CN109295197A - BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting - Google Patents
BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting Download PDFInfo
- Publication number
- CN109295197A CN109295197A CN201811009584.3A CN201811009584A CN109295197A CN 109295197 A CN109295197 A CN 109295197A CN 201811009584 A CN201811009584 A CN 201811009584A CN 109295197 A CN109295197 A CN 109295197A
- Authority
- CN
- China
- Prior art keywords
- bsnd
- site
- heart disease
- coronary heart
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biotechnology, in particular to BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting, include: 1) expanding the primer in the site rs6682884: 5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence；5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence；2) probe of mutational site parting: 5 ' CCGTAGCTTCTCGTC3 ' of c-type probe sequence is carried out；5 ' CGTAGCTTCTAGTCTGG3 ' of A type probe sequence.The invention discloses a kind of BSND genes relevant to coronary disease susceptibility of new coronary heart disease hereditary basis that can explain Chinese han population, confirm SNP site rs6682884 closely related with coronary disease susceptibility on BSND gene, detection accuracy and high sensitivity simultaneously.
Description
Technical field
The invention belongs to field of biotechnology, in particular to the monokaryon glycosides on BSND gene relevant to coronary disease susceptibility
Sour polymorphism (single nucleotide polymorphism, SNP) site, and the phase for detecting the SNP site
Answer vitro detection reagent more particularly to the nucleic acid affinity ligand of the SNP site preparation for detecting, screening or prediction Han nationality
Application in the composition of crowd's coronary disease susceptibility.
Background technique
Coronary atherosclerotic heart disease (coronary heart disease, CHD), abbreviation coronary heart disease is one
The disease of kind cause of disease complexity, environment and genetics factor are related with the occurrence and development of coronary heart disease.In the U.S. and many developed countries,
Coronary heart disease ranks cause of death first place.Currently, the death rate of China's coronary heart disease also remains high and is in rise year by year trend.2015
Year, Chinese Urban Residents coronary heart disease death rate was 110.67/10 ten thousand, and rural resident is 110.91/10 ten thousand, is omited compared with upper one year
Rise.The disease incidence of coronary heart disease also shows areal variation, 1987~1993 more provinces and cities of China, 35~64 years old census of population
(Chinese MONICA) discovery, highest disease incidence are 108.7/10 ten thousand (Qingdaos), and minimum 3.3/10 ten thousand (Anhui Chuzhou) have
More significant regional disparity, northern provinces and cities are generally higher than southern provinces and cities.
In recent years, it also increasingly draws attention for the molecules research of coronary heart disease.From 2007, Anna
After Helgadottir and Ruth Mcpherson has found that the region 9p21 coronary heart disease is significantly associated with coronary heart disease simultaneously, successively
There is a coronary heart disease susceptibility loci more than 50 to be found.But these sites are the susceptibility loci of American-European crowd, the phase with Chinese population
Closing property is not yet verified.First article about Chinese population coronary heart disease susceptibility loci, research card are delivered in 2011 in China
A real new susceptibility loci 6p24.1 (rs6903956) relevant to Chinese han population coronary heart disease.2016, quick equal pair of height
5 susceptibility locis of American-European crowd and the correlation of Han nationality's human coronary heart disease are studied, the results showed that only one of which with
The Chinese significant correlation of Han nationality's coronary heart disease genetic predisposition.
China is still in infancy the molecular studies of coronary heart disease, it is known that for explaining the coronary disease of Chinese han population
The gene of sick hereditary basis and the negligible amounts in site, in order to improve the detection of Chinese Han Population coronary disease susceptibility, screening or prediction
Accuracy, to be easier, more direct, sensitiveer and more specific detect, screening or predict that Chinese Han Population coronary heart disease is easy
Perception, it is necessary to find new tumor susceptibility gene relevant to coronary disease susceptibility and SNP site.Therefore, this research is for China
Jiangsu crowd carries out coronary heart disease dependent genes screening, has obtained a SNP site mutation related with coronary disease susceptibility.
Summary of the invention
The present invention is intended to provide a kind of new coronary heart disease hereditary basis that can explain Chinese han population and coronary heart disease
The relevant BSND gene of neurological susceptibility, while confirming SNP site closely related with coronary disease susceptibility on BSND gene
rs6682884。
In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention are as follows: BSND gene SNP mutational site parting is drawn
Object includes:
1) primer in the site rs6682884 is expanded:
5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence；
5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence；
2) probe of mutational site parting is carried out:
5 ' CGTAGCTTCTAGTCTGG3 ' of A type probe sequence；
5 ' CCGTAGCTTCTCGTC3 ' of c-type probe sequence.
5 ' ends of the c-type probe are modified using FAM fluorophor, and 3 ' ends are modified using MGB；5 ' ends of A type probe
It is modified using VIC fluorophor, 3 ' ends are modified using MGB.
A kind of kit of vitro detection coronary heart disease dependent genes, the kit include that the BSND gene SNP is mutated
Site serotype specific primer.The kit further includes archaeal dna polymerase, PCR buffer.
For the parting detection architecture of BSND gene rs6682884 site A → CSNP mutation, including the vitro detection
The kit of coronary heart disease dependent genes, PCR amplification system are as follows:
2×Taqman mastmix 10μl
Invention additionally discloses a kind of BSND gene SNP mutational site, which is BSND gene rs6682884
Site, mutation type are A → C.
The present invention also provides BSND gene SNP mutational site serotype specific primers as detection, prevention, diagnosis or treatment coronary heart disease
Reagent application.The kit of the vitro detection coronary heart disease dependent genes is as detection, prevention, diagnosis or treatment coronary disease
The application of the reagent of disease.Parting detection architecture conduct for the site BSND gene rs6682884 A → C SNP mutation detects, in advance
The application of the reagent of anti-, diagnosis or treatment coronary heart disease.
Difference SNP screening is carried out to sample with full exon sequencing (WES) method.
BSND gene SNP genotyping detection method:
For the genotyping detection method of BSND gene rs6682884 site A → CSNP mutation:
1, human peripheral 2ml is acquired, EDTA is anticoagulant, -80 DEG C of preservations.
2, design upstream and downstream primer is a pair of: upstream primer sequence ACCCAAGGCTGAGATGTTTGTG；Downstream primer sequence
CTCCATATCATCCCATTTTGCA；
3, design typing probes: A type probe sequence CGTAGCTTCTAGTCTGG, 5 ' ends are modified using VIC fluorophor,
3 ' ends are modified using MGB；C-type probe sequence CCGTAGCTTCTCGTC, 5 ' ends are modified using FAM fluorophor, and 3 ' ends use
MGB modification.
4, peripheral blood genomic DNA is extracted, parting detection is carried out using Taqman PCR method.
When carrying out parting detection using Taqman PCR method, the amplification system of use:
2×Taqman mastmix 10μl
Amplification program:
Its middle probe FAM is c-type probe, and probe VIC is A type probe, and 2 × Taqman mastmix is PCR buffer, mould
Plate DNA is the peripheral blood genomic DNA extracted.
Amplification fluorescent result:
1. indicating that the allele in the site rs6682884 is A/A homozygote when only VIC fluorescence signal amplification curve；
When only FAM fluorescence signal amplification curve, indicate that the allele in the site rs6682884 is C/C homozygote；
When there are two kinds of fluorescence signal amplification curves of VIC and FAM simultaneously, the allele in the site rs6682884 is indicated
For A/C heterozygote.
The invention discloses a kind of the easy with coronary heart disease of new coronary heart disease hereditary basis that can explain Chinese han population
The relevant BSND gene of perception, while confirming SNP site closely related with coronary disease susceptibility on BSND gene
Rs6682884, detection accuracy and high sensitivity.
Detailed description of the invention
Fig. 1 is A/A homozygote amplification curve schematic diagram of the invention；
Fig. 2 is C/C homozygote amplification curve schematic diagram of the invention；
Fig. 3 is A/C heterozygote amplification curve schematic diagram of the invention.
Specific embodiment
For a clearer understanding of the present invention, the present invention, embodiment are further described referring now to the following example and attached drawing
It is only used for explaining without limiting the invention in any way.Unless stated otherwise, preparation process under normal temperature and normal pressure into
Row；Unless stated otherwise, the reagent that uses in the present invention, method and apparatus is the art conventional reagent, method and apparatus；
Unless stated otherwise, the experimental condition used in the present invention is the art normal test conditions；Unless stated otherwise, this hair
Bright middle agents useful for same is commercially available；Unless stated otherwise, the water in the present invention is deionized water.
Embodiment 1, a kind of coronary heart disease tumor susceptibility gene, that is, BSND gene.The sample to be tested of gene containing BSND can be always
It is obtained from the blood of experimenter.
Embodiment 2, a kind of reagent of vitro detection coronary heart disease dependent genes, the reagent is for detecting BSND gene
The SNP genotype in the site rs6682884, the reagent include following primer and probe:
5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence (SEQ ID No.1)；
5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence (SEQ ID No.2)；
5 ' VIC-CGTAGCTTCTAGTCTGG-MGB3 ' of A type probe sequence (SEQ ID No.3)；
5 ' FAM-CCGTAGCTTCTCGTC-MGB3 ' of c-type probe sequence (SEQ ID No.4).
So-called SNP, that is, single nucleotide polymorphism is primarily referred to as being drawn by the variation of single nucleotide acid at the genomic level
The DNA sequence polymorphism risen.It is one of the most common type in human heritable mutation, account for the 90% of all known polymorphisms with
On.Part SNP will have a direct impact on protein structure or gene expression dose, itself may be exactly the candidate of disease genetic mechanism
Change site.
Coronary heart disease is a kind of disease of cause of disease complexity, other than the effect of inhereditary material, the affiliated ethnic group of patient, life
Environment and living habit etc. are also closely bound up with the generation of coronary heart disease.In the factor to work to the disease, work
Gene number estimate up to up to a hundred, again there is interaction between each gene, there are phases between environment again for gene
Interaction.Coronary heart disease/myocardial infarction occurs have certain familial aggregation, but is more some Sporadic cases.This hair
Bright to use sequencing of extron group (WES) first, filtering out may be relevant with coronary heart disease between patients with coronary heart disease and Healthy People
SNP；Case-control study is used again, passes through the confirmatory experiment of large sample, it was demonstrated that the relationship between these SNP and coronary heart disease.
The Case control studies are exactly the frequency that (case and control) compares certain allele in using the two groups of crowds selected at random
Rate.
The present invention, by statistical analysis (135 patients with coronary heart disease and 40 controls), passes through in Jiangsu Province's Chinese Han Population
A large amount of experiment, finally demonstrating the BSND gene with rs6682884 polymorphic site of the invention with conclusive evidence is
Coronary heart disease dependent genes.
Embodiment 3, a kind of preparation or kit of the reagent having vitro detection coronary heart disease dependent genes, it is characterised in that should
Kit includes PCR amplification enzyme (i.e. archaeal dna polymerase) and corresponding buffer.The present invention detects rs6682884 loci polymorphism
The kit of coronary heart disease dependent genes can be used for the polymorphism of vitro detection coronary heart disease dependent genes；The site rs6682884 is prominent
The kit of the coronary heart disease dependent genes of change can be used for detecting, prevention, diagnose or treat coronary heart disease；Vitro detection coronary heart disease phase
The method of correlation gene can be used for detecting, prevention, diagnose or treat coronary heart disease.
Embodiment 4, a kind of reagent of vitro detection coronary heart disease dependent genes are related for vitro detection coronary heart disease in preparation
The preparation of gene or the application in kit.The present invention detects the examination of the coronary heart disease dependent genes of rs6682884 loci polymorphism
Agent box can be used for the polymorphism of vitro detection coronary heart disease dependent genes；The coronary heart disease dependent genes of rs6682884 site mutation
Kit can be used for detect, prevention, diagnosis or treatment coronary heart disease；The method of vitro detection coronary heart disease dependent genes can be used
In detection, prevention, diagnosis or treatment coronary heart disease.
Embodiment 5, the difference is that, kit also includes PCR amplification primer and probe with above-described embodiment.
Embodiment 6, screening experiment.
The screening of two groups of difference in crowds genes is carried out using full exon PCR sequencing PCR (WES).
The selection of research object: CHD group 5, selected from December, 2016 in Nanjing No.1 Hospital's cardiovascular disease research
The patients with coronary heart disease gone to a doctor, all patients with coronary heart disease meet diagnosis of coronary heart disease in 2007 and treatment guidelines；Control group 5, choosing
The Healthy People to check UP from December, 2016 in Nanjing No.1 Hospital.Two groups of ages, sex composition no difference of science of statistics (P >
0.05).All patients with coronary heart disease and normal healthy controls person are the Han population in Jiangsu province of consanguinity-less relation, exclude other hearts
Disease and liver, kidney trouble.
Method: WES sequencing is carried out using QIAGEN kit, DNA extracts concrete operation step referring to QIAamp-DNA-
FFPE-Tissue-Handbook--June-2012-EN.pdf and DNeasy-Blood--Tissue-Handbook.pdf text
Part.DNA concentration is measured with microplate reader, agarose gel electrophoresis checks the integrated degree of DNA.With Agilent SureSelect
The full exon trapping kit of All Human Exome library (50,58,78Mb) (V5, V6, V5+UTR) carries out sequencing text
Library building, detailed process is referring to file: G7530-90000- (agilent WES) .pdf.By DNA library concentration to be measured in cBot
Flowcell, is then transferred on sequencing system, according to the normal stream of Illumina by upper completion cluster generation
In bis- generation of Cheng Jinhang, is sequenced and data analysis.
As a result: according to genotypic difference of the variant sites in different samples, accurately being examined, found using Fisher
The P value in the mutational site of case/control group difference, difference is smaller, illustrates that variant sites are more significant in two group differences,
Screening conditions: P < 0.05.It is again 1 with CHD group sudden change sample rate and control group sudden change sample rate is 0 for screening conditions, finally
BSND gene is filtered out, subsequent authentication is carried out.
Embodiment 7, confirmatory experiment.
Coronary disease ospc gene BSND polymorphic site rs6682884 of the invention is detected in patient using Taqman-PCR method
With the difference in normal population.
The selection of research object: CHD group 135, selected from January, -2018 in November, 2017 in Nanjing No.1 Hospital
The medical patients with coronary heart disease in angiocardiopathy institute, all patients with coronary heart disease meet diagnosis of coronary heart disease in 2007 and treatment guidelines；
Control group 40, the Healthy People to check UP selected from January, -2018 in November, 2017 in Nanjing No.1 Hospital.Two groups of ages,
Sex composition no difference of science of statistics (P > 0.05).All patients with coronary heart disease and normal healthy controls person are Jiangsu of consanguinity-less relation
Area's Chinese Han Population excludes other heart diseases and liver, kidney trouble.
Method: PCR reaction system (20 μ L): 4 μ L of genomic templates (comes from peripheral blood, uses Ezup pillar poba gene
Group DNA extraction agent box extracts), 2 × Taqman mastmix, 10 μ L, upstream, each 0.4 μ L, FAM probe of downstream primer
0.2 μ L, VIC probe 0.2 μ L, ddH24.8 μ L of O carries out PCR reaction, PCR cycle ginseng on ABI7500 real-time fluorescence PCR instrument
Number: 94 DEG C initial denaturation 3 minutes；Through 94 DEG C 5 seconds, 60 DEG C 30 seconds recycle 40 weeks.Primer and probe sequence is as follows:
5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence；
5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence；
5 ' VIC-CGTAGCTTCTAGTCTGG-MGB3 ' of A type probe sequence；
5 ' FAM-CCGTAGCTTCTCGTC-MGB3 ' of c-type probe sequence.
As a result: when only VIC fluorescence signal amplification curve, indicating that the allele in the site rs6682884 is A/A homozygous
Son；When only FAM fluorescence signal amplification curve, indicate that the allele in the site rs6682884 is C/C homozygote；When simultaneously
When there are two kinds of fluorescence signal amplification curves of VIC and FAM, indicate that the allele in the site rs6682884 is A/C heterozygote.Knot
Shown in the following Fig. 1-3 of fruit.
Embodiment 8 further to inquire into the relationship between BSND gene and incidence of coronary heart disease from the angle of heredity, and is state
Inside and outside existing similar research provides the evidence of genetic epidemiology, with Taqman real time fluorescent PCR method, what is be collected into
In patients with coronary heart disease and control group crowd, the polymorphism in vitro detection site rs6682884 in the sample of test individual, from
And the site rs6682884 is analyzed in the distributional difference of patients with coronary heart disease and normal control population.
Hardy-Weinberg balance check is used first.Hardy-Weinberg balance is a kind of the general of Population Genetics
Read: be primarily referred to as a nationality live in a certain area, can mutual randomer hybridization a group human body, possessed by this group all
Hereditary information is known as the gene pool of the group, it directly reflects this area, the hereditary feature of this nationality.The table of these hereditary information
Up to form gene frequency and genotype frequency, under conditions of no mutation, migration and genetic drift, in group gene frequency and
Genotype frequency is abided by remain unchanged and be balanced as Hardy-Weinberg.Genetic polymorphism existing in this way, but also with heredity
Stability.
Genotypic results analysis is found, genotypic results meet Hardy-Weinberg balance, therefore can arrange
Except experimental error, the genotypic results are reliable, and analysis the results are shown in Table 1.
Table 1
Conclusion: single factor analysis discovery, three kinds of genotype individuals of polymorphic site rs6682884 are in case group and control group
In be distributed with notable difference (P < 0.05), A/C show the further analysis of recessive inheritance mode find, the carrier of A allele
The carrier of opposite C allele has marked difference (P < 0.05) in case group and control group, the wherein carrying of A allele
The risk that person suffers from coronary heart disease is 3.29 times of the risk that the carrier of C allele suffers from coronary heart disease.
Embodiment 9, vitro detection coronary heart disease dependent genes, that is, BSND gene kit
A kind of kit of vitro detection coronary heart disease dependent genes, which includes:
1) primer in the site rs6682884 is expanded:
5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence；
5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence；
2) probe of mutational site parting is carried out:
5 ' VIC-CGTAGCTTCTAGTCTGG-MGB3 ' of A type probe sequence；
5 ' FAM-CCGTAGCTTCTCGTC-MGB3 ' of c-type probe sequence.
2) PCR amplification enzyme and corresponding buffer.
The above display describes basic principles and main features and advantage of the invention.The technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, what is described in the above embodiment and the description is only saying the principle of the present invention,
Without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these changes and improvements are all
It drops into the claimed scope of the invention.The scope of the present invention is defined by the appended claims and its equivalents.
Sequence table
<110>Co., Ltd of Nanjing gold domain medical test institute
<120>BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting
<130> xhx2018083101
<141> 2018-08-31
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Homo sapiens
<400> 1
acccaaggct gagatgtttg tg 22
<210> 2
<211> 22
<212> DNA
<213> Homo sapiens
<400> 2
ctccatatca tcccattttg ca 22
<210> 3
<211> 15
<212> DNA
<213> Homo sapiens
<400> 3
ccgtagcttc tcgtc 15
<210> 4
<211> 17
<212> DNA
<213> Homo sapiens
<400> 4
cgtagcttct agtctgg 17
Claims (9)
1.BSND gene SNP mutational site serotype specific primer, characterized by comprising:
1) primer in the site rs6682884 is expanded:
5 ' ACCCAAGGCTGAGATGTTTGTG3 ' of upstream primer sequence；
5 ' CTCCATATCATCCCATTTTGCA3 ' of downstream primer sequence；
Carry out the probe of mutational site parting:
5 '-CCGTAGCTTCTCGTC-3 ' of c-type probe sequence；
5 '-CGTAGCTTCTAGTCTGG-3 ' of A type probe sequence.
2. BSND gene SNP according to claim 1 mutational site serotype specific primer, which is characterized in that the c-type probe
5 ' ends modified using FAM fluorophor, 3 ' ends are modified using MGB；5 ' ends of A type probe are modified using VIC fluorophor, and 3 '
End is modified using MGB.
3. a kind of kit of vitro detection coronary heart disease dependent genes, which includes BSND base of any of claims 1 or 2
Because of SNP mutation site serotype specific primer.
4. a kind of kit of vitro detection coronary heart disease dependent genes according to claim 3, which is characterized in that the reagent
Box further includes archaeal dna polymerase, PCR buffer.
5. for the parting detection architecture of BSND gene rs6682884 site A → CSNP mutation, which is characterized in that including right
It is required that the kit of vitro detection coronary heart disease dependent genes described in 3 or 4, PCR amplification system are as follows:
2×Taqman mastmix 10μl
0.4 μ l of upstream primer
0.4 μ l of downstream primer
0.2 μ l of c-type probe
0.2 μ l of A type probe
ddH2O 4.8μl
4 μ l of template DNA.
6.BSND gene SNP mutational site, which is characterized in that the SNP mutation site is the site BSND gene rs6682884, is dashed forward
Change type is A → C.
7. BSND gene SNP of any of claims 1 or 2 mutational site serotype specific primer is as detection, prevention, diagnosis or treatment hat
The application of the reagent of heart trouble.
8. the kit of vitro detection coronary heart disease dependent genes described in claim 3 or 4 is used as and detects, prevents, diagnoses or control
Treat the application of the reagent of coronary heart disease.
9. the parting detection architecture described in claim 5 for BSND gene rs6682884 site A → CSNP mutation is as inspection
It surveys, prevention, the application for the reagent for diagnosing or treating coronary heart disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811009584.3A CN109295197A (en) | 2018-08-31 | 2018-08-31 | BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811009584.3A CN109295197A (en) | 2018-08-31 | 2018-08-31 | BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109295197A true CN109295197A (en) | 2019-02-01 |
Family
ID=65165702
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811009584.3A Pending CN109295197A (en) | 2018-08-31 | 2018-08-31 | BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109295197A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113646443A (en) * | 2019-04-09 | 2021-11-12 | 社会福祉法人三星生命公益财团 | Composition for diagnosing glioma or predicting prognosis and method for providing information related thereto |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014166303A2 (en) * | 2013-04-12 | 2014-10-16 | The Chinese University Of Hong Kong | Use of multiomic signature to predict diabetes |
| CN108048560A (en) * | 2018-01-26 | 2018-05-18 | 山东大学齐鲁医院 | A kind of kit, application method and application for detecting T1 gene rs1047896 polymorphic sites |
-
2018
- 2018-08-31 CN CN201811009584.3A patent/CN109295197A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014166303A2 (en) * | 2013-04-12 | 2014-10-16 | The Chinese University Of Hong Kong | Use of multiomic signature to predict diabetes |
| CN108048560A (en) * | 2018-01-26 | 2018-05-18 | 山东大学齐鲁医院 | A kind of kit, application method and application for detecting T1 gene rs1047896 polymorphic sites |
Non-Patent Citations (3)
| Title |
|---|
| SANDER WALDAMAR VAN DER LAAN: "The genetics of carotid atherosclerosis", 《HTTP://DSPACE.LIBRARY.UU.NL/HANDLE/1874/346682》 * |
| 佚名: "rs6682884", 《ENSEMBLE》 * |
| 高敏: "中国汉族人冠心病易感基因相关性研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113646443A (en) * | 2019-04-09 | 2021-11-12 | 社会福祉法人三星生命公益财团 | Composition for diagnosing glioma or predicting prognosis and method for providing information related thereto |
| EP3954784A4 (en) * | 2019-04-09 | 2023-05-10 | Samsung Life Public Welfare Foundation | Composition for diagnosis or prognosis prediction of glioma, and method for providing information related thereto |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108085395A (en) | Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence | |
| CN110029158A (en) | A kind of marfan's syndrome detection panel and its application | |
| CN106399304B (en) | A kind of SNP marker relevant to breast cancer | |
| JP2015089364A (en) | Cancer diagnostic method by multiplex somatic mutation, development method of cancer pharmaceutical, and cancer diagnostic device | |
| CN109182490A (en) | LRSAM1 gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting | |
| CN109666734A (en) | A kind of marfan's syndrome multidigit point kit for screening | |
| CN109295197A (en) | BSND gene SNP mutational site serotype specific primer and its application in coronary disease disease forecasting | |
| CN103502469A (en) | Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof | |
| CN103710447B (en) | Method and reagent for predicting susceptibility of ankylosing spondylitis | |
| CN103710448B (en) | Method and kit for predicting susceptibility of ankylosing spondylitis | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN106834476A (en) | A kind of breast cancer detection kit | |
| CN103266181B (en) | Kit for detecting transthyretin (TTR) gene mutant G307C | |
| CN104293958B (en) | A kind of test kit predicting susceptibility of ankylosing spondylitis and method | |
| CN113278697B (en) | Lung cancer diagnostic kit based on peripheral blood internal gene methylation | |
| CN106636351A (en) | SNP marker related to breast cancer and its application | |
| CN107385076A (en) | A kind of hypothyroidism Disease-causing gene mutation and the diagnostic reagent based on this gene mutation | |
| CN107502669A (en) | The SNP in the site of people NOS3 genes the 61st and its application | |
| CN110205322B (en) | Mutation SNP (Single nucleotide polymorphism) site of breast cancer pathogenic gene SEC63 and application thereof | |
| CN106834491B (en) | Breast cancer prognosis-related gene mutation detection kit and its application method | |
| CN103725781B (en) | Kit and method for predicting susceptibility of ankylosing spondylitis | |
| CN106282172A (en) | The STR bit point of PKD1 gene and application thereof | |
| CN106282171A (en) | The STR bit point of PKD2 gene and application thereof | |
| Tong | Report and Consultation | |
| CN104293969B (en) | A kind of reagent predicting susceptibility of ankylosing spondylitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |