CN102747076A - Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof - Google Patents
Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof Download PDFInfo
- Publication number
- CN102747076A CN102747076A CN201210201464XA CN201210201464A CN102747076A CN 102747076 A CN102747076 A CN 102747076A CN 201210201464X A CN201210201464X A CN 201210201464XA CN 201210201464 A CN201210201464 A CN 201210201464A CN 102747076 A CN102747076 A CN 102747076A
- Authority
- CN
- China
- Prior art keywords
- heart disease
- site
- coronary heart
- allelotrope
- susceptibility
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses single nucleotide polymorphisms (SNPs) associated with the susceptibility to diseases, particularly relates to SNPs of a susceptible area chr4q32 associated with the susceptibility to coronary heart disease and an application thereof in evaluating the susceptibility to coronary heart disease, belonging to the technical field of biology. The SNPs are a series of SNPs located at GUCY1A3-GUCY1B3 gene region down stream on the chromosome 4q32, that is, rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, and rs1123037. According to the invention, by using the chromosome 4q32's variation characters of haplotypes composing of a section of SNPs close to the GUCY1A3-GUCY1B3 gene region down stream and a series of SNPs to judge the susceptible population of coronary heart disease, non-invasive rapid and simple screening can be carried out on the people who have no early clinical signs of coronary heart disease, especially high risk group of coronary heart disease who have traditional risk factors, susceptible objects of coronary heart disease can be discovered early, corresponding health protection measures can be adopted, and the incidence of coronary heart disease and myocardial infarction can be reduced.
Description
Technical field
The present invention relates to the mononucleotide polymorphism site that is associated with disease susceptibility; Be particularly related to mononucleotide polymorphism site and the application in the assessment coronary disease susceptibility thereof of a kind of susceptible related zone chr4q32, belong to biological technical field with coronary disease susceptibility.
Background technology
The atherosclerotic cardiovascular and cerebrovascular disease have become the main health problem that world wide is paid close attention to.The World Health Organization's report in 2004 shows that the annual cardiovascular disorder in the whole world is taken the death toll Da Gaoda 1,720 ten thousand that causes as the leading factor with coronary heart disease and apoplexy, accounts for 1/3rd of all death tolls.Estimate that this numeral of the year two thousand twenty will further increase by 50%, up to 2,500 ten thousand, cardiovascular disorder is global human " No.1 killer ".An extensive perspective study of carrying out in China shows that also heart disease has become the major causes of death of Chinese population, apportion man, women's cause of death the 2nd and the 1st.China annual New Development myocardial infarction 500,000 people, the Hazard Factor of being correlated with along with the change and the atherosclerosis of mode of life continue to increase, and coronary heart disease and myocardial infarction morbidity yet will be lasting ascendant trend.
A large amount of research datas show that coronary heart disease is a kind of complex disease, are by due to a plurality of minor genes and the long-term interaction of environmental factors.Therefore identify tumor susceptibility gene relevant with coronary heart disease or Disease-causing gene, further the tumor susceptibility gene of screening increase disease risks is confirmed susceptible individual in the crowd, will help cause of coronary heart disease risk profile, new drug development, diagnosis and individualized treatment.From the basis to clinical; People have carried out a large amount of research to this; And accumulating a large amount of knowledge aspect the Hazard Factor of coronary heart disease and the pathogenetic physiopathology of coronary disease; But the definite genetic molecule mechanism about coronary heart disease and myocardial infarction generation is but known little about it, and for how to identify inheritance susceptible gene and the coronary heart disease genetic predisposition of identifying the experimenter, lacks comprehensive system effective recognition method always.
Summary of the invention
The purpose of the embodiment of the invention is the defective to above-mentioned prior art; Provide a series of and mononucleotide polymorphism site (the SNP coronary disease susceptibility significant correlation; Single nucleotide polymorphism)); And find out the most significant wherein related representative site with coronary disease susceptibility, the purposes that said mononucleotide polymorphism site is used to assess coronary disease susceptibility is provided then.
The technical scheme taked of the present invention is to achieve these goals:
First aspect provides the mononucleotide polymorphism site (SNP) of the susceptible zone chr4q32 of a series of and coronary disease susceptibility significant correlation.In Chinese han population, choose the normal artificial research object of 1515 routine patients with coronary heart disease and 5019 examples, use full genome chip (Affymetrix Axiom
TMGenome-Wide CHB 1 Array Plate) chip carries out gene type to SNP in the full genome range.The data of utilizing chip to obtain; Estimate the incidence relation of genotype and phenotype; Thereby obtain maybe with coronary heart disease between to have potential related zone be the downstream of the GUCY1A3-GUCY1B3 gene region on karyomit(e) 4q32; With the remarkable related mononucleotide polymorphism site of coronary disease susceptibility is a series of mononucleotide polymorphism sites that are positioned at this zone, for: rs2625269, allelotrope are A/G; Rs1976041, allelotrope are A/G; Rs1905261, allelotrope are A/C; Rs1905262, allelotrope are A/T; Rs2705455, allelotrope are G/A; Rs1483041, allelotrope are A/G; Rs2200168, allelotrope are C/T; Rs716428, allelotrope are C/T; Rs990619, allelotrope are G/C; Rs1842896, allelotrope are G/T; Rs2625245, allelotrope are A/G; Rs1123037, allelotrope are A/T.
Second aspect is used logistic regression analysis assessment each SNP site and Coronary Heart Disease, calculates dangerous allelic relative risk (Odds ratio; OR) and 95% credibility interval, the dangerous allelotrope that obtains this a series of SNP site is respectively: the rs2625269 pleomorphism site is A, and the rs1976041 pleomorphism site is G; The rs1905261 pleomorphism site is A, and the rs1905262 pleomorphism site is A, and the rs2705455 pleomorphism site is G; The rs1483041 pleomorphism site is A, and the rs2200168 pleomorphism site is C, and the rs716428 pleomorphism site is C; The rs990619 pleomorphism site is G; The rs1842896 pleomorphism site is T, and the rs2625245 pleomorphism site is G, and the rs1123037 pleomorphism site is T.
The third aspect is selected chr4q32 Regional Representative site rs1842896, in data analysis, uses linkage disequilibrium (Linkage disequilibrium, LD) situation between Haploview computed in software chromosomal region site.This zone rs1842896 pleomorphism site and rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs2625245, rs1123037 has strong linkage disequilibrium.Use FludigmEP1 gene alaysis system (FludigmEP1 simultaneously
TMGENETIC ANALYSIS system); Taqman MGB probe method is carried out gene type; Further in 15460 routine patients with coronary heart disease and 11472 routine check samples, verify; Merge all 16975 routine cases and 16491 check sample analyses and show the related more remarkable of rs1842896 and coronary heart disease, this result has confirmed that further the regional polymorphic site of chr4q32 and coronary heart disease are closely related.
Fourth aspect according to the above-mentioned and mononucleotide polymorphism site coronary disease susceptibility significant correlation, makes up relatively its frequency difference between patient and normal control of haplotype (haplotype), in order to the assessment coronary disease susceptibility.
The beneficial effect that the technical scheme that the embodiment of the invention provides is brought is:
The variation property of the haplotype that karyomit(e) 4q32 forms by the SNP site in one section contiguous GUCY1A3-GUCY1B3 gene region downstream and by series of SN-striking P site according to the present invention is judged the method for coronary heart disease Susceptible population; Can be to the crowd of the early stage clinical symptom of coronary heart disease not occurring; Especially the coronary heart disease high risk population who has conventional risk factors; There is not the fast and convenient examination of wound; Early discovery coronary heart disease susceptible object, and take corresponding hygienic measures, reduce the sickness rate of coronary heart disease and myocardial infarction.
Also can scientific basis be provided according to the present invention for researching and developing coronary heart disease gene therapy targetedly.The present invention further detects gene expression regulation, protein function; The mechanism of causing a disease of further investigation coronary heart disease; Development of new medicine and gene therapy realize having established important foundation based on the individuation diagnosis and treatment of genetic background, and bring important medical health-benefiting and economic benefit.
Description of drawings
Fig. 1 is the correlation diagram of determined chr4q32 region S NP site and coronary heart disease among the embodiment 1.
Fig. 2 is in the detection in the repeated authentication stage of embodiment 2, wherein the representative site rs1842896 gene type of 96 samples (94 samples to be tested and 2 negative controls) dendrogram as a result;
Fig. 3 carries out the sectional drawing of gene type to the representative site rs1842896 of described 96 samples of Fig. 2 (94 samples to be tested and 2 negative controls) for using SNP Genotyping Analysis softgware version 3.0 softwares;
Fig. 4 is that described 96 samples of Fig. 2 (94 samples to be tested and 2 negative controls) are represented the site rs1842896 gene type sectional drawing of derived data as a result.
Among Fig. 1: X-coordinate " Position on chr " is the position (Mb of unit) on the karyomit(e); Ordinate zou is a mononucleotide polymorphism site and the related significance P value (log10 (p-value)) of coronary heart disease, and right side Recombination rate is a recombination fraction, unit (CM/Mb); Represent site rs1842896 with ◆ the expression.
Among Fig. 2: the X axle is represented the VIC fluorescence intensity, and the Y axle is represented FAM fluorescence; Genotype result: red 1 is the G/G homozygote, and green 2 is the T/T homozygote, and blue 3 is the G/T heterozygote, black 4 negative contrasts (NTC).
Wherein: X-coordinate X:Allele is an allelotrope, and VIC-MGB represents VIC fluorescent mark MGB probe; Ordinate zou Y:Allele is an allelotrope, and FAM-MGB is a FAM fluorescent mark MGB probe; Expression SNP site, top, call rate are the genotypic confidence level of automatic differentiation that software provides for this site recall rate, Auto Confidence on this chip; The EP1 chip title of below Chip Run Name for adopting in the experiment.
Embodiment
For making the object of the invention, technical scheme and advantage clearer, do to describe in detail further in the face of embodiment of the present invention down.
One, method
At first in Chinese han population, choose the normal artificial research object of 1515 routine patients with coronary heart disease and 5019 examples.Use full genome chip (the Affymetrix Axiom of Affymetrix company
TMGenome-Wide CHB 1 Array Plate) detects by Shanghai Communications University BIO-X center.Obtain the genotype data of 1515 routine patients with coronary heart disease and the full genome chip SNP of 5019 routine normal peoples.Obtain the related significance level in each site (P value) in the SNP chip through related (GWAS) analytical calculation of full genome with coronary heart disease; According to significance level (the P value is less than 0.001) find out with coronary heart disease between have potential related chromosomal region, and obtain coronary disease susceptibility significantly related mononucleotide polymorphism site and allelotrope thereof.Adopt plink software to carry out logistic regression analysis each SNP site of assessment significance related during statistical study with coronary heart disease; Calculate dangerous allelic relative risk (Odds ratio; OR) and 95% credibility interval; Directly obtain OR value, credibility interval and P value in the analysis, thereby obtain the dangerous allelotrope in said site.
Two, case and check sample inclusion criteria
The coronary heart disease case comprises myocardial infarction patient and patient with angina pectoris, and the selected Case definition of myocardial infarction case is Acute Myocardial Infarction Case definition (according to WHO a Case definition in 1979): promptly the typical chest pain symptom duration is more than 30 minutes; Continuous 2 the ST sections of leading of electrocardiogram(ECG are raised (limb leads 0.1mv, chest leads 0.2mv) and serial dynamic change are arranged; The serum marker substrate concentration of myocardial necrosis raises, and raises like troponin (TNT/TNI), and myocardium isozyme (CK-MB) raises greater than high 2 times of limitting of normal value.The selected Case definition of stenocardia case surpasses 70% for finding that through coronary angiography at least one main branch of coronary artery is narrow.Valvular heart disease, congenital heart disease, heart failure, serious kidney and hepatic diseases, secondary hypertension, myocardosis, familial hypercholesterolemia and suspicious patients with coronary heart disease except each item inspection.The control group inclusion criteria: previously there are not coronary heart disease or other Atheromatosis histories, no pectoralgia, cardiac symptom such as uncomfortable in chest, electrocardiogram(ECG does not have obvious ischemic change.Case group and control group are Chinese han population, and consanguinity-less relation.
Three, test crowd's essential characteristic
The test crowd is that its essential characteristic of chip detection sample is as shown in table 1:
Table 1:
Four, result
Find to be positioned at karyomit(e) 4q32 through full genome related (GWAS) analysis and go up series of SN-striking P site (rs2625269, rs1976041, rs1905261 in one section close linkage zone of GUCY1A3-GUCY1B3 gene region downstream 76kb; Rs1905262, rs2705455, rs1483041; Rs2200168, rs716428, rs990619; Rs1842896; Rs2625245, rs1123037) with coronary disease susceptibility significant correlation (referring to Fig. 1), the association results of itself and coronary heart disease is as shown in table 2.
This a series of SNP site and allelotrope thereof are: rs2625269, allelotrope are A/G; Rs1976041, allelotrope are A/G; Rs1905261, allelotrope are A/C; Rs1905262, allelotrope are A/T; Rs2705455, allelotrope are G/A; Rs1483041, allelotrope are A/G; Rs2200168, allelotrope are C/T; Rs716428, allelotrope are C/T; Rs990619, allelotrope are G/C; Rs1842896, allelotrope are G/T; Rs2625245, allelotrope are A/G; Rs1123037, allelotrope are A/T.Wherein dangerous allelotrope is respectively: the rs2625269 pleomorphism site is A, and the rs1976041 pleomorphism site is G, and the rs1905261 pleomorphism site is A; The rs1905262 pleomorphism site is A, and the rs2705455 pleomorphism site is G, and the rs1483041 pleomorphism site is A; The rs2200168 pleomorphism site is C, and the rs716428 pleomorphism site is C, and the rs990619 pleomorphism site is G; The rs1842896 pleomorphism site is T, and the rs2625245 pleomorphism site is G, and the rs1123037 pleomorphism site is T.(seeing table 2).Carry these dangerous allelic individual relative risks that coronary heart disease take place and be do not have the carrier 1.22-1.24 doubly.Wherein rs1842896 pleomorphism site T allelotrope carrier's incidence of coronary heart disease risk is 1.23 times of the allelic carrier of G (OR=1.23,95%CI:1.11-1.37), the P value is (seeing table 2) significantly.
The association results of table 2.Chr4q32 region S NP site and coronary heart disease
The chromosomal region band that this pleomorphism site belongs to is represented in wherein " zone "; " Risk allele ", expression risk allelotrope; " Other allele ", expression is with reference to allelotrope; " gene frequency " is the risk gene frequency." OR (95%CI) " representes to compare with carrying the allelic individuality of reference, carries the allelic individual relative risk that coronary heart disease takes place of risk.Chromosome position is with reference to Human Genome NCBI Build36.
One, method
(Linkage disequilibrium, LD) situation is used r to linkage disequilibrium between the chromosomal region mononucleotide polymorphism site of use Haploview computed in software embodiment 1 gained
2Expression (0-1).Select wherein to have the representative site of strong linkage disequilibrium, further in 15460 routine patients with coronary heart disease and 11472 routine check samples, verify that the method for checking is to use FludigmEP1 gene alaysis system (FludigmEP1
TMGENETIC ANALYSIS system); Taqman MGB probe method is carried out gene type to 15460 cases and 11472 check samples; The somatotype result who merges all 16975 routine cases and 16491 check samples; Analyze its related with coronary heart disease, confirm the most significant related representative mononucleotide polymorphism site with coronary disease susceptibility.
Two, case and check sample inclusion criteria
Case is said identical with embodiment 1 with the check sample inclusion criteria.
Three, test crowd's essential characteristic
The test crowd attaches most importance to and reviews the card sample, and its essential characteristic is as shown in table 3:
Table 3:
Four, result
In the mononucleotide polymorphism site related with coronary disease susceptibility, rs1842896 pleomorphism site and rs2625269, rs1976041; Rs1905261, rs1905262, rs2705455; Rs1483041, rs2200168, rs716428; Rs990619, rs2625245, rs1123037 have strong linkage disequilibrium (r
2>0.8, see table 4).
Show 4.Chr4q32 zone rs1842896 and concern (r with regional SNP site linkage disequilibrium
2)
| The SNP polymorphic site | The zone | Chromosome position | r 2 |
| rs2625269 | 4q32.1 | 156699160 | 1.00 |
| rs1976041 | 4q32.1 | 156705490 | 0.89 |
| rs1905261 | 4q32.1 | 156721728 | 1.00 |
| rs1905262 | 4q32.1 | 156721898 | 1.00 |
| rs2705455 | 4q32.1 | 156722307 | 1.00 |
| rs1483041 | 4q32.1 | 156722890 | 1.00 |
| rs2200168 | 4q32.1 | 156723970 | 0.89 |
| rs716428 | 4q32.1 | 156726319 | 0.89 |
| rs990619 | 4q32.1 | 156727128 | 1.00 |
| rs1842896 | 4q32.1 | 156730909 | 1.00 |
| rs2625245 | 4q32.1 | 156731096 | 1.00 |
| rs1123037 | 4q32.1 | 156734175 | 0.86 |
Chr4q32 zone rs1842896 pleomorphism site is further verified in 15460 routine patients with coronary heart disease and 11472 routine check samples, merges all 16975 routine cases and related more significantly (P=1.26 * 10 of 16491 check sample analyses demonstration rs1842896 with coronary heart disease
-11), this result has further confirmed Chr4q32 zone polymorphic site and coronary heart disease closely related (seeing table 5).
The association results of table 5.Chr4q32 Regional Representative site rs1842896 in 16975 routine cases and 16491 routine check samples
The chromosomal region band that this pleomorphism site belongs to is represented in wherein " zone "; " Risk Allele (Freq) ", expression risk allelotrope and gene frequency thereof." OR (95%CI) " representes to compare with carrying the allelic individuality of reference, carries the allelic individual relative risk that coronary heart disease takes place of risk.
Detect the method for susceptibility loci to the repeated authentication stage:
Experiment porch: Fludigm EP1 gene alaysis system (Fludigm EP1
TMGENETIC ANALYSIS system); This system is the high-throughput gene type system of U.S. chip Fludigm company exploitation, is made up of integrated fluid pipeline (IFC) chip, integrated fluid conduit controller (IFC controller), heat circulating system and fluorescent signal acquisition system (EP1 reader); Adopt the conventional reagent of Taqman gene type, can carry out gene type to 96 SNP sites of 96 samples or 48 SNP sites of 48 samples simultaneously; It is a kind of high-throughout open genetic analysis platform.Taqman MGB probe method comprises 96 SNP locus gene somatotype experiments of rs1842896.
One, instrument: Fludigm
EP1 (gene alaysis system)
Two, material:
1. reagent, sample:
*This primer and probe are equipped with according to the detection site that the user provides by supplier.ROX is a kind of optical dye.
Consumptive material:
| 96.96 gene typing chips | ?（96.96?Dynamic?Array(138X)） |
| 96 hole PCR plates and disposable shrouding film | ?（96well?plates?and?seal(one-off)） |
Three, experimental technique
(1) operation steps:
1. test fluid (Assay) preparation: on 96 hole PCR plates, prepare test mixing liquid (Assay mix) with reference to following table
| Component | Each well volume (μ l) |
| 40×Taqman?Genotyping?Assay | ?1.25 |
| 2×Assay?Loading?Reagent | 2.5 |
| ROX(50×) | 0.25 |
| DNase/RNase-free?water | 1.0 |
| TV | 5.0 |
After adding, cover disposable shrouding film, abundant mixing on the microwell plate vibrator, centrifugal 30 seconds of 2500～3000rpm on the microwell plate whizzer (about 500g cf-) places subsequent use on ice.
2. sample (sample) preparation: in 96 orifice plate PCR plates, with reference to following table:
After adding, cover disposable shrouding film, abundant mixing on the microwell plate vibrator, centrifugal about 30 seconds of 2500～3000rpm on the microwell plate whizzer (about 500g cf-) places subsequent use on ice.
3. application of sample and amplification procedure
Chip in integrated fluid conduit controller HX after the initialize, application of sample (the application of sample amount of Assay is 4.2 μ l/ holes, and the application of sample amount of Sample is 5.2 μ l/ holes).To add excellent chip and reappose in integrated fluid conduit controller HX, start " Load Mix (138X) " program, carry out separatory and mixing.
After said process is accomplished; Take out chip (in one hour) from integrated fluid conduit controller HX at once; Remove the blue pad pasting in chip back, chip is placed heat circulating system (Stand alone Thermo Cycler), start Thermo Cycler PCR appearance; Choose built-in program curing PROGTM96, carry out the PCR process.After PCR finishes, turn off PCR appearance below vacuum pump (Vacuum Pump), open PCR appearance upper cover, take off chip.
(2) data gathering: start fluorescent signal acquisition system (EP1 reader), application data acquisition software (
Data Collection Software version 3) image data.
(3) data analysis: using SNP Genotyping Analysis 3.0 softwares, carry out cluster analysis and reporter gene type according to the not homoallelic fluorescence signal intensity of mononucleotide polymorphic site.
Referring to Fig. 2, represent the VIC fluorescence intensity with the X axle, the Y axle is represented FAM fluorescence, carries out cluster according to the relative height of two kinds of fluorescent signals, and red 1 is the G/G homozygote, and green 2 is the T/T homozygote, and blue 3 is the GG/T heterozygote, black 4 negative contrasts (NTC); Referring to Fig. 3 is that on behalf of site rs1842896, using SNP Genotyping Analysis 3.0 softwares (Genotyping Analysis software version 3.0) carry out the sectional drawing of gene type to 96 samples (94 samples to be tested and 2 negative controls).The gene type result is with excel form output (referring to Fig. 4).
One, method
By 4q32 zone rs2625269, rs1976041, rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, the rs1123037 site makes up 4 kinds of haplotypes.According to 1515 cases of full genome chip acquisition and the genotype data of 5019 check samples; Analyze these SNP sites and haplotype frequency difference between patient and normal people of constituting of series of SN-striking P site thus, can draw the variation of each concrete base in site and by its haplotype difference formed and the relation of coronary disease susceptibility.The same Fludigm that uses
EP1
TMGENETIC ANALYSIS system, the TaqmanMGB probe method is carried out the gene type experiment to crowd to be checked, promptly can confirm coronary heart disease Susceptible population among the crowd.
Two, result
1, the association results of Chr4q32 region S NP haplotype and coronary heart disease
In above-mentioned 4 kinds of haplotypes, haplotype AGAAGACCGTGT and GACTAGTTCGAA are the most common in the crowd, and frequency is respectively 0.76 and 0.194.These two haplotypes are associated with the susceptibility of coronary heart disease, and there is significant difference (seeing table 6) in its frequency between patients with coronary heart disease and normal controls.The coronary heart disease risk haplotype is AGAAGACCGTGT, and the frequency in the coronary heart disease case is 0.7888, is higher than the frequency 0.753 of control group significantly.
The association results of table 6.Chr4q32 region S NP haplotype and coronary heart disease
* haplotype is respectively by rs2625269, rs1976041, and rs1905261, rs1905262, rs2705455, rs1483041, rs2200168, rs716428, rs990619, rs1842896, rs2625245, rs1123037 forms.Wherein, the P value is the significance level of haplotype in case-control medium frequency difference.
2, the assessment of coronary heart disease Susceptible population among the crowd
According to the association results of table 2.Chr4q32 region S NP site and coronary heart disease among the embodiment 1, and the association results of showing 6.Chr4q32 region S NP haplotype and coronary heart disease in the present embodiment, through using Fludigm
EP1
TMGENETIC ANALYSIS system, after Taqman MGB probe method records crowd's to be checked susceptibility loci, as the crowd who belongs to one of following characteristic is the Susceptible population of coronary heart disease: the rs2625269 pleomorphism site of GUCY1A3-GUCY1B3 gene region downstream 76kb is A in the karyomit(e) 4q32 zone, and the rs1976041 pleomorphism site is G; The rs1905261 pleomorphism site is A, and the rs1905262 pleomorphism site is A, and the rs2705455 pleomorphism site is G, and the rs1483041 pleomorphism site is A; The rs2200168 pleomorphism site is C, and the rs716428 pleomorphism site is C, and the rs990619 pleomorphism site is G; The rs1842896 pleomorphism site is T, and the rs2625245 pleomorphism site is G, and the rs1123037 pleomorphism site is T; And by the SNP site rs2625269 that is positioned at these gene region downstream 76kb, rs1976041, rs1905261; Rs1905262, rs2705455, rs1483041; Rs2200168, rs716428, rs990619; Rs1842896, rs2625245, the individuality of the haplotype AGAAGACCGTGT that rs1123037 forms.
Chr4q32 region S NP site sequence:
Shown in the SEQ ID NO.1 in the sequence table:
rs2625269?ATCATATATGGAATAAAGGAAAATAT[A/G]GGTAAAGATTTATACAATCTCAATA
Shown in the SEQ ID NO.2 in the sequence table:
rs1976041?TACATGTGATAAATGTTGTAGGTATC[A/G]GGATGGAAAATAAAGCTATTCTCTT
Shown in the SEQ ID NO.3 in the sequence table:
rs1905261?ggaacaagttgatttcagccctgatg[A/C]atgattttgaagggttcaaggccag
Shown in the SEQ ID NO.4 in the sequence table:
rs1905262?tatgaatgagcaagaaaaggagtttc[A/T]tgagatacaatatagtcctggtgaa
Shown in the SEQ ID NO.5 in the sequence table:
rs2705455?atatgatattagataagtcacgtgtt[g/a]ccgtaatttagaatttttttacctg
Shown in the SEQ ID NO.6 in the sequence table:
rs1483041?TGTGCAGGCTGCTGTAGCAGATTGCT[A/G]TGCATAAAGGCCATTAGCTTCTAGG
Shown in the SEQ ID NO.7 in the sequence table:
rs2200168?GAGCACAGGCAGGAAACTACGTAGCA[C/T]GTCAGGCTTTTGTTTATTTAACACC
Shown in the SEQ ID NO.8 in the sequence table:
rs716428?TTTACTTGCACCCTATTATACTCTTC[C/T]AGTTTGGTTGATAAGTTATGCAATT
Shown in the SEQ ID NO.9 in the sequence table:
rs990619?AAAGGACCGATATAGAGATCGAGGAA[G/C]TTATCACGAATCGTGTATCAACCGA
Shown in the SEQ ID NO.10 in the sequence table:
rs1842896?AGTATTATTTAAAATAGCACCAAAAT[G/T]CATTCCCTTAAAAGCACTAGTTATC
Shown in the SEQ ID NO.11 in the sequence table:
rs2625245?GAAAAATTTTATCTTTGTTCAAGAAA[A/G]TTACTGAGGGATAAATATAGTGTAA
Shown in the SEQ ID NO.12 in the sequence table:
rs1123037?ATGGAGGAGAGAAGACTGGGGAAAGA[A/T]GTGACATTAAATTGGCCATGAAGTT
The above is merely preferred embodiment of the present invention, and is in order to restriction the present invention, not all within spirit of the present invention and principle, any modification of being done, is equal to replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (4)
1. the mononucleotide polymorphism site of the susceptible zone chr4q32 related with coronary disease susceptibility; Said mononucleotide polymorphism site is a series of mononucleotide polymorphism sites that are positioned at the GUCY1A3-GUCY1B3 gene region downstream on the karyomit(e) 4q32; For: rs2625269, allelotrope are A/G; Rs1976041, allelotrope are A/G; Rs1905261, allelotrope are A/C; Rs1905262, allelotrope are A/T; Rs2705455, allelotrope are G/A; Rs1483041, allelotrope are A/G; Rs2200168, allelotrope are C/T; Rs716428, allelotrope are C/T; Rs990619, allelotrope are G/C; Rs1842896, allelotrope are G/T; Rs2625245, allelotrope are A/G; Rs1123037, allelotrope are A/T.
2. mononucleotide polymorphism site according to claim 1, the dangerous allelotrope in wherein said series of SN-striking P site is respectively: the rs2625269 pleomorphism site is A, the rs1976041 pleomorphism site is G; The rs1905261 pleomorphism site is A, and the rs1905262 pleomorphism site is A, and the rs2705455 pleomorphism site is G; The rs1483041 pleomorphism site is A, and the rs2200168 pleomorphism site is C, and the rs716428 pleomorphism site is C; The rs990619 pleomorphism site is G; The rs1842896 pleomorphism site is T, and the rs2625245 pleomorphism site is G, and the rs1123037 pleomorphism site is T.
3. mononucleotide polymorphism site according to claim 1 and 2, the most significant wherein related with coronary disease susceptibility representative mononucleotide polymorphism site is: rs1842896.
4. mononucleotide polymorphism site according to claim 1 and 2 is used to assess the purposes of coronary disease susceptibility, it is characterized in that, said coronary heart disease comprises myocardial infarction and stenocardia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210201464.XA CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210186553.1 | 2012-06-07 | ||
| CN201210186553 | 2012-06-07 | ||
| CN201210201464.XA CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102747076A true CN102747076A (en) | 2012-10-24 |
| CN102747076B CN102747076B (en) | 2014-12-24 |
Family
ID=47027567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210201464.XA Active CN102747076B (en) | 2012-06-07 | 2012-06-15 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747076B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404044A (en) * | 2014-12-04 | 2015-03-11 | 广东医学院 | Detection method and applications for single nucleotide polymorphisms in exon region of ANRIL (Antisense Noncoding RNA in the INK4 Locus) gene related to susceptibility of coronary artery disease |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| CN101294195A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | Coronary disease testing method and reagent kit |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
-
2012
- 2012-06-15 CN CN201210201464.XA patent/CN102747076B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634963A (en) * | 2003-12-30 | 2005-07-06 | 中国医学科学院阜外心血管病医院 | Coronary disease related gene, its detection method and use thereof |
| CN101294195A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | Coronary disease testing method and reagent kit |
| CN101294201A (en) * | 2007-04-27 | 2008-10-29 | 上海人类基因组研究中心 | coronary disease testing method and reagent kit |
Non-Patent Citations (3)
| Title |
|---|
| MARK D. SHRIVER, ET AL.: "Large-scale SNP analysis reveals clustered and continuous patterns of human genetic variation", 《HUMAN GENOMICS》, vol. 2, no. 2, 30 June 2005 (2005-06-30), pages 81 - 89, XP021126848, DOI: doi:10.1186/1479-7364-2-2-81 * |
| 杨英等: "冠心病全基因组关联研究进展", 《遗传》, vol. 32, no. 2, 28 February 2010 (2010-02-28), pages 97 - 104 * |
| 王晓玲等: "PON 基因簇潜在功能多态位点与冠心病的关联研究", 《遗传学报》, vol. 32, no. 7, 31 July 2005 (2005-07-31), pages 675 - 681 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404044A (en) * | 2014-12-04 | 2015-03-11 | 广东医学院 | Detection method and applications for single nucleotide polymorphisms in exon region of ANRIL (Antisense Noncoding RNA in the INK4 Locus) gene related to susceptibility of coronary artery disease |
| CN104404044B (en) * | 2014-12-04 | 2018-04-27 | 广东医学院 | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102747076B (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102757954B (en) | Combination of multiple genetic single nucleotide polymorphisms related to coronary heart disease and application of combination | |
| Povel et al. | Single nucleotide polymorphisms (SNPs) involved in insulin resistance, weight regulation, lipid metabolism and inflammation in relation to metabolic syndrome: an epidemiological study | |
| Lotta | Genome-wide association studies in atherothrombosis | |
| CN102876793B (en) | Application of single nucleotide polymorphism rs2058660 to detecting susceptibility gene of leprosy | |
| Kelley et al. | A new era in liquid biopsy: from genotype to phenotype | |
| Hotta et al. | INSIG2 gene rs7566605 polymorphism is associated with severe obesity in Japanese | |
| Jain et al. | Multiplex quantitative fluorescent polymerase chain reaction for detection of aneuploidies | |
| CN102747072B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof | |
| CN102899413A (en) | Application of single nucleotide polymorphisms of rs2735591 in detection of leprosy susceptibility genes | |
| Pankuweit et al. | The HLA class II allele DQB1* 0309 is associated with dilated cardiomyopathy | |
| CN109295229A (en) | Detection method is sequenced in the SNP fluorescence in situ hybridization of ABCB1 and SLCO1B1 | |
| Cui et al. | Development of a high resolution melting method for genotyping of risk HLA-DQA1 and PLA2R1 alleles and ethnic distribution of these risk alleles | |
| Zee et al. | Haplotype analysis of the β2 adrenergic receptor gene and risk of myocardial infarction in humans | |
| CN102747076B (en) | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof | |
| Chokkalingam et al. | Fetal growth and body size genes and risk of childhood acute lymphoblastic leukemia | |
| CN102747073B (en) | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr2p24, and applications thereof | |
| CN106520987A (en) | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients | |
| Siller-López et al. | Association of paraoxonase-1 Q192R (rs662) single nucleotide variation with cardiovascular risk in coffee harvesters of central Colombia | |
| Mani | Local ancestry association, admixture mapping, and ongoing challenges | |
| CN101575641B (en) | Method for detecting fluorescence quantitative PCR genotypes of predisposing genes of hepatic cell carcinoma and kit thereof | |
| Dissanayake et al. | Prevalence of genetic thrombophilic polymorphisms in the Sri Lankan population—implications for association study design and clinical genetic testing services | |
| Bielinski et al. | Circulating soluble ICAM-1 levels shows linkage to ICAM gene cluster region on chromosome 19: the NHLBI Family Heart Study follow-up examination | |
| Reinhard et al. | Association between PPAR α gene polymorphisms and myocardial infarction | |
| CN102757955B (en) | Tag single nucleotide polymorphism at 12# chromosome susceptible area related to coronary heart disease, and haplotype and application of tag single nucleotide polymorphism | |
| CN102747075B (en) | Coronary heart disease associated sixth chromosome susceptible region tagging single nucleotide polymorphism sites, haplotypes thereof, and applications of sites and haplotypes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |