CN102719459B - Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase - Google Patents
Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase Download PDFInfo
- Publication number
- CN102719459B CN102719459B CN201210141944.1A CN201210141944A CN102719459B CN 102719459 B CN102719459 B CN 102719459B CN 201210141944 A CN201210141944 A CN 201210141944A CN 102719459 B CN102719459 B CN 102719459B
- Authority
- CN
- China
- Prior art keywords
- beta
- glucancellobio
- gene
- hydrolase
- glucosidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the method for producing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase.Belong to biological technical field.First clone's wood is mould glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and beta-glucosidase gene; Build the subtilis expression vector containing these three kinds of enzyme gene expression frameworks and yeast expression vector; Expression vector is transformed corresponding Host Strains; Screen the subtilis recon of high expression level endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase and pichia spp recon respectively as engineering bacteria.Restructuring mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase that fermenting B. subtilis engineering bacteria and Pichia yeast engineering are produced.The invention solves by the low key issue of the production of enzyme left in Natural strains production mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, be conducive to the price reducing its enzyme product.
Description
Technical field
The invention belongs to biological technical field, relate to the method building microbial engineering bacteria Restruction albumen.Specifically using microbe engineering bacteria Restruction mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase.
Background technology
Endoglucanase (endo-1,4-β-D-glucanase), 1,4-BETA-D-glucancellobio-hydrolase (exo-1,4-β-D-glucanase) and beta-glucosidase (β-glucosidase) have the cellulosic effect of united hydrolysis.Mierocrystalline cellulose is made up of glucose molecule.Endoglucanase (endo-1,4-β-D-glucanase) acts on the noncrystalline domain of Mierocrystalline cellulose inside, and random hydrolysis β-Isosorbide-5-Nitrae-glycosidic link, by the brachymemma of long chain cellulose molecule, produces the small molecules Mierocrystalline cellulose of a large amount of non reducing end.1,4-BETA-D-glucancellobio-hydrolase acts on Mierocrystalline cellulose linear molecule end, cuts next cellobiose molecule successively; Cellobiose is hydrolyzed into glucose molecule by beta-glucosidase.Namely, at endoglucanase, under the combined action of 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, cellulose hydrolysis is glucose molecule.Endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase are widely used in feed, cellulosic ethanol, and the fields such as food, weaving and environmental sanitation industry, have huge market potential.Current endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucoside enzyme product are the bacterial strains (bacterium, actinomycetes and filamentous fungus) deriving from natural cellulase-producing.But because bacteriogenic endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase are present in born of the same parents with inclusion bodies, product is difficult to purifying; And actinomycetes and filamentous fungus poor growth, nutritional requirement is higher, secretion self albumen a large amount of, and be difficult to purifying, production cost is higher.In the last few years, report was had to express restructuring endoglucanase or 1,4-BETA-D-glucancellobio-hydrolase or beta-glucosidase successively.Owing to quoting strong promotor, the strategy selected the good Host Strains of production performance and take gene multiple copied to recombinate, can improve the expression amount of recombinase more significantly.But the not endoglucanase of industrial demand or 1,4-BETA-D-glucancellobio-hydrolase or beta-glucosidase, but the mixed enzyme of endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase.Current market still there is no the mixed enzyme product of the mixing endoglucanase of recombinant production, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, if with the existing engineering bacteria manufacture order enzyme containing endoglucanase or 1,4-BETA-D-glucancellobio-hydrolase or beta-glucosidase, and then these enzymes are carried out mixing application, its complex procedures, cost is high.
Subtilis and pichia spp are all the Host Strains being usually used in Restruction albumen, but respectively have feature.The principal character of pichia spp is the purifying that the few oneself protein of secretion is conducive to expression product; Subtilis has amphimicrobian characteristic, can ferment, also can ferment at the environment of anaerobic having the environment wanting oxygen.
Summary of the invention
The present invention builds the subtilis engineering bacteria containing mould glucose incision enzyme gene expression framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and the beta-glucosidase gene expression framework of wood and the Pichia yeast engineering of expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework containing wooden mould glucose incision enzyme gene; Express the subtilis engineering bacteria of framework with expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene containing the mould glucose incision enzyme gene of wood and express framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene containing the glucose incision enzyme gene that wood is mould and express the Pichia yeast engineering Restruction mixing endoglucanase of framework, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase.
The technical solution adopted in the present invention is:
1. clone gene: clone endoglucanase from reesei gene group, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase gene.
2. obtain promotor, recombination sequence, signal peptide, transcription terminator sequences and the resistance gene sequences of construction of expression vector.
3. build two kinds of expression vectors as accompanying drawing 1 and accompanying drawing 2.
4. express what build above the Bacillus subtilus expression vector Transforming B. subtilis of framework, glycan excision enzyme gene expression construct and beta-glucosidase gene expression framework, glucose incision enzyme gene expression framework, glycan excision enzyme gene expression construct and the beta-glucosidase gene mould containing wood are expressed the yeast expression vector conversion pichia spp genome of framework containing wooden mould glucose incision enzyme gene by electric method for transformation.The recon of screening high expression level endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase is as engineering bacteria.
5. fermentation expresses containing the glucose incision enzyme gene that wood is mould subtilis engineering bacteria and Pichia yeast engineering Restruction mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and the beta-glucosidase that framework, glycan excision enzyme gene expression construct and beta-glucosidase gene express framework.
The present invention build containing the mould glucose incision enzyme gene of wood express framework, glycan excision enzyme gene expression construct and beta-glucosidase gene express the subtilis engineering bacteria of framework and the advantage applies of Pichia yeast engineering Restruction mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase in:
(1) replacing Natural strains with engineering bacteria and produce endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, improving the output of enzyme by increasing gene copy number.
(2) produce enzyme with the engineering bacteria that the engineering bacteria containing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase gene replaces containing single enzyme gene, produce endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase with a fermentation procedure simultaneously and instead of with three operations difference Restruction endoglucanases or 1,4-BETA-D-glucancellobio-hydrolase or beta-glucosidase.Save starting material, energy consumption and manpower.
(3) subtilis and pichia spp each tool feature in Restruction albumen, the present invention builds respectively and expresses containing the glucose incision enzyme gene that wood is mould subtilis engineering bacteria and the Pichia yeast engineering that framework, glycan excision enzyme gene expression construct and beta-glucosidase gene express framework, and producing for its recombinase provides two kinds of bacterial strains to select.
Accompanying drawing explanation
Accompanying drawing 1. expresses containing the glucose incision enzyme gene that wood is mould the Bacillus subtilus expression vector that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
P. glyceraldehyde 3-phosphate dehydrogenase (GAP) promotor of bacillus megaterium; S. alpha factor signal peptide; Genel. wooden mould glucose incision enzyme gene; Gene2. wooden mould glycan excision enzyme gene; Gene3. wooden mould beta-glucosidase gene; TT. transcription terminator sequences; G418.G418 resistant gene (being applied to screening subtilis recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screening escherichia coli transformant); B.subtilisrDNA. the rDNA sequence of subtilis.
Accompanying drawing 2. expresses containing the glucose incision enzyme gene that wood is mould the yeast expression vector that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
P. glyceraldehyde 3-phosphate dehydrogenase (GAP) promotor of pichia spp; S. alpha factor signal peptide; Gene1. wooden mould glucose incision enzyme gene; Gene2. wooden mould glycan excision enzyme gene; Gene3. wooden mould beta-glucosidase gene; TT. transcription terminator sequences; G418.G418 resistant gene (being applied to screening pichia spp recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screening escherichia coli transformant); P.pastorisrDNA. the rDNA sequence of pichia spp.
Embodiment
The invention will be further described to use nonlimiting examples below.
Embodiment 1:
1.1 build the subtilis expression vector of expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework containing the glucose incision enzyme gene that wood is mould
1.1.1 cloning vector is built
Synthesized the DNA double chain of two base complementrities containing penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin by DNA sequence dna Synesis Company of specialty, and form sticky end at the two ends of every bar DNA chain-ordering.Make its cyclisation by the effect of DNA ligase, form DNA cloning vector.By its cloning vector called after pBCL.
1.1.2 with glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and β alpha-glucosidase gene that reverse transcription PCR amplification wood is mould
Synthesize following primer:
Primer a:5 ' tc
gaattcccgaattccagcagaetg3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer b:5 ' tt
gCGGCCGCatgcggccgcctactttc3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Primer c:5 ' gc
gaattcccgaattccaagcttgct3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer d:5 ' aa
gCGGCCGCcagcggccgcttacaggaa3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Primer e:5 ' cc
gaattcgcgctacgtagttgtacct3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer f:5 ' ta
gcggccgcataagcggccgcctac3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Application RNA extracts test kit and extracts the mould total serum IgE of wood, and application cDNA synthetic agent box synthesizes its cDNA.With the mould cDNA of the wood of above-mentioned synthesis for template, application primer a and primer b carries out pcr amplification, and the PCR primer of acquisition proves the mould glucose incision enzyme gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides; With the mould cDNA of the wood of above-mentioned synthesis for template, application primer c and primer d carries out pcr amplification, and the PCR primer of acquisition proves the mould 1,4-BETA-D-glucancellobio-hydrolase gene order of wood through sequential analysis with the BLAST software analysis that NCBI provides; With the mould cDNA of the wood of above-mentioned synthesis for template, application primer e and primer f carries out pcr amplification, and the PCR primer of acquisition proves the mould β alpha-glucosidase gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides.
1.1.3 above-mentioned various enzyme gene expression framework is built respectively
1.1.3.1 the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification bacillus megaterium (Bacillusmegaterium) is used.
Primer 1:
5’CC
TACGTAGATCCATTATCGGTGAACCA3’
Primer 2:
5’GG
GCATGCGGGTATTTCCTCCTTGAATGT3’
[illustrating: 8 bases that primer 5 ' is held are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Extract genomic dna [the huge Bacillus subtilis genes group DNA extraction method: B. subtilis cell is added on the helicase solution (sorbyl alcohol of helicase 1mol/L dissolves) of 9mg/ml in 30 DEG C of joltings 30 minutes of bacillus megaterium, then bacterial genomes DNA extraction method conveniently extracts its genomic dna], application primer 1 and primer 2 carry out pcr amplification, PCR primer is through sequencing and prove the promoter sequence of bacillus megaterium glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), what do not have underscore is glyceraldehyde 3-phosphate dehydrogenase promoter sequence]:
CCTACGTAGATCCATTATCGGTGAACCATCTATTAAAGACATGCTTCATTTAATTAAGTCCGCTGGTATGGTTGTTCACGGAATAGGAGACGCTATGACAATGGCAGAACGCCGTAAAACACCACAAGCAGACTTAGAAAAAGTGAAAAATGGACATGCTGTAGGTGAGGCATTTGGATACTATTTTAATCATCAAGGCGAAGTTGTTCATAAAGTTAAAACAGTTGGCATACAACTCGATGATTTAAAGAACAATAAATGTGTTATTGCTGTTGCAGGAGGTTCATCAAAAGCAAAGGCAATTAAAGCGTTTATGCAACAAGCGCATGATTCGATTCTCATTACAGATGAAGGCGCCGCAAAAGAGTTAGTAAGGGATTTTAATTAATCCCTCATATAAAAAATACTTTTTACATTCAAGGAGGAAATACCC
GCATGCCC
1.1.3.2 alpha factor signal peptide [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is alpha factor signal peptide sequence] is synthesized by DNA sequence dna Synesis Company of specialty:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
1.1.3.3 transcription terminator sequences [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is transcription terminator sequences] is synthesized by DNA sequence dna Synesis Company of specialty:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
1.1.3.4 following G418 resistance gene sequences [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistance gene sequences] is synthesized by gene SOEing method
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
1.1.3.5 to increase from Bacillus subtilis genes group rDNA sequence with PCR
Primer 1:5 ' CC
gGTACCgacgaacgctggcggcgtgc3 '
Primer 2: 5 ' CC
tTCGAAgcaccttccgatacggctacct3 '
[illustrating: 8 bases that primer 5 ' is held are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Extract Bacillus subtilis genes group DNA (Bacillus subtilis genes group DNA extraction method is with above-described bacillus megaterium genome DNA extracting method), be that template application primer 1 and primer 2 carry out pcr amplification with genomic dna, the PCR primer of acquisition is through sequential analysis and the rDNA sequence proving Bacillus subtilis genes group with the BLAST software analysis that NCBI provides.
1.1.3.6 framework establishment (promotor-signal peptide-gene-transcription terminator sequences) process is expressed:
D. build glucose incision enzyme gene and express framework:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the multiple clone site of pBCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pBCL carrier, and is located at the downstream of promoter sequence; Glucose incision enzyme gene sequence mould for wood is reconstituted in the multiple clone site of pBCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pBCL carrier, and is located at gene order downstream.This carrier of expressing framework containing glucose incision enzyme gene is called pBCL1.
E. 1,4-BETA-D-glucancellobio-hydrolase gene expression construct is built:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the multiple clone site of pBCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pBCL carrier, and is located at the downstream of promoter sequence; 1,4-BETA-D-glucancellobio-hydrolase gene order mould for wood is reconstituted in the multiple clone site of pBCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pBCL carrier, and is located at gene order downstream.This carrier containing 1,4-BETA-D-glucancellobio-hydrolase gene expression construct is called pBCL2.
F. build β alpha-glucosidase gene and express framework:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the multiple clone site of pBCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pBCL body, and is located at the downstream of promoter sequence; β alpha-glucosidase gene sequence mould for wood is reconstituted in the multiple clone site of pBCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pBCL carrier, and is located at gene order downstream.This carrier of expressing framework containing β alpha-glucosidase gene is called pBCL3.
1.1.4 the structure of expression vector is completed
1.1.4.1 3 covers are expressed framework and be assembled in same cloning vector.
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, cut pBCL2, and the expression framework of pBCL3 carrier, and this two cover cut is expressed the multiple clone site that framework is inserted in pBCL1 successively.This carrier is called pBCL123.
1.1.4.2 by the effect of DNA restriction enzyme and T4DNA ligase enzyme successively by the rDNA (DNA recombination sequence) of subtilis and G418 gene recombination in the multiple clone site of pBCL123 carrier.Form and express containing the glucose incision enzyme gene that wood is mould the subtilis expression vector (accompanying drawing 1) that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
1.2 build the subtilis engineering bacteria of expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework containing the glucose incision enzyme gene that wood is mould.
The glucose incision enzyme gene mould containing wood is expressed the subtilis expression vector transforming B bacillus that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework by electricity consumption method for transformation, subtilis through electric transformation is coated G418-LB (1% Tryptones, 0.5% yeast extract, 1% sodium-chlor, 1.5% agar powder, final concentration is the G418 of 700 μ g/ml) dull and stereotyped, grow bacterium colony (recon) after cultivating 3 days at 37 DEG C.Apply above-described glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and beta-glucosidase gene special primer respectively, with recon genomic dna for template, carry out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and carries out sequencing to its PCR primer and prove the genome that has been reconstituted in of mould glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and the beta-glucosidase gene of its wood.The recon that the also process gene specific primer being grown on G418 resistant panel carries out PCR checking is carried out shake flask fermentation 2 days at 37 DEG C respectively, the endoglucanase of fermented liquid supernatant, 1,4-BETA-D-glucancellobio-hydrolase and activity of beta-glucosidase is measured by ordinary method, according to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level expresses as the glucose incision enzyme gene mould containing wood the subtilis engineering bacteria that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
1.3 Restruction mixing endoglucanases, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase
The subtilis engineering bacteria of the glucose incision enzyme gene mould containing wood being expressed framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework is inoculated in LB (1% Tryptones, 0.5% yeast extract, 1% sodium-chlor) liquid nutrient medium, be distributed into 3 bottles, 37 DEG C of fermentations 2 days; By natural product endoglucanase, the wood of 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase mould (i.e. 1.1.2 be applied to the wood of amplification gene mould) is inoculated in conventional fungi culture medium (murphy juice 200g/L, glucose 20g/L), be distributed into 3 bottles, 30 DEG C of fermentations 3 days.Centrifuging and taking supernatant.Analyze fermented liquid supernatant to the hydrolytic action (table 1) of carboxymethyl cellulose.Analyze by the result of statistical otherness his-and-hers watches 1, result shows that expressing containing wooden mould glucose incision enzyme gene the fermented liquid supernatant that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express the subtilis engineering bacteria of framework is significantly better than natural product endoglucanase to the glucogenic effect of cellulose hydrolysis, and the mould fermented liquid supernatant of the wood of 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase is to cellulosic effect (P<0.01).
Table 1. fermented liquid supernatant and carboxymethyl cellulose effect generate glucose content measurement result
Illustrate: the polarimetry that glucose content mensuration is conventional.
Embodiment 2:
2.1 build the yeast expression vector of expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework containing the glucose incision enzyme gene that wood is mould
2.1.1 cloning vector is built
Synthesized the DNA double chain of two base complementrities containing penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin by DNA sequence dna Synesis Company of specialty, and form sticky end at the two ends of every bar DNA chain-ordering.Make its cyclisation by the effect of DNA ligase, form DNA cloning vector.By its cloning vector called after pPCL.
2.1.2 with glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and β alpha-glucosidase gene that reverse transcription PCR amplification wood is mould
Synthesize following primer:
Primer a:5 ' tc
gaattcccgaattccagcagactg3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer b:5 ' tt
gCGGCCGCatgcggccgcctactttc3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Primer c:5 ' gc
gaattcccgaattccaagcttgct3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer d:5 ' aa
gCGGCCGCcagcggccgcttacaggaa3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Primer e:5 ' cc
gaattcgcgctacgtagttgtacct3 ' [illustrating: 5 ' 8 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 6 bases of underscore)]
Primer f:5 ' ta
gcggccgcataagcggccgcctac3 ' [illustrating: 5 ' 10 bases of holding are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (having 8 bases of underscore)]
Application RNA extracts test kit and extracts the mould total serum IgE of wood, and application cDNA synthetic agent box synthesizes its cDNA.With the mould cDNA of the wood of above-mentioned synthesis for template, application primer a and primer b carries out pcr amplification, and the PCR primer of acquisition proves the mould glucose incision enzyme gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides; With the mould cDNA of the wood of above-mentioned synthesis for template, application primer c and primer d carries out pcr amplification, and the PCR primer of acquisition proves the mould 1,4-BETA-D-glucancellobio-hydrolase gene order of wood through sequential analysis with the BLAST software analysis that NCBI provides; With the mould eDNA of the wood of above-mentioned synthesis for template, application primer e and primer f carries out pcr amplification, and the PCR primer of acquisition proves the mould β alpha-glucosidase gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides.
2.1.3 various enzyme gene expression framework is built respectively
2.1.3.1 the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification pichia spp is used.
Primer 1:
5’CC
TACGTAGGATCCTTTTTTGTAGAAATGTCTTGG3’
Primer 2:
5’GG
GCATGCTGTGTTTTGATAGTTGTTC3’
[illustrating: 8 bases that primer 5 ' is held are that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (wherein having 6 bases of underscore)]
Extracting pichia spp genomic dna, take genomic dna as template, and application primer 1 and primer 2 carry out pcr amplification, and PCR primer is through sequencing and the promoter sequence proving its glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides.[illustrate: pichia spp genome DNA extracting method: Pichia pastoris is added on the helicase solution (dissolving of helicase 1mo1/L sorbyl alcohol) of 9mg/ml in 30 DEG C of joltings 30 minutes, then bacterial genomes DNA extraction method conveniently extracts its genomic dna.]
2.1.3.2DNA sequent synthesis method synthesizes following alpha factor signal peptide [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is a factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
2.1.3.3DNA sequent synthesis method synthesizes following transcription terminator sequences [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is transcription terminator sequences]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
2.1.3.4 following G418 resistance gene sequences [what following sequence had underscore is that enzyme cuts protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistance gene sequences] is synthesized by gene SOEing method
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
2.1.3.5 pcr amplification rDNA sequence from pichia spp genome
PCR primer:
Primer 1:5 ' CC
gGTACCggcttccaggacgtatcgcggatcgctgcgttcttcatc3 '
Primer 2: 5 ' CC
tTCGAAagccccgtggcacacgaccaatcttcccagccgaca3 '
Illustrate: 8 bases that 5 ' of primer is held are that enzyme cuts protection base (2 bases) and enzyme discrimination bit (having 6 bases of underscore).
Extracting pichia spp genomic dna, take genomic dna as template, and application primer 1 and primer 2 carry out pcr amplification, and the PCR primer of acquisition proves the rDNA sequence in pichia spp genome through sequential analysis and the BLAST software analysis that provides with NCBI.
2.1.3.6 framework establishment (promotor-signal peptide-gene-transcription terminator sequences) process is expressed:
D. build glucose incision enzyme gene and express framework:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the multiple clone site of pPCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of promoter sequence; Glucose incision enzyme gene sequence mould for wood is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pPCL carrier, and is located at gene order downstream.This carrier of expressing framework containing glucose incision enzyme gene is called pPCL1.
E. 1,4-BETA-D-glucancellobio-hydrolase gene expression construct is built:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the multiple clone site of pPCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of promoter sequence; 1,4-BETA-D-glucancellobio-hydrolase gene order mould for wood is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pPCL carrier, and is located at gene order downstream.This carrier containing 1,4-BETA-D-glucancellobio-hydrolase gene expression construct is called pPCL2.
F. build β alpha-glucosidase gene and express framework:
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the multiple clone site of pPCL carrier; Alpha factor signal peptide DNA sequence dna is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of promoter sequence; β alpha-glucosidase gene sequence mould for wood is reconstituted in the multiple clone site of pPCL carrier, and is located at the downstream of signal peptide sequence; Transcription terminator sequences is reconstituted in the multiple clone site of pPCL carrier, and is located at gene order downstream.This carrier of expressing framework containing β alpha-glucosidase gene is called pPCL3.
2.1.4 the structure of expression vector is completed
2.1.4.1 3 covers are expressed framework and be assembled in same cloning vector.
By the effect of DNA restriction enzyme and T4DNA ligase enzyme, cut pPCL2, and the expression framework of pPCL3 carrier, and this two cover cut is expressed the multiple clone site that framework is inserted in pPCL1 successively.This carrier is called pPCL123.
2.1.4.2 by the effect of DNA restriction enzyme and T4DNA ligase enzyme successively by the rDNA sequence (DNA recombination sequence) of pichia spp and G418 gene recombination in the multiple clone site of pPCL123 carrier.Form and express containing the glucose incision enzyme gene that wood is mould the yeast expression vector (accompanying drawing 2) that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
2.2 build the Pichia yeast engineering of expressing framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework containing the glucose incision enzyme gene that wood is mould.
The glucose incision enzyme gene mould containing wood is expressed the yeast expression vector conversion pichia spp that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework by electricity consumption method for transformation, pichia spp through electric transformation is coated G418-YPD (2% peptone, 1% yeast extract, 2% glucose, 1.5% agar powder, final concentration is the G418 of 700 μ g/ml) dull and stereotyped, grow bacterium colony (recon) after cultivating 3 days at 30 DEG C.Apply above-described glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and beta-glucosidase gene special primer respectively, with recon genomic dna for template, carry out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and carries out sequencing to its PCR primer and prove that mould glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and the beta-glucosidase gene of its wood has been reconstituted in the genome of recon.The recon that the also process gene specific primer being grown on G418 resistant panel carries out PCR checking is carried out shake flask fermentation 2 days at 37 DEG C respectively, the endoglucanase of fermented liquid supernatant, 1,4-BETA-D-glucancellobio-hydrolase and activity of beta-glucosidase is measured by ordinary method, according to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level expresses as the glucose incision enzyme gene mould containing wood the Pichia yeast engineering that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework.
2.3 Restruction mixing endoglucanases, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase
The Pichia yeast engineering of the glucose incision enzyme gene mould containing wood being expressed framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene expression framework is inoculated in YPD (2% peptone, 1% yeast extract, 2% glucose) liquid nutrient medium, be distributed into 3 bottles, 30 DEG C of fermentations 2 days; By natural product endoglucanase, the wood of 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase mould (i.e. 2.1.2 be applied to the wood of amplification gene mould) is inoculated in conventional fungi culture medium (murphy juice 200g/L, glucose 20g/L), be distributed into 3 bottles, 30 DEG C of fermentations 3 days.Centrifuging and taking supernatant.Analyze fermented liquid supernatant to the hydrolytic action (table 2) of carboxymethyl cellulose.Analyze by the result of statistical otherness his-and-hers watches 2, result shows that expressing containing the mould glucose incision enzyme gene of wood the fermented liquid supernatant that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express the Pichia yeast engineering of framework is significantly better than natural product endoglucanase to the glucogenic effect of cellulose hydrolysis, and the mould fermented liquid supernatant of the wood of 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase is to cellulosic effect (P<0.01).
Table 2. fermented liquid supernatant and carboxymethyl cellulose effect generate glucose content measurement result
Illustrate: the polarimetry that glucose content mensuration is conventional.
Claims (2)
1. produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, it is characterized in that,
A. by Protocols in Molecular Biology clone wooden mould glucose incision enzyme gene, 1,4-BETA-D-glucancellobio-hydrolase gene and beta-glucosidase gene;
B. build subtilis and integrate composition secreted expression carrier and pichia spp integration composition secreted expression carrier, subtilis integrates the rDNA sequence containing subtilis on composition secreted expression carrier, containing the expression framework of the above three kinds of enzyme gene, and in expression framework, alpha factor signal peptide sequence containing pilot protein secretion, pichia spp integrates the rDNA sequence containing pichia spp on composition secreted expression carrier, containing the expression framework of the above three kinds of enzyme gene, and in expression framework, alpha factor signal peptide sequence containing pilot protein secretion,
C. subtilis integrated composition secreted expression carrier Transforming B. subtilis, pichia spp integrated composition secreted expression carrier conversion pichia spp, guide vector integration in Host Strains genome by the rDNA sequence on carrier, thus obtain subtilis recon and pichia spp recon;
D. the subtilis recon and the pichia spp recon that screen the above-described three kinds of enzymes of high expression level respectively express as containing glucose incision enzyme gene subtilis engineering bacteria and the Pichia yeast engineering that framework, 1,4-BETA-D-glucancellobio-hydrolase gene expression construct and beta-glucosidase gene express framework;
E. fermentation Restruction mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, under the guiding of signal peptide, the endoglucanase of engineering bacterium expression, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase are secreted into extracellular, and results are containing the restructuring mixing endoglucanase of engineering bacteria cell, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase.
2. the method for production endoglucanase according to claim 1,1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase, it is characterized in that, utilize method preparation restructuring mixing endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and the beta-glucoside enzyme product of production endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and the beta-glucosidase described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141944.1A CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141944.1A CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102719459A CN102719459A (en) | 2012-10-10 |
| CN102719459B true CN102719459B (en) | 2016-03-09 |
Family
ID=46945327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210141944.1A Active CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719459B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441464A (en) * | 2015-11-19 | 2016-03-30 | 江南大学 | System for codon optimization and pichia pastoris expression of genes of cellobiohydrolase II |
| CN108841810B (en) * | 2018-07-21 | 2021-08-27 | 湖北大学 | Multifunctional cellulase gene and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2277988A1 (en) * | 2008-04-14 | 2011-01-26 | Mitsui Chemicals, Inc. | Yeast for production of glucose, and method for production of glucose using the same |
| CN101463330A (en) * | 2009-01-12 | 2009-06-24 | 北京挑战生物技术有限公司 | Inocula producing cellulase and use thereof |
-
2012
- 2012-05-02 CN CN201210141944.1A patent/CN102719459B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102719459A (en) | 2012-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hooker et al. | Leveraging anaerobic fungi for biotechnology | |
| CN102286443B (en) | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN105802854B (en) | Cellulase high-yield strain and application thereof | |
| CN106566779A (en) | Recombinant yeast strain, construction method and application thereof | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN101631864A (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| CN102827820B (en) | Beta-glucosidase and application thereof | |
| Jain et al. | Performance evaluation of fungal cellulases with dilute acid pretreated sugarcane bagasse: a robust bioprospecting strategy for biofuel enzymes | |
| Chang et al. | A thermo-and toxin-tolerant kefir yeast for biorefinery and biofuel production | |
| CN110229804A (en) | A kind of limonene synzyme SynLS1 and its application | |
| Koeck et al. | Differences in biomass degradation between newly isolated environmental strains of Clostridium thermocellum and heterogeneity in the size of the cellulosomal scaffoldin | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN106978407A (en) | A kind of β glucuronidases and its gene and application | |
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN105624051B (en) | Wood-sugar fermentation yeast strain and construction method based on the building of evolution engineering | |
| CN103114099A (en) | Beta-glucosaccharase gene for coding glycosyl hydrolase family 1 and application thereof | |
| Qin et al. | Deciphering the efficient cellulose degradation by the thermophilic fungus Myceliophthora thermophila focused on the synergistic action of glycoside hydrolases and lytic polysaccharide monooxygenases | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN105567779A (en) | Fermentation method of high-yield and low-molecular-weight thermal gel | |
| CN101555491A (en) | Method for increasing yield of alcohol by saccharomyces cerevisiae ferment production | |
| CN104263744A (en) | Artificially modified glucose oxidase gene and expression application thereof | |
| CN103205403A (en) | Method for producing ligninolytic enzymes | |
| CN102747063A (en) | Xylose isomerase producing method | |
| CN108865914B (en) | Recombinant saccharomyces cerevisiae strain capable of degrading lignocellulose and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |