect summation of 9 mononucleotide polymorphism sites is obtained the coronary heart disease genetic risk factor scoring of this individuality to be measured:
Genetic risk factor scoring=∑ log(OR
i) * N
i, OR wherein
iThe relative risk that refers to i mononucleotide polymorphism site, N
iThe dangerous allelotrope number that refers to entrained i the mononucleotide polymorphism site of individuality to be measured; Wherein each mononucleotide polymorphism site OR is: rs2123536:1.13; Rs1842896:1.15; Rs9349379:1.19; Rs9268402:1.16; Rs12524865:1.13; Rs10757274:1.36; Rs1333042:1.34; Rs7136259:1.14; Rs11066280:1.26;
According to score value judgement individual packets to be measured, the 1st group of G1:0.115～1.200, the 2nd group of G2:1.201～1.473, the 3rd group of G3:1.474～1.737, the 4th group of G4:1.738～2.021, the 5th group of G5:2.022～2.972;
According to following formula, calculate and suffer from the relatively ill risk score of coronary heart disease:
Suffer from the relatively ill risk score=exp of coronary heart disease (0.220+0.232 * G2+0.403 * G3+0.534 * G4+0.852 * G5+0.178 * drink+1.110 * smoking+0.010 * blood glucose value+0.074 * weight index+(0.080) * high density lipoprotein cholesterol value)/0.222; Smoking, drink for "Yes" or "No", "Yes" is 1, and "No" is 0; Weight index is BMI=body weight/height
2, unit is Kg/m
2Blood sugar, determine cholesterol with high density lipoprotein method are 12 hours on an empty stomach, and unit is mg/dl;
The height reflection individual height of suffering from risk of coronary heart disease to be measured of wherein, suffering from the relatively ill risk score of coronary heart disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101893902A CN102758010B (en) | 2012-06-07 | 2012-06-07 | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101893902A CN102758010B (en) | 2012-06-07 | 2012-06-07 | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102758010A CN102758010A (en) | 2012-10-31 |
| CN102758010B true CN102758010B (en) | 2013-11-27 |
Family
ID=47052660
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101893902A Active CN102758010B (en) | 2012-06-07 | 2012-06-07 | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102758010B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109524060A (en) * | 2018-11-19 | 2019-03-26 | 江苏科技大学 | A kind of the gene sequencing data processing system and processing method of hereditary disease indicating risk |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200131B (en) * | 2015-09-23 | 2018-04-03 | 博奥生物集团有限公司 | The kit of peripheral arterial disease risk is assessed based on 14 SNP sites |
| CN107653311B (en) * | 2017-09-07 | 2021-11-02 | 中国医学科学院阜外医院 | Single nucleotide polymorphism rs4883263 detection system related to blood lipid level and related application |
| CN107502667B (en) * | 2017-09-22 | 2020-02-07 | 中国医学科学院阜外医院 | Gene functional genetic variation related to LDL-C level and related application |
| CN107841551B (en) * | 2017-09-29 | 2021-04-13 | 中国人民解放军第三军医大学第三附属医院 | Application of single nucleotide polymorphism site in wound sepsis risk assessment |
| CN109509511A (en) * | 2018-06-28 | 2019-03-22 | 吉恩生物科技（昆山）有限公司 | A kind of cardiovascular and cerebrovascular relevant parameter analysis method |
| CN108676873A (en) * | 2018-07-25 | 2018-10-19 | 上海海洋大学 | Detect the suspension microballon array system of coronary heart disease susceptibility loci |
| JP7165099B2 (en) * | 2019-04-23 | 2022-11-02 | ジェネシスヘルスケア株式会社 | Method for determining risk of myocardial infarction and/or angina pectoris |
| CN114075599A (en) * | 2020-08-17 | 2022-02-22 | 中国科学院上海营养与健康研究所 | Application of single nucleotide polymorphism sites in preparation of genetic risk scoring system of metabolism-related factors |
| WO2022247903A1 (en) * | 2021-05-26 | 2022-12-01 | 中国医学科学院阜外医院 | Polygenic risk score for coronary heart disease, construction method therefor, and application thereof in combination with clinical risk assessment |
| CN113506594B (en) * | 2021-05-26 | 2023-02-03 | 中国医学科学院阜外医院 | Construction method, device and application of polygene genetic risk comprehensive score of coronary heart disease |
| CN114898809B (en) * | 2022-04-11 | 2022-12-23 | 中国科学院数学与系统科学研究院 | Analysis method and storage medium for gene-environment interaction suitable for complex traits |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| WO2007006862A2 (en) * | 2005-07-12 | 2007-01-18 | Oy Jurilab Ltd | Method and kit for detecting a risk of coronary heart disease |
| WO2007124157A2 (en) * | 2006-04-21 | 2007-11-01 | Celera | Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
-
2012
- 2012-06-07 CN CN2012101893902A patent/CN102758010B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| WO2007006862A2 (en) * | 2005-07-12 | 2007-01-18 | Oy Jurilab Ltd | Method and kit for detecting a risk of coronary heart disease |
| WO2007124157A2 (en) * | 2006-04-21 | 2007-11-01 | Celera | Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
Non-Patent Citations (5)
| Title |
|---|
| Association of polymorphisms in the RAGE gene with serum CRP levels and coronary artery disease in the Chinese Han population;Gao J et al.;《J Hum Genet》;20100729;第55卷(第10期);668-675 * |
| Gene-environment interaction in genome-wide association studies;Murcray CE et al.;《Am J Epidemiol》;20090115;第169卷(第2期);219-226 * |
| Gene-gene and gene-environment interactions:new insights into the prevention,detection and management of coronary artery disease;Lanktree MB et al.;《Genome Med》;20090226;第1卷(第2期);1-11 * |
| 冠心病全基因组关联研究进展;杨英等;《遗传》;20100215;第32卷(第02期);94-104 * |
| 冠心病易感基因的筛选;盛海辉;《生理科学进展》;20040425;第35卷(第02期);130-134 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109524060A (en) * | 2018-11-19 | 2019-03-26 | 江苏科技大学 | A kind of the gene sequencing data processing system and processing method of hereditary disease indicating risk |
| CN109524060B (en) * | 2018-11-19 | 2022-02-08 | 江苏科技大学 | Genetic disease risk prompting gene sequencing data processing system and processing method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102758010A (en) | 2012-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102758010B (en) | Combination of multiple genetic single nucleotide polymorphisms and environmental factors related to coronary heart disease and application of combination | |
| CN102757954B (en) | Combination of multiple genetic single nucleotide polymorphisms related to coronary heart disease and application of combination | |
| CN105002286B (en) | The multiple mononucleotide polymorphism sites related to hypertension and/or cardiovascular disease incidence risk and related application | |
| CA2764693C (en) | Risk markers for cardiovascular disease | |
| Kayser et al. | Three genome-wide association studies and a linkage analysis identify HERC2 as a human iris color gene | |
| CA2724497C (en) | Genetic markers for weight management and methods of use thereof | |
| CN107254531B (en) | Genetic biomarker for auxiliary diagnosis of early colorectal cancer and application thereof | |
| WO2013043554A1 (en) | Methods for creating recommended dietary regime | |
| CA2781074A1 (en) | Genetic markers for weight management and methods of use thereof | |
| CN103146692A (en) | Kit for rapidly detecting warfarin individualized medication related gene SNP sites, and its detection method | |
| CN103642921B (en) | Selection, detection and application of catalase gene tagging single nucleotide polymorphic sites | |
| CN102747075B (en) | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes | |
| CN102757955B (en) | Tag single nucleotide polymorphism at 12# chromosome susceptible area related to coronary heart disease, and haplotype and application of tag single nucleotide polymorphism | |
| CN109880903B (en) | SNP marker for auxiliary diagnosis of non-small cell lung cancer and application thereof | |
| CN104131102B (en) | A kind of judge that NSCLC patient is to the test kit of Gefitinib therapeutic response | |
| CN102747072B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof | |
| WO2007032496A1 (en) | Method for determination of risk of type 2 diabetes | |
| CN109182508A (en) | The fluorescence in situ hybridization sequencing approach of TCF7L2 gene mononucleotide polymorphism | |
| CN101356287A (en) | Methods and compositions for the assessment of cardiovascular function and disorders | |
| CN109439742A (en) | Nucleotide combination for Proton pump inhibitor metabolism and drug resistant gene SNP detection | |
| CN102747076B (en) | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof | |
| CN109295171A (en) | The nucleic acid molecule combination and application of detection SNP are sequenced for fluorescence in situ hybridization | |
| CN117587022A (en) | Methylation marker and kit for predicting occurrence risk of drug-induced metabolic syndrome | |
| CN109266730A (en) | The method of fluorescence in situ hybridization sequencing detection ALDH2 gene mononucleotide polymorphism | |
| Grallert | Genetic analysis of candidate genes for the metabolic syndrome and type 2 diabetes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |