CN102719459A - Production method of endo-1,4-beta-D-glucanase, exo-1,4-beta-D-glucanase and beta-glucosidase - Google Patents
Production method of endo-1,4-beta-D-glucanase, exo-1,4-beta-D-glucanase and beta-glucosidase Download PDFInfo
- Publication number
- CN102719459A CN102719459A CN2012101419441A CN201210141944A CN102719459A CN 102719459 A CN102719459 A CN 102719459A CN 2012101419441 A CN2012101419441 A CN 2012101419441A CN 201210141944 A CN201210141944 A CN 201210141944A CN 102719459 A CN102719459 A CN 102719459A
- Authority
- CN
- China
- Prior art keywords
- beta
- enzyme
- glucosidase
- gene
- visose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a production method for endo-1,4-beta-D-glucanase, exo-1,4-beta-D-glucanase and beta-glucosidase, and belongs to the technical field of biology. The method comprises the steps of: cloning the endo-1,4-beta-D-glucanase gene, the exo-1,4-beta-D-glucanase gene, and the beta-glucosidase genes of trichoderma; establishing a bacillus subtilis expression vector and a pichia pastoris expression vector containing gene expression cassettes of the three enzymes; transforming the expression vectors into corresponding host bacteria; screening a bacillus subtilis recombinant and a pichia pastoris recombinant as engineering bacteria, wherein the bacillus subtilis recombinant and the pichia pastoris recombinant overexpress the endo-1,4-beta-D-glucanase, the exo-1,4-beta-D-glucanase, and the beta-glucosidase; and producing recombination mixes of the endo-1,4-beta-D-glucanase, the exo-1,4-beta-D-glucanase and the beta-glucosidase by fermenting the bacillus subtilis engineering bacteria and the pichia pastoris engineering bacteria. The production method of the invention assists in solving a key problem that the yield of enzyme left in the mixes of the endo-1,4-beta-D-glucanase, the exo-1,4-beta-D-glucanase and the beta-glucosidase produced by a natural bacteria strain is low, and benefits the price reduction of the enzyme.
Description
Technical field
The invention belongs to biological technical field, relate to the method that microbial engineering bacteria is produced recombinant protein that makes up.Specifically be that using microbe engineering bacteria production reorganization mixes endoglucanase, VISOSE excision enzyme and beta-glucosidase.
Background technology
(endo-1, (exo-1, (β-glucosidase) has the cellulolytic effect of associating to endoglucanase for 4-β-D-glucanase) and beta-glucosidase for 4-β-D-glucanase), VISOSE excision enzyme.Mierocrystalline cellulose is made up of glucose molecule.Endoglucanase (endo-1,4-β-D-glucanase) act on the inner noncrystalline domain of Mierocrystalline cellulose, random hydrolysis β-1, the 4-glycosidic link with the brachymemma of long chain cellulose molecule, produces the small molecules Mierocrystalline cellulose of a large amount of non reducing ends.It is terminal that the VISOSE excision enzyme acts on the Mierocrystalline cellulose linear molecule, cuts next cellobiose molecule successively; Beta-glucosidase is hydrolyzed into glucose molecule with cellobiose.Promptly at endoglucanase, under the combined action of VISOSE excision enzyme and beta-glucosidase, cellulose hydrolysis is a glucose molecule.Endoglucanase, VISOSE excision enzyme and beta-glucosidase are widely used in feed, cellulosic ethanol, and fields such as food, weaving and environmental sanitation industry have huge market potential.Endoglucanase, VISOSE excision enzyme and beta-glucoside enzyme product are the bacterial strains (bacterium, actinomycetes and filamentous fungus) that derives from natural cellulase-producing at present.But because bacteriogenic endoglucanase, VISOSE excision enzyme and beta-glucosidase are to be present in the born of the same parents with the inclusion body form, product is difficult to purifying; And actinomycetes and filamentous fungus poor growth, nutritional requirement is higher, and secretion is the albumen of self in a large number, is difficult to purifying, and production cost is higher.In the last few years, report express recombinant endoglucanase or VISOSE excision enzyme or beta-glucosidase were arranged successively.Owing to quote strong promotor, select good host bacterium of production performance and the strategy of taking the reorganization of gene multiple copied, can improve the expression amount of recombinase more significantly.But demand is not endoglucanase or VISOSE excision enzyme or beta-glucosidase in the industry, but the mixed enzyme of endoglucanase, VISOSE excision enzyme and beta-glucosidase.The current mixed enzyme product that does not still have mixing endoglucanase, VISOSE excision enzyme and the beta-glucosidase of recombinant production on the market; If with the existing engineering bacteria manufacture order enzyme that contains endoglucanase or VISOSE excision enzyme or beta-glucosidase; And then these enzymes are carried out mixing application; Its complex procedures, cost is high.
Subtilis and pichia spp all are the host bacterium that is usually used in producing recombinant protein, but respectively have characteristic.The principal character of pichia spp is the purifying that the few oneself protein of secretion helps expression product; Subtilis has amphimicrobian characteristic, can want the environment of oxygen to ferment having, and also can ferment at the environment of anaerobic.
Summary of the invention
The present invention makes up the subtilis engineering bacteria that contains the mould glucose incision enzyme gene expression framework of wood, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework and contains the mould glucose incision enzyme gene of wood and expresses the Pichia yeast engineering that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework; Express the subtilis engineering bacteria of framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework and contain Pichia yeast engineering production reorganization mixing endoglucanase, VISOSE excision enzyme and the beta-glucosidase that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework with containing wooden mould glucose incision enzyme gene.
The technical scheme that the present invention adopted is:
1. clone gene: from the mould genome of wood, clone endoglucanase, VISOSE excision enzyme and beta-glucosidase gene.
2. obtain promotor, recombination sequence, signal peptide, Transcription Termination subsequence and the resistant gene sequence of construction of expression vector.
3. make up two kinds of expression vectors like accompanying drawing 1 and accompanying drawing 2.
4. transform subtilis, will contain the yeast expression vector conversion pichia spp genome that the mould glucose incision enzyme gene of wood is expressed framework, glycan excision enzyme gene expression construct and beta-glucosidase gene expression framework through the Bacillus subtilus expression vector that contains the mould glucose incision enzyme gene expression framework of wood, glycan excision enzyme gene expression construct and beta-glucosidase gene expression framework of electric method for transformation above structure.The recon of screening high expression level endoglucanase, VISOSE excision enzyme and beta-glucosidase is as engineering bacteria.
5. ferment and contain subtilis engineering bacteria and Pichia yeast engineering production reorganization mixing endoglucanase, VISOSE excision enzyme and the beta-glucosidase that the mould glucose incision enzyme gene of wood is expressed framework, glycan excision enzyme gene expression construct and beta-glucosidase gene expression framework.
The present invention make up contain the mould glucose incision enzyme gene of wood express framework, glycan excision enzyme gene expression construct and beta-glucosidase gene express the subtilis engineering bacteria of framework and advantage applies that Pichia yeast engineering production reorganization mixes endoglucanase, VISOSE excision enzyme and beta-glucosidase in:
(1) replaces natural bacterial strain with engineering bacteria and produce endoglucanase, VISOSE excision enzyme and beta-glucosidase, through increasing the output that gene copy number improves enzyme.
(2) replace the engineering bacteria contain the single enzyme gene with the engineering bacteria that contains endoglucanase, VISOSE excision enzyme and beta-glucosidase gene and produce enzyme, produce endoglucanase, VISOSE excision enzyme and beta-glucosidase simultaneously with a fermentation procedure and replaced with three operations and produce recombinate endoglucanase or VISOSE excision enzyme or beta-glucosidase respectively.Starting material, energy consumption and manpower have been saved.
(3) subtilis and pichia spp each tool characteristic aspect the production recombinant protein; The present invention makes up respectively and contains subtilis engineering bacteria and the Pichia yeast engineering that the mould glucose incision enzyme gene of wood is expressed framework, glycan excision enzyme gene expression construct and beta-glucosidase gene expression framework, selects for its recombinase production provides two kinds of bacterial strains.
Description of drawings
P. the glyceraldehyde 3-phosphate dehydrogenase of bacillus megaterium (GAP) promotor; S. alpha factor signal peptide; Gene1. wooden mould glucose incision enzyme gene; The mould glycan excision enzyme gene of gene 2. wood; The mould beta-glucosidase gene of gene 3. wood; TT. Transcription Termination subsequence; G418.G418 resistant gene (being applied to screen the subtilis recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of B.subtilis rDNA. subtilis.
Accompanying drawing 2. contains the mould glucose incision enzyme gene of wood and expresses the yeast expression vector that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework.
P. the glyceraldehyde 3-phosphate dehydrogenase of pichia spp (GAP) promotor; S. alpha factor signal peptide; Gene1. wooden mould glucose incision enzyme gene; The mould glycan excision enzyme gene of gene 2. wood; The mould beta-glucosidase gene of gene 3. wood; TT. Transcription Termination subsequence; G418.G418 resistant gene (being applied to screen the pichia spp recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of P.pastoris rDNA. pichia spp.
Embodiment
With indefiniteness embodiment the present invention is described further below.
Embodiment 1:
Contain the subtilis expression vector that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework 1.1 make up
1.1.1 structure cloning vector
By the synthetic dna double chain that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pBCL.
1.1.2 synthesize following primer with mould glucose incision enzyme gene, VISOSE excision enzyme gene and the β alpha-glucosidase gene of reverse transcription PCR amplification wood:
Primer a:5 ' tc
GaattcCcgaattccagcagactg3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer b:5 ' tt
GCGGCCGCAtgcggccgcctactttc3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer c:5 ' gc
GaattcCcgaattccaagcttgct3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer d:5 ' aa
GCGGCCGCCagcggccgcttacaggaa3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer e:5 ' cc
GaattcGcgctacgtagttgtacct 3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer f:5 ' ta
GcggccgcAtaagcggccgcctac 3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Use RNA and extract the mould total RNA of test kit extraction wood, use synthetic its cDNA of cDNA synthetic agent box.Mould cDNA is a template with above-mentioned synthetic wood, uses primer a and primer b and carries out pcr amplification, and the PCR product of acquisition proves the mould glucose incision enzyme gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides; Mould cDNA is a template with above-mentioned synthetic wood, uses primer c and primer d and carries out pcr amplification, and the PCR product of acquisition proves the mould VISOSE excision enzyme gene order of wood through sequential analysis with the BLAST software analysis that NCBI provides; Mould cDNA is a template with above-mentioned synthetic wood, uses primer e and primer f and carries out pcr amplification, and the PCR product of acquisition proves the mould β alpha-glucosidase gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides.
1.1.3 make up above-mentioned various enzyme gene expression framework respectively
1.1.3.1 glyceraldehyde 3-phosphate dehydrogenase promoter sequence with pcr amplification bacillus megaterium (Bacillus megaterium).
Primer 1:
5’CC
TACGTAGATCCATTATCGGTGAACCA?3’
Primer 2:
5’GG
GCATGCGGGTATTTCCTCCTTGAATGT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
[huge subtilis genome DNA extracting method: the Snailase solution (Snailase dissolves with the sorbyl alcohol of 1mol/L) that the bacillus subtilis mycetocyte is added on 9mg/ml was in 30 ℃ of joltings 30 minutes to extract the genomic dna of bacillus megaterium; Extract its genomic dna according to the bacterial genomes DNA extraction method of routine then]; Use primer 1 and carry out pcr amplification with primer 2; The PCR product proves the promoter sequence [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the glyceraldehyde 3-phosphate dehydrogenase promoter sequence] of bacillus megaterium glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides:
CCTACGTAGATCCATTATCGGTGAACCATCTATTAAAGACATGCTTCATTTAATTAAGTCCGCTGGTATGGTTGTTCACG?GAATAGGAGACGCTATGACAATGGCAGAACGCCGTAAAACACCACAAGCAGACTTAGAAAAAGTGAAAAATGGACATGCT?GTAGGTGAGGCATTTGGATACTATTTTAATCATCAAGGCGAAGTTGTTCATAAAGTTAAAACAGTTGGCATACAACTCGA?TGATTTAAAGAACAATAAATGTGTTATTGCTGTTGCAGGAGGTTCATCAAAAGCAAAGGCAATTAAAGCGTTTATGCAAC?AAGCGCATGATTCGATTCTCATTACAGATGAAGGCGCCGCAAAAGAGTTAGTAAGGGATTTTAATTAATCCCTCATATAA?AAAATACTTTTTACATTCAAGGAGGAAATACCC
GCATGCCC
1.1.3.2 the dna sequence dna Synesis Company by specialty synthesizes alpha factor signal peptide [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACT?ACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGC?TGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAG?AAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
1.1.3.3 the dna sequence dna Synesis Company by specialty synthesizes Transcription Termination subsequence [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAA?GAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAG?GATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGG?TAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTG?AGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
1.1.3.4 with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATAC?CATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTAT?CGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAA?ATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGC?CATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACG?CGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATT?TTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCAT?CAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTA?ACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGT?CGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCC?TCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
1.1.3.5 with the PCR rDNA sequence that from the subtilis genome, increases
Primer 1:5 ' CC
GGTACCGacgaacgctggcggcgtgc3 '
Primer 2: 5 ' CC
TTCGAAGcaccttccgatacggctacct3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extract subtilis genomic dna (the subtilis genome DNA extracting method is with above-described bacillus megaterium genome DNA extracting method); With the genomic dna is that template applications primer 1 carries out pcr amplification with primer 2, and the PCR product of acquisition proves the genomic rDNA sequence of subtilis through sequential analysis with the BLAST software analysis that NCBI provides.
1.1.3.6 the expression cassette framework is built (promotor-signal peptide-gene-Transcription Termination subsequence) process:
D. make up glucose incision enzyme gene and express framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the MCS of pBCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBCL carrier, and is located at the downstream of promoter sequence; The glucose incision enzyme gene sequence that wood is mould is reconstituted in the MCS of pBCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pBCL carrier, and is located at the gene order downstream.This carrier that contains glucose incision enzyme gene expression framework is called pBCL1.
E. make up VISOSE excision enzyme gene expression construct:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the MCS of pBCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBCL carrier, and is located at the downstream of promoter sequence; The VISOSE excision enzyme gene order that wood is mould is reconstituted in the MCS of pBCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pBCL carrier, and is located at the gene order downstream.This carrier that contains VISOSE excision enzyme gene expression construct is called pBCL2.
F. make up the β alpha-glucosidase gene and express framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of huge subtilis is reconstituted in the MCS of pBCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBCL body, and is located at the downstream of promoter sequence; The β alpha-glucosidase gene sequence that wood is mould is reconstituted in the MCS of pBCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pBCL carrier, and is located at the gene order downstream.This carrier that contains β alpha-glucosidase gene expression framework is called pBCL3.
1.1.4 accomplish the structure of expression vector
1.1.4.1 being expressed framework, 3 covers are assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4 dna ligase, cut the expression framework of pBCL2 and pBCL3 carrier, and this two cover that will downcut is expressed the MCS that framework is inserted in pBCL1 successively.This carrier is called pBCL123.
1.1.4.2 the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA (DNA recombination sequence) of subtilis and G418 recombination in the MCS of pBCL123 carrier.Constitute and contain the subtilis expression vector (accompanying drawing 1) that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework.
Contain the subtilis engineering bacteria that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework 1.2 make up.
The electricity consumption method for transformation will contain the mould glucose incision enzyme gene of wood and express the subtilis expression vector conversion Bacillus subtillis that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework; To pass through the subtilis of electric transformation and coat G418-LB (1% Tryptones; 0.5% yeast extract, 1% sodium-chlor, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 37 ℃ of cultivations after 3 days.Using above-described glucose incision enzyme gene, VISOSE excision enzyme gene and beta-glucosidase gene special primer respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that mould glucose incision enzyme gene, VISOSE excision enzyme gene and the beta-glucosidase gene of its wood of sequencing proof has been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 37 ℃ respectively with the recon that gene specific primer carries out the PCR checking; Measure endoglucanase, VISOSE excision enzyme and the activity of beta-glucosidase of fermented liquid supernatant with ordinary method; According to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level is expressed the subtilis engineering bacteria that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework as containing the mould glucose incision enzyme gene of wood.
Mix endoglucanase, VISOSE excision enzyme and beta-glucosidase 1.3 produce reorganization
The subtilis engineering bacteria that will contain the mould glucose incision enzyme gene expression framework of wood, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework is inoculated in LB (1% Tryptones; 0.5% yeast extract; 1% sodium-chlor) liquid nutrient medium; Be distributed into 3 bottles, 37 ℃ of fermentations 2 days; With natural product endoglucanase; Wooden mould (being that 1.1.2.4 is applied to the wooden mould of amplification gene) of VISOSE excision enzyme and beta-glucosidase is inoculated in conventional fungi culture medium (murphy juice 200g/L, glucose 20g/L); Be distributed into 3 bottles, 30 ℃ of fermentations 3 days.The centrifuging and taking supernatant.Analyze the hydrolytic action (table 1) of fermented liquid supernatant to CMC 99.5.Result with statistical otherness his-and-hers watches 1 analyzes; The result shows that containing wooden mould glucose incision enzyme gene expresses the fermented liquid supernatant of subtilis engineering bacteria that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene express framework glucogenic effect significantly is better than natural product endoglucanase to cellulose hydrolysis, and the wooden mould fermented liquid supernatant of VISOSE excision enzyme and beta-glucosidase is to cellulosic effect (P＜0.01).
Table 1. fermented liquid supernatant and CMC 99.5 effect generate glucose content and measure the result
Explain: glucose content is measured with conventional polarimetry.
Embodiment 2:
Contain the yeast expression vector that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework 2.1 make up
2.1.1 structure cloning vector
By the synthetic dna double chain that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pPCL.
2.1.2 synthesize following primer with mould glucose incision enzyme gene, VISOSE excision enzyme gene and the β alpha-glucosidase gene of reverse transcription PCR amplification wood:
Primer a:5 ' tc
GaattcCcgaattccagcagactg3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer b:5 ' tt
GCGGCCGCAtgcggccgcctactttc3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer c:5 ' gc
GaattcCcgaattccaagcttgct3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer d:5 ' aa
GCGGCCGCCagcggccgcttacaggaa3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer e:5 ' cc
GaattcGcgctacgtagttgtacct 3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer f:5 ' ta
GcggccgCataagcggccgcctac 3 ' [explain: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Use RNA and extract the mould total RNA of test kit extraction wood, use synthetic its cDNA of cDNA synthetic agent box.Mould cDNA is a template with above-mentioned synthetic wood, uses primer a and primer b and carries out pcr amplification, and the PCR product of acquisition proves the mould glucose incision enzyme gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides; Mould cDNA is a template with above-mentioned synthetic wood, uses primer c and primer d and carries out pcr amplification, and the PCR product of acquisition proves the mould VISOSE excision enzyme gene order of wood through sequential analysis with the BLAST software analysis that NCBI provides; Mould cDNA is a template with above-mentioned synthetic wood, uses primer e and primer f and carries out pcr amplification, and the PCR product of acquisition proves the mould β alpha-glucosidase gene sequence of wood through sequential analysis with the BLAST software analysis that NCBI provides.
2.1.3 make up various enzyme gene expression frameworks respectively
2.1.3.1 glyceraldehyde 3-phosphate dehydrogenase promoter sequence with the pcr amplification pichia spp.
Primer 1:
5’CC
TACGTAGGATCCTTTTTTGTAGAAATGTCTTGG?3’
Primer 2:
5’GG
GCATGCTGTGTTTTGATAGTTGTTC?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is wherein arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides.[explain: the pichia spp genome DNA extracting method: the Snailase solution (Snailase with 1mol/L sorbyl alcohol dissolving) that the pichia spp cell is added on 9mg/ml extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then in 30 ℃ of joltings 30 minutes.]
2.1.3.2DNA the sequence synthesis method is synthesized following alpha factor signal peptide [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACT?ACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGC?TGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAG?AAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
2.1.3.3DNA the sequence synthesis method is synthesized following Transcription Termination subsequence [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAA?GAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAG?GATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGG?TAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTG?AGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
2.1.3.4 with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATAC?CATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTAT?CGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAA?ATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGC?CATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACG?CGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATT?TTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCAT?CAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTA?ACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGT?CGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCC?TCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
2.1.3.5 pcr amplification rDNA sequence from the pichia spp genome
The PCR primer:
Primer 1:5 ' CC
GGTACCGgcttccaggacgtatcgcggatcgctgcgttcttcatc3 '
Primer 2: 5 ' CC
TTCGAAAgccccgtggcacacgaccaatcttcccagccgaca 3 '
Explain: 8 bases of 5 ' end of primer are that enzyme is cut protection base (2 bases) and enzyme discrimination bit (6 bases that underscore is arranged).
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product of acquisition proves the rDNA sequence in the pichia spp genome through sequential analysis and the BLAST software analysis that provides with NCBI.
2.1.3.6 the expression cassette framework is built (promotor-signal peptide-gene-Transcription Termination subsequence) process:
D. make up glucose incision enzyme gene and express framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPCL carrier, and is located at the downstream of promoter sequence; The glucose incision enzyme gene sequence that wood is mould is reconstituted in the MCS of pPCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pPCL carrier, and is located at the gene order downstream.This carrier that contains glucose incision enzyme gene expression framework is called pPCL1.
E. make up VISOSE excision enzyme gene expression construct:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPCL carrier, and is located at the downstream of promoter sequence; The VISOSE excision enzyme gene order that wood is mould is reconstituted in the MCS of pPCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pPCL carrier, and is located at the gene order downstream.This carrier that contains VISOSE excision enzyme gene expression construct is called pPCL2.
F. make up the β alpha-glucosidase gene and express framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPCL carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPCL carrier, and is located at the downstream of promoter sequence; The β alpha-glucosidase gene sequence that wood is mould is reconstituted in the MCS of pPCL carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pPCL carrier, and is located at the gene order downstream.This carrier that contains β alpha-glucosidase gene expression framework is called pPCL3.
2.1.4 accomplish the structure of expression vector
2.1.4.1 being expressed framework, 6 covers are assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4 dna ligase, cut the expression framework of pPCL2 and pPCL3 carrier, and this two cover that will downcut is expressed the MCS that framework is inserted in pPCL1 successively.This carrier is called pPCL123.
2.1.4.2 the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA sequence (DNA recombination sequence) of pichia spp and G418 recombination in the MCS of pPCL123 carrier.Constitute and contain the yeast expression vector (accompanying drawing 2) that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework.
Contain the Pichia yeast engineering that the mould glucose incision enzyme gene of wood is expressed framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework 2.2 make up.
The electricity consumption method for transformation will contain the mould glucose incision enzyme gene of wood and express the yeast expression vector conversion pichia spp that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework; To pass through the pichia spp of electric transformation and coat G418-YPD (2% peptone; 1% yeast extract, 2% glucose, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 30 ℃ of cultivations after 3 days.Using above-described glucose incision enzyme gene, VISOSE excision enzyme gene and beta-glucosidase gene special primer respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that mould glucose incision enzyme gene, VISOSE excision enzyme gene and the beta-glucosidase gene of its wood of sequencing proof has been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 37 ℃ respectively with the recon that gene specific primer carries out the PCR checking; Measure endoglucanase, VISOSE excision enzyme and the activity of beta-glucosidase of fermented liquid supernatant with ordinary method; According to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level is expressed the Pichia yeast engineering that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework as containing the mould glucose incision enzyme gene of wood.
Mix endoglucanase, VISOSE excision enzyme and beta-glucosidase 2.3 produce reorganization
The Pichia yeast engineering that will contain the mould glucose incision enzyme gene expression framework of wood, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework is inoculated in YPD (2% peptone; 1% yeast extract; 2% glucose) liquid nutrient medium; Be distributed into 3 bottles, 30 ℃ of fermentations 2 days; With natural product endoglucanase; Wooden mould (being that 1.1.2.4 is applied to the wooden mould of amplification gene) of VISOSE excision enzyme and beta-glucosidase is inoculated in conventional fungi culture medium (murphy juice 200g/L, glucose 20g/L); Be distributed into 3 bottles, 30 ℃ of fermentations 3 days.The centrifuging and taking supernatant.Analyze the hydrolytic action (table 2) of fermented liquid supernatant to CMC 99.5.Result with statistical otherness his-and-hers watches 2 analyzes; The result shows that containing the mould glucose incision enzyme gene of wood expresses the fermented liquid supernatant of Pichia yeast engineering that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene express framework glucogenic effect significantly is better than natural product endoglucanase to cellulose hydrolysis, and the wooden mould fermented liquid supernatant of VISOSE excision enzyme and beta-glucosidase is to cellulosic effect (P＜0.01).
Table 2. fermented liquid supernatant and CMC 99.5 effect generate glucose content and measure the result
Explain: glucose content is measured with conventional polarimetry.
Claims (2)
1. produce the method for endoglucanase, VISOSE excision enzyme and beta-glucosidase.It is characterized in that: through mould glucose incision enzyme gene, VISOSE excision enzyme gene and the beta-glucosidase gene of Protocols in Molecular Biology clone wood, structure contains the mould glucose incision enzyme gene of wood and expresses subtilis expression vector and the yeast expression vector that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework; Obtain the subtilis recon, thereby yeast expression vector is transformed pichia spp acquisition pichia spp recon thereby the subtilis expression vector is transformed subtilis; Screen respectively up to the subtilis recon and the pichia spp recon of above-described three kinds of enzymes and express subtilis engineering bacteria and the Pichia yeast engineering that framework, VISOSE excision enzyme gene expression construct and beta-glucosidase gene are expressed framework as containing the mould glucose incision enzyme gene of wood; Subtilis engineering bacteria and Pichia yeast engineering production reorganization with containing the mould glucose incision enzyme gene expression framework of wood, VISOSE excision enzyme gene expression construct and beta-glucosidase gene expression framework mix endoglucanase, VISOSE excision enzyme and beta-glucosidase.
2. the method for production endoglucanase according to claim 1, VISOSE excision enzyme and beta-glucosidase is characterized in that: utilize the method preparation reorganization of the described production endoglucanase of claim 1, VISOSE excision enzyme and beta-glucosidase to mix endoglucanase, VISOSE excision enzyme and beta-glucoside enzyme product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141944.1A CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141944.1A CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102719459A true CN102719459A (en) | 2012-10-10 |
| CN102719459B CN102719459B (en) | 2016-03-09 |
Family
ID=46945327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210141944.1A Active CN102719459B (en) | 2012-05-02 | 2012-05-02 | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719459B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441464A (en) * | 2015-11-19 | 2016-03-30 | 江南大学 | System for codon optimization and pichia pastoris expression of genes of cellobiohydrolase II |
| CN108841810A (en) * | 2018-07-21 | 2018-11-20 | 湖北大学 | A kind of multifunctional cellulase gene and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101463330A (en) * | 2009-01-12 | 2009-06-24 | 北京挑战生物技术有限公司 | Inocula producing cellulase and use thereof |
| CN102007206A (en) * | 2008-04-14 | 2011-04-06 | 三井化学株式会社 | Yeast for production of glucose, and method for production of glucose using the same |
-
2012
- 2012-05-02 CN CN201210141944.1A patent/CN102719459B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102007206A (en) * | 2008-04-14 | 2011-04-06 | 三井化学株式会社 | Yeast for production of glucose, and method for production of glucose using the same |
| CN101463330A (en) * | 2009-01-12 | 2009-06-24 | 北京挑战生物技术有限公司 | Inocula producing cellulase and use thereof |
Non-Patent Citations (3)
| Title |
|---|
| YANASE S ET AL.: "Ethanol production from cellulosic materials using cellulase-expressing yeast", 《BIOTECHNOL J.》 * |
| 刘泽寰 等: "绿色木霉EG_基因的克隆及其在工业酿酒酵母中的整合表达", 《中山大学学报（自然科学版）》 * |
| 张磊 等: "木霉纤维素酶基因的克隆与表达研究进展", 《纤维素科学与技术》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441464A (en) * | 2015-11-19 | 2016-03-30 | 江南大学 | System for codon optimization and pichia pastoris expression of genes of cellobiohydrolase II |
| CN108841810A (en) * | 2018-07-21 | 2018-11-20 | 湖北大学 | A kind of multifunctional cellulase gene and its application |
| CN108841810B (en) * | 2018-07-21 | 2021-08-27 | 湖北大学 | Multifunctional cellulase gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102719459B (en) | 2016-03-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102286443B (en) | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase | |
| Hooker et al. | Leveraging anaerobic fungi for biotechnology | |
| CN105802854B (en) | Cellulase high-yield strain and application thereof | |
| CN102762727A (en) | Host cell capable of producing enzymes useful for degradation of lignocellulosic material | |
| CN106414728B (en) | Agar oligohydrolase and method for producing 3, 6-anhydro-L-galactose and galactose from agarose by using the same | |
| CN101870956B (en) | Cellulase-producing fungus agent and application thereof | |
| Cunha et al. | Three-phasic fermentation systems for enzyme production with sugarcane bagasse in stirred tank bioreactors: Effects of operational variables and cultivation method | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN101631864A (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| CN102827820B (en) | Beta-glucosidase and application thereof | |
| CN101260379B (en) | Gene engineering bacterium for producing 1,3-propanediol and its preparation method and application | |
| Chang et al. | A thermo-and toxin-tolerant kefir yeast for biorefinery and biofuel production | |
| Xie et al. | Saccharomycopsis fibuligera in liquor production: A review | |
| CN104357429B (en) | A kind of high temperature neutral beta glucuroide HiBgl3A and its gene and application | |
| Volkov et al. | Cloning, purification and study of recombinant GH3 family β-glucosidase from Penicillium verruculosum | |
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN103114099A (en) | Beta-glucosaccharase gene for coding glycosyl hydrolase family 1 and application thereof | |
| Shokrkar et al. | Exploring strategies for the use of mixed microalgae in cellulase production and its application for bioethanol production | |
| Pan et al. | α-L-rhamnosidase: Production, properties, and applications | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN105567779A (en) | Fermentation method of high-yield and low-molecular-weight thermal gel | |
| CN106459942A (en) | Variants of exoglucanases having improved activity and uses thereof | |
| Mou et al. | Isolation of a newly Trichoderma asperellum LYS1 with abundant cellulase-hemicellulase enzyme cocktail for lignocellulosic biomass degradation | |
| CN103205403A (en) | Method for producing ligninolytic enzymes | |
| CN106459945A (en) | Variants of exoglucanases having improved activity and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |