CN105802854B - Cellulase high-yield strain and application thereof - Google Patents

Abstract

The present invention relates to a cellulase high-yielding strain and its application. It is the first time to reveal a Trichoderma reesei strain PPL3-1 with high cellulase production. The cellulase produced by it has significant advantages in both enzyme activity and yield. The inventors also improved the cellulase production of this strain by further optimization.

Description

A kind of cellulase high-yielding strain and its application

technical field

The present invention relates to the field of microbiology, more particularly, the present invention relates to a cellulase high-producing strain and its application.

Background technique

Cellulose is a polymer composed of multiple glucose residues linked by β-1,4-glycosidic bonds, and is the most abundant renewable biomass resource on earth. Using lignocellulose as raw material, hydrolyzing cellulose with cellulase to generate glucose, and then fermenting it into fuel ethanol has become an important way to deal with the problems of energy crisis and environmental pollution in today's world.

Cellulase is a general term for a series of enzymes that can convert cellulose into glucose, mainly including endo-β-1,4-glucanase (EC 3.2.1.4), exo-glucanase (exoglucanase, EC 3.2.1.91) and beta-glucosidase (beta-glucosidase, EC 3.2.1.21). The endoglucanase acts on the inside of the long-chain cellulose molecule to cut the long fibers into short fibers, and the exoglucanase acts on one end of the cellulose molecule to cut two glucose residues to form fiber two. The sugar, β-glucosidase, cleaves cellobiose and some cellooligosaccharides eventually to individual glucose molecules. As one of the important components of the cellulose complex enzyme system, the key role of β-glucosidase is mainly reflected in two aspects: on the one hand, due to the accumulation of cellobiose, its upstream endoglucanase and exoglucan The activity of the enzyme has a significant feedback inhibition effect. Therefore, the efficient hydrolysis of cellobiose by β-glucosidase plays a crucial role in the complete degradation of cellulose. On the other hand, in addition to hydrolysis activity, β-glucosidase also has transglycosidase activity. Under certain conditions, two glucose molecules can be synthesized into one sophorose molecule through transglycosidation. It has been found that sophorose is a cellulase gene Strong inducer of expression. It is generally believed that the induction mechanism of cellulase synthesis in filamentous fungi is that a small amount of constitutive cellulase existing on the surface of conidia and hyphae first degrades cellulose to generate oligosaccharides such as cellobiose, and then binds glucose in the plasma membrane. Under the action of transglycosidase, inducers such as sophorose are generated, and enter into human cells through the constitutive permease system on the cell membrane to initiate the synthesis of cellulase. It can be seen that improving the catalytic activity of β-glucosidase in the cellulose degradation system has great commercial value and practical significance for improving the conversion efficiency of the cellulose degradation system and reducing the production cost of the cellulosic ethanol industry.

There are many kinds of cellulase, and many microorganisms, especially fungi, have the ability to produce this compound enzyme. Among them, Trichoderma, Aspergillus, Rhizopus and Penicillium have strong enzyme-producing ability, especially Trichoderma species. Trichoderma reesei is the most used strain in the cellulase industry. Trichoderma reesei strain Qm6a is the starting strain of each high cellulase-producing strain. In order to obtain a new strain with high cellulase production, Qm6a was subjected to two rounds of linear accelerator mutagenesis and screening to obtain a more efficient cellulase-producing mutant strain Qm9414 However, it is still repressed by carbon metabolism, and the enzyme production status will increase with the fermentation time, the glucose concentration will increase, and the synthesis of cellulase will be gradually inhibited. In order to obtain higher cellulase production, Qm6a was re-bred, and the high-yielding strain Rut-C30 resistant to carbon metabolism repression was obtained through three rounds of mutagenesis and screening: the first round of UV mutagenesis and anti-metabolic repression screening obtained Strain M7; In the second round, M7 was mutated to mutant NG14 by N-nitroguanidine. Compared with Qm9414, the extracellular protein production and filter paper enzyme activity of NG14 were increased by 1 and 4 times, respectively; the third round was based on NG14. A more efficient cellulase-producing strain Rut-C30 was obtained after UV mutagenesis and anti-metabolic repression screening. In addition, another mutant strain RL-P37 was obtained by ultraviolet mutagenesis on the basis of NG14, and another high-producing strain of cellulase CL-847, which is widely used in industry, was mutagenized from Qm9414. Due to its high-yield cellulase capacity, it is widely used in textile, papermaking, pulping and bioenergy industries. At present, the highest fermentation level of the bacteria can reach a protein yield of 100g/L. It has a strong protein secretion ability and is safe for humans and animals. It has been developed as a good fungal host for expressing homologous and heterologous proteins. In the industrial application of cellulase, the further improvement of the ability of Trichoderma reesei to produce enzymes and protein secretion will help to further open the application market of cellulase. However, the high-yielding strains of Trichoderma reesei are monopolized by large European and American companies, which limits the development of my country's cellulase industry. Therefore, it is necessary to carry out more in-depth transformation of Trichoderma reesei to improve its enzyme production capacity and protein secretion capacity, reduce the industrial production cost of cellulase, and then develop industrial strains with independent property rights.

Because the composition of Trichoderma reesei enzymes accounts for 99% of cellulase exonuclease and endonuclease, while β-glucosidase and other cellulases and hemicellulases account for less than 1%; meanwhile, fungal enzyme system Most of them are acidic and have poor heat resistance, which have become the bottleneck of Trichoderma reesei cellulase. Although traditional mutagenesis breeding can obtain many excellent industrial strains, Kubicek et al. believed that from 1978 to 1991, the mutant strains of Trichoderma reesei obtained only by traditional mutagenesis methods had no significant enzyme production capacity. change. In recent years, with the further development of molecular biology, people have gradually shifted from traditional biology such as conventional mutation breeding and improving fermentation conditions to systems biology using comparative genomics, proteomics, transcriptomics and metabolomics. , in order to analyze and understand the functions and related molecular mechanisms of important mutant genes of some high-yielding strains, and use these mechanisms to carry out further genetic modification to obtain production strains that are more in line with industrial needs. Especially in 2008, the genome sequencing of Trichoderma reesei Qm6a and Rut-C30 was completed and published one after another, and the molecular mechanism of Rut-C30 high production has been analyzed by comparative genomics methods, such as a series of transcription factors, basal metabolism-related enzymes and transporters. Isogenic deletion. These research results have been applied to the transformation of industrial strains by many researchers: especially the discovery of the most critical cre1 mutation in Rut-C30, which explains the derepression phenomenon of mutant strains. Therefore, by knocking out the repressor cre1 in the wild-type strain or introducing a cre1 mutation, the expression of cellulase in the recombinant strain under glucose and induction conditions can be significantly improved; while Ace1 is another inhibitor of cellulase production, and in ace1 knockout In all but the strains, the expression of major cellulase genes was up-regulated under cellulose- or sophorose-inducing conditions.

To sum up, it is necessary in this field to further study cellulase producing strains and develop strains with excellent performance.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a cellulase high-yielding strain and its application.

In a first aspect of the present invention, an isolated Trichoderma reesei strain or its spores, mycelium, and protoplasts is provided, and the preservation number of the strain in the China Center for Type Culture Collection is CCTCC NO: M 2014561.

In a preferred example, the enzymatic activity of the cellulase produced by the Trichoderma reesei strain with the deposit number CCTCC NO:M 2014561 or its spores is higher than 15IU/mL; preferably higher than 20IU/mL.

In another preferred example, the strain whose deposit number is CCTCC NO:M 2014561 or its spores, mycelium, and protoplasts is transformed with a hygromycin (hygromycin) resistance gene hph.

In another aspect of the present invention, there is provided a Trichoderma reesei strain or its spores, mycelium, protoplasts, the strain is the cultured offspring of the aforementioned Trichoderma reesei strain, and its ura5 gene is deleted mutation. Preferably, the enzymatic activity of the cellulase produced by the progeny strain is higher than 25 IU/mL.

In another aspect of the present invention, there is provided a genetically engineered Trichoderma reesei strain or its spores, mycelium, and protoplasts, wherein the strain is transformed from an exogenous strain in the Trichoderma reesei strain A strain obtained after ura5 (preferably, which is derived from Penicillium oxalicum) and cellulase activator Xyr1.

In another preferred embodiment, the nucleotide sequence of the ura5 is shown in SEQ ID NO: 5 or 6.

In another preferred embodiment, the nucleotide sequence of the cellulase activator Xyr1 is shown in SEQ ID NO:7.

In another aspect of the present invention, there is provided a Trichoderma reesei strain or its spores, mycelium, and protoplasts, wherein the strain is the described reesei that overexpresses (or is transformed with) cellulase activator Xyr1 Trichoderma strains or their spores, mycelium, protoplasts. For example, the vitrease activator Xyr1 is endogenously overexpressed in the strain, or the strain is overexpressed after exogenous transformation into the vitrease activator Xyr1 coding sequence.

In another aspect of the present invention, there is provided the use of any of the aforementioned Trichoderma reesei strains or their spores, mycelium, and protoplasts for the production of cellulase (preferably, by utilizing industrial and agricultural wastes) production of cellulase); or for the hydrolysis of β-1,4-glycosidic bonds (to obtain reducing sugars).

In a preferred example, the cellulase is used to hydrolyze lignocellulose; preferably, the lignocellulose includes (but is not limited to): corn stover, corncob, straw, rice husk, wheat straw , sorghum stalk, xylose bagasse, bagasse, or a combination thereof.

In another aspect of the present invention, a method for producing cellulase is provided, the method comprising: culturing any of the aforementioned Trichoderma reesei strains or their spores, mycelia, and protoplasts to produce fibers Vegetase.

In a preferred embodiment, the culturing method includes:

(1) After activating any of the aforementioned Trichoderma reesei strains or their spores, prepare a spore suspension with a concentration of 10 ⁶ to 10 ⁸ /mL, and then prepare a seed liquid, and then inoculate the seed liquid into In the liquid fermentation medium, the initial pH is 5.0 ± 0.2, and cultured at 28 ± 2 ° C and 200 ± 50 rpm in a shaker for 5-7 days; the fermentation medium contains 3 ± 1% microcrystalline cellulose in a mass-to-volume ratio. And the inorganic salt culture solution of 2±0.5% bran according to the mass volume ratio;

(2) Centrifuging the fermentation broth obtained in step (1), and taking the supernatant as crude enzyme liquid.

In another aspect of the present invention, there is provided a method for hydrolyzing lignocellulose, the method comprising: (i) utilizing any of the aforementioned Trichoderma reesei strains or their spores, mycelium, and protoplasts to produce fibers vegetase, and (ii) hydrolyzing lignocellulose using the obtained cellulase.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein.

Description of drawings

Figure 1. Transmission electron microscope photographs of Trichoderma reesei Rut-C30 and spores of high-yielding strain PPL3-1. Figure 1A shows the control strain Rut-C30, and Figure 1B shows the high-yielding strain PPL3-1. It can be seen that the vesicles of PPL3-1 are significantly increased, and the spore wall is also partially thickened. This may be related to the ability of high-yielding strains to secrete expressed proteins.

Figure 2. The enzyme activity of filter paper after fermentation of different strains of Trichoderma reesei in vials. In the fermentation system of Rut-C30 strain in 10ml small shake flask, after induction of bran and cellulose for 7 days, the filter paper enzyme activity (FPA) was 13U/ml, while PPL3-1 was 20U/ml after 7 days of fermentation under the same conditions, while The high-yielding strain PPLU4-6 obtained by further genetic breeding can reach 26U/ml, and the high-yielding strain PPLXIM after further overexpression of Xyr1 can reach 30U/ml.

Detailed ways

The inventor obtained a high-yielding cellulase-producing Trichoderma reesei (anamorph)/Hypocrea jecorina (teleomorph) PPL3-1 (hyg ^r ) ( Hereinafter referred to as PPL3-1), the deposit number is CCTCC NO: M 2014561. Compared with the high-yielding strains of Trichoderma reesei commonly used in industry, it has obvious advantages. The cellulase produced by the PPL3-1 strain is significantly improved in enzyme activity and yield. The inventors also improved the cellulase production of the PPL3-1 strain by further optimization. Therefore, the PPL3-1 strain of the present invention and its transformed strain have good industrial application prospects.

As used herein, the terms "Trichoderma reesei high-yielding strain PPL3-1 of the present invention", "Trichoderma reesei high-producing mutant PPL3-1 of the present invention", "fuson PPL3-1 of the present invention", "Trichoderma reesei" (anamorph)/Hypocreajecorina (teleomorph) PPL3-1 (hyg ^r )", "Trichoderma reesei PPL3-1", "Hypocreajecorina PPL3-1", "PPL3-1" are used interchangeably.

Trichoderma reesei is the main producer of commercial cellulase, but the ratio and activity of β-glucosidase in the cellulase system produced by common strains currently used in industry are low, making it highly efficient in hydrolyzing cellulose, especially It is the limiting factor for industrial pretreatment of straw. Therefore, in the current commercial cellulase, β-glucosidase produced from other fungi (such as Aspergillus niger, which is high-producing β-glucosidase) is added or compounded to the enzyme preparation produced by Trichoderma reesei.

The inventors carried out laboratory domestication of Trichoderma reesei wild strains on cellulose plates, selected strains with higher cellulase yield according to the size of the hydrolysis circle on the cellulose plates, and then carried out genetic breeding by physical and chemical methods and other methods. , the obtained high-yielding mutant strains were fused with protoplasts to obtain a series of fusants, and then these fusants were screened by large-scale filter paper enzyme activity, and finally the high-yielding strain PPL3-1 was obtained. Compared with other industrial strains of Trichoderma reesei Rut-C30, the cellulase enzyme system of the cellulase high-producing strain has the same optimum pH and optimum temperature, and the β-glucosidase enzyme activity has certain advantages. The pNPGase enzyme activity of the crude enzyme solution is above 30IU/mL, which makes up for the bottleneck of the lack of β-glucosidase in common cellulase industrial production strains, while the filter paper enzyme activity is above 20IU/mL, which is better than Rut-C30. There are advantages, so it is a good industrial cellulase strain. Like other industrial strains of Trichoderma reesei, its cellulase can be used in food, feed, health care, bioenergy and other fields, and has great application value.

The present invention obtains high-yielding strains, and the activity of β-glucosidase is significantly improved. In addition, the carbon source for the fermentation and cultivation of transformants is simple and readily available agricultural wastes such as bran, which can improve the hydrolysis efficiency of cellulase preparations. Very obvious role, such as application in the production of other food industries, will also greatly reduce its production cost, has a wider potential for industrial applications.

Further, the high-yielding cellulase strain PPL3-1 of the present invention can be used as a starting strain, and can be further improved by means of laboratory domestication, genetic breeding, molecular genetic manipulation, etc. to obtain a derivative strain with higher yield or more optimized enzyme system. Through genetic breeding and screening of PPL3-1 to obtain a strain with more improved enzyme activity, and then for single spore isolation, a high-yielding strain PPLU4-6 with a 30% increase in filter paper enzyme activity can be obtained by further screening, and this high-yield strain can be used as molecular genetic manipulation. It has a huge application prospect in industry to carry out genetic manipulation without selection marker.

Further, the derivative strain PPLU4-6 (uracil-deficient strain) of the high-yielding cellulase strain PPL3-1 of the present invention, as the object of molecular manipulation, can knock-in and knock-out genes and other genetic manipulations to carry out purposeful Genetic modification, or overexpression of Trichoderma reesei cellulase genes, such as overexpression of cellulase activator Xyr1, etc., or knockout of cellulase repressor Cre1, etc.

The strain of the present invention is a living cell. Once the spores, mycelia, protoplasts of the strain of the present invention and their related culture mixtures as well as living cells are obtained, the present invention can be obtained in large quantities by means of inoculation, passage, regeneration, etc. strains. This is usually by inoculating it into a solid plate medium or a liquid medium to expand the strain to obtain the living cells of the present invention. The obtained living cells can be further subjected to laboratory domestication, genetic breeding and molecular genetic manipulation to obtain mutants and transformants. The present invention can also be utilized as a host cell for heterologous expression.

Methods well known to those skilled in the art can be used to mutagenize the living cells of the present invention, resulting in changes in gene coding, enzymatic properties and morphological changes in the living cells. These methods include physical methods such as rays, particles, lasers, and ultraviolet light, and chemical mutagenesis methods such as alkylating agents, base analogs, hydroxylamine, and acridine dyes. Mutagenesis may be multiple generations of one or more of the above methods, and is not limited to these methods. Based on the strains provided by the present invention, physical and chemical methods can be further carried out for breeding, and new cellulase genes and related regulatory genes can also be introduced, and the enzyme production performance of the obtained mutants and transformants can be further improved. The method is a combination of one or more of the above.

Methods well known to those skilled in the art can be used to construct expression constructs (vectors) and further engineer the strains of the invention. For example, further improvement (eg, increasing the expression of beneficial factors and reducing the expression of harmful factors) has been carried out on the signaling pathways, signaling pathways and proteins involved in cellulase production that have been discovered or newly discovered in the strain.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. The procedures used are well known in the art. Such as Agrobacterium-mediated fungal transformation methods, protoplast transformation methods, electroshock transformation methods, CRISPR-Cas9 genome editing methods, biolistic methods, etc., but are not limited to these methods.

The Trichoderma reesei strain PPL3-1 disclosed in the present invention can utilize the industrial and agricultural production wastes containing lignocellulose, such as bran, corn steep liquor, soybean meal flour and other cheap raw materials, to produce cellulase through liquid or solid state fermentation. The cellulase produced has high activity, reasonable components and strong ability to hydrolyze lignocellulose. Under the same fermentation conditions, the cellulase yield of this strain was twice that of the commonly used industrial strain Rut-C30. The invention provides a new strain resource for solving the problems of high production cost and low saccharification efficiency caused by low enzyme activity and unreasonable enzyme components in the utilization of cellulose resources.

The application of the present invention in the preparation of cellulase can be realized by liquid fermentation. As a preferred embodiment, the fermentation method includes: (1) a slant or flat plate made of Trichoderma reesei PPL3-1 strain on a potato culture medium After activation, a spore suspension with a concentration of 10 ⁶ to 10 ⁸ mL ^-1 was prepared, and the inoculum of 10% was inserted into Sabouraud's medium (seed medium: 1% yeast extract, 1% peptone, 4% glucose) ), 28 ℃, 200rpm shaking culture, get the seed liquid, then insert the seed liquid into the liquid fermentation medium with 10% inoculum, the initial pH is 5.0, the filling amount is 10mL in a 50mL conical flask, at 28 ℃, 200rpm Cultivate in a shaker for 5-7 days; (2) centrifuge the fermentation broth obtained in step (1), and take the supernatant as crude enzyme liquid; the fermentation medium contains 5% inducer (3% microcrystalline cellulose and 2% bran) in inorganic salt broth (0.4% KH ₂ PO ₄ , 0.28% (NH ₄ ) ₂ SO ₄ , 0.06% MgSO ₄ ·7H ₂ O, 0.05% CaCl ₂ , 0.06% urea, 0.3 % tryptone, 0.1% Tween 80, _0.5 % CaCO3, 0.001% _FeSO4.7H2O , _0.00032 % _MnSO4.H2O , _0.00028 % _ZnSO4.7H2O , _0.0004 % CoCl2 ₎ .

The culture medium and culture method applied for culturing the strain of the present invention are not limited to those disclosed above, and other medium and culture method conventionally used for culturing Trichoderma reesei can also be applied in the present invention.

As mentioned above, the fermentation system can be scaled up for industrial production. Depending on the size of the system, those skilled in the art can make appropriate adjustments to facilitate the growth or production of strains based on their general knowledge.

As mentioned above, the crude enzyme liquid of liquid fermentation can be obtained by ultrafiltration, salting out or organic solvent precipitation and other methods to obtain purer cellulase or enzyme powder. The filter paper activity (FPA), CMC activity and β-glucosidase activity of the produced cellulase were determined by fermentation. It should be understood that the methods of isolating and purifying cellulase are not limited to those provided in the present invention, and other methods known to those skilled in the art can also be applied in the present invention.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods that do not indicate specific conditions in the following examples are usually in accordance with conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, 2002, or according to the conditions described by the manufacturer. the proposed conditions.

Embodiment 1, utilize Trichoderma reesei high-yielding strain to carry out cellulase production

In order to ensure the cellulase-producing ability of the obtained PPL3-1 (the deposit number is CCTCC NO:M 2014561), by liquid fermentation and measuring the filter paper enzyme activity of the crude enzyme liquid to achieve:

(1) Inoculate the Trichoderma reesei PPL3-1 strain on a potato medium plate and place it at 28°C for 7 days to make a spore suspension with a concentration of 10 ⁶ to 10 ⁸ cells/mL. % (v/v) of the inoculum amount was inserted into Sabouraud's medium (seed medium (v/v): 1% yeast extract, 1% peptone, 4% glucose), 28°C, 200rpm shaking culture to obtain seeds 10% (v/v) inoculum in liquid fermentation medium, the initial pH is 5.0, and the liquid volume is 10mL in a 50mL conical flask, and cultured in a shaker at 28°C for 5-7 days at 200rpm. days; the fermentation medium was an inorganic salt broth (0.4% KH ₂ PO ₄ , 0.28% (NH ₄ ) ₂ SO ₄ , 5% inducer (3% microcrystalline cellulose and 2% bran), 0.06% MgSO ₄ ·7H ₂ O, 0.05% CaCl ₂ , 0.06% Urea, 0.3% Peptone, 0.1% Tween 80, 0.5% CaCO ₃ , 0.001% FeSO ₄ ·7H ₂ O, 0.00032% MnSO ₄ ·H ₂ O, 0.00028% ZnSO ₄ ·7H ₂ O, 0.0004% CoCl ₂ ),

(2) Centrifuging the fermentation broth obtained in step (1), and taking the supernatant as crude enzyme liquid.

(3) In 0.05mol/L acetic acid-sodium acetate or citric acid-sodium citrate buffer solution of pH5.0, add Trichoderma reesei PPL3-1 crude enzyme solution to filter paper, hydrolyze at 50～60℃ for 60min, The enzyme activity of the enzyme on the filter paper was determined. The results showed that the enzyme activity could reach more than 20IU/mL.

Example 2. Degradation of lignocellulose using cellulase

In order to verify the ability of Trichoderma reesei high-producing cellulase strain PPL3-1 to degrade natural lignocellulose. The inventors used corn stalks treated with 10% dilute sulfuric acid, washed and dried the pretreated stalks as materials, in 1 mL of acetic acid-sodium acetate or citric acid-sodium citrate buffer solution of 0.05mol/L pH 5.0, 30 μl crude enzyme solution of cellulase produced by Trichoderma reesei PPL3-1 was added to 30 mg of pretreated corn stalks, shaken at a speed of 200 rpm in a shaking shaker, hydrolyzed at 50 °C for 24 hours, and centrifuged to take the supernatant , the reducing sugar in the supernatant was measured by DNS method, and the total amount of reducing sugar in the system was converted. The study found that the cellulase produced by the strain of the present invention can produce 12-16 mg/mL reducing sugar (simple sugar), while the cellulase of Rut-C30 as a control only produces 5-8 mg/mL reducing sugar (simple sugar). ), there are obvious advantages.

It can be seen from the above results that the cellulase produced by the strain of the present invention can hydrolyze β-1,4-glycosidic bonds to obtain reducing sugars.

Embodiment 3. Characteristic study of Trichoderma reesei high-yielding strain PPL3-1

Compared with Rut-C30, the number of vesicles in PPL3-1 was significantly increased, and the cell wall was also significantly thicker (Fig. 1), which may be related to the high fiber production of PPL3-1. the ability of the enzyme.

Example 4. Genetic engineering of Trichoderma reesei strain PPL3-1

Trichoderma reesei PPL3-1 strain was inoculated on a plate made of potato culture medium, cultivated at 28°C for 7 days, and washed the spores with Tween physiological saline (containing 0.85% NaCl, 0.02% Tween-80) to prepare The spore suspension with a concentration of 10 ⁶ -10 ⁸ mL ^-1 was evenly spread on Trichoderma reesei basic medium (adding final concentration of 2% and 3% ball milled cellulose powder and 0.1% triton X-100) cultured on the prepared plate. After a single colony grows on the plate, the single colony with a significantly enlarged hydrolysis circle is connected to a 24-well plate and further cultivated at 28°C for 7 days, and then spread on the above plate, and the single bacteria with a significantly enlarged hydrolysis circle is selected again. , culture, and then select a high-producing strain of cellulase by cellulase activity assay, so as to select a high-producing strain. The Trichoderma reesei basic medium is a basic inorganic salt culture solution (according to w/v, 1% KH ₂ PO ₄ , 0.6% (NH ₄ ) ₂ SO ₄ , 0.1% MgSO ₄ ·7H ₂ O, 0.3% Sodium tricitrate·2H2O, 0.0005% _FeSO4 · _7H2O , _0.00016 % MnSO4· _H2O , _0.00014 % ZnSO4 _{· 7H2O} , 0.0002% _{CaCl2 ·} 2H2O, pH 5.8), and Uridine was added at a final concentration of 0.5% (w/v).

The high-yielding strains obtained above were isolated from single spores, and after passage of not less than 10 generations, strains PPLU4-6 with stable and high cellulase production were selected.

The PPLU4-6 strain was inoculated on a plate made of potato medium containing 0.5% (w/v) uridine, and cultured at 28°C for 7 days, with Tween physiological saline (containing 0.85% NaCl, 0.02% Tween-80) Wash the spores, and simultaneously inoculate the starting strain PPL3-1. After culturing at 28°C for 7 days, carry out liquid fermentation according to the method described in Example 1, and measure the enzyme activity of the filter paper of the crude enzyme solution. The filter paper of the PPLU4-6 monospore strain The enzyme activity reached 26 U/mL, which was 30% higher than the filter paper enzyme activity of the starting strain PPL3-1 (Fig. 2).

The present inventors found that PPLU4-6 could not survive in a medium lacking uridine, and therefore investigated whether there are defects in uridine synthesis-related genes ura3 and ura5 in PPLU4-6. According to the genome sequence of Trichoderma reesei RutC-30 in JGI, the amplification primers of ura3 and ura5 genes were designed. The primer sequences are:

ura3F: 5'-GCTCTAGAATGGCACCACACCCGACGCT-3' (SEQ ID NO: 1);

ura3R: 5'-GCTCTAGACTATCGCAGCAGCCTCTCGG-3' (SEQ ID NO: 2);

ura5F: 5'-GCTCTAGAATGGCTACCACCTCCCAGCT-3' (SEQ ID NO: 3);

ura5R: 5'-GCTCTAGATCAGTCAGTCGCCTTGTACT-3' (SEQ ID NO: 4).

The ura3 and ura5 gene fragments of Trichoderma reesei PPL3-1 were amplified by KOD high-fidelity enzyme, and the 3' end was treated with A, and then cloned into pMD18-T simple vector using TA cloning kit. Sample sequencing. The wild-type sequence of the ura5 gene is shown in SEQ ID NO: 5 (711 bp). The sequencing results of the sequences amplified in this example showed that there was a mutation in the amino acid sequence of the ura5 gene (L135P, the corresponding site of the coding sequence was mutated from CTG to CCG). Therefore, it can be determined that the uridine auxotrophy of PPL3-1 is caused by the mutation of the ura5 gene. This mutation can be used as a selectable marker for further genetic engineering of PPLU4-6.

The ura5 gene (SEQ ID NO: 6) containing the promoter sequence was amplified by PCR from Penicillium oxalicum as a selection marker using primers:

Forward primer: 5' TCTAGAGCCGCATAGTTAAGCC 3' (SEQ ID NO: 10), the 5' end adds Xba I recognition site: TCTAGA;

Reverse primer: 5' ACTAGTCAGGGCTGGTGACGGAA 3' (SEQ ID NO: 11), the Spe I recognition site ACTAGT is added to its 5' end,

The amplified product was double digested with Xba I and Spe I and then ligated into pHDt/sk (see Microbial Cell Factories, 2012, 11:21) that had undergone the same double digestion to obtain pHDt/sk-ura5.

Trichoderma reesei cellulase transcription activator Xyr1 (SEQ ID NO: 7) was isolated from the genome of strain PPL3-1 by PCR using the following primers:

Forward primer: 5' TCTAGAATGTTGTCCAATCCTCTCCGTCG 3' (SEQ ID NO: 8), the 5' end adds Xba I recognition site: TCTAGA;

The reverse primer is 5' TCTAGATTAGAGGGCCAGACCGGTTCCGT 3' (SEQ ID NO: 9), and Xba I recognition site: TCTAGA is added to its 5' end.

After the PCR product was purified, it was digested with Xba I, and the DNA fragment of the enzyme cut was recovered using the Axygen PCR product column recovery kit. The recombinant expression vector pHDt/sk-ura5-Xyr1 was obtained by ligating overnight at 16°C with T4 DNA ligase. The His-tag (6×His-Tag) provided at the N-terminus of the expression product is convenient for subsequent purification. The plasmid pHDt/sk-ura5-Xyr1 constructed above was transformed into Agrobacterium tumefaciens AGL1, and then transformed into Trichoderma reesei PPLU4-6 strain under the mediation of Agrobacterium tumefaciens. The obtained strain is a strain overexpressing the activator.

The obtained transformants were subjected to liquid fermentation according to the method described in Example 1, and the filter paper enzyme activity of the crude enzyme solution was measured. The filter paper enzyme activity of the PPLXIM monospore strain reached 30U/mL, and the enzyme activity was significantly improved (Fig. 2). .

biological material preservation

The Trichoderma reesei strain Trichoderma reesei (anamorph)/Hypocrea jecorina (teleomorph) PPL3-1 (hyg ^r ) (abbreviated as PPL3-1) of the present invention is preserved in the China Center for Type Culture Collection (CCTCC, Wuhan, China), and the deposit number is CCTCC NO:M 2014561; deposited on November 11, 2014.

All documents mentioned herein are incorporated by reference in this application as if each document were individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (10)

1. an isolated Trichoderma reesei bacterial strain, is characterized in that, the preservation number of described bacterial strain in China Type Culture Collection is CCTCC NO: M 2014561. 2. A spore which is the spore of the Trichoderma reesei strain of claim 1. 3. A mycelium, which is the mycelium of the Trichoderma reesei strain of claim 1. 4. A protoplast, which is the protoplast of the Trichoderma reesei strain of claim 1. 5. Use of the Trichoderma reesei strain according to claim 1, characterized in that, for producing cellulase; or for hydrolyzing β-1,4-glycosidic bonds. 6. The use of claim 5, wherein the cellulase is used to hydrolyze lignocellulose. 7. purposes as claimed in claim 6 is characterized in that, described lignocellulose is present in the material comprising the following group: corn stover, corn cob, straw, rice husk, wheat straw, sorghum stalk, xylose residue , bagasse or a combination thereof. 8. A method for producing cellulase, characterized in that the method comprises: culturing the Trichoderma reesei strain of claim 1 to produce cellulase. 9. The method of claim 8, wherein the culturing method comprises: (1) After activating the spores of the Trichoderma reesei strain according to claim 1, prepare a spore suspension with a concentration of 10 ⁶ to 10 ⁸ /mL, and then prepare it into a seed liquid, and then inoculate the seed liquid into the liquid In the fermentation medium, the initial pH is 5.0 ± 0.2, and cultured at 28 ± 2 ° C and 200 ± 50 rpm in a shaker for 5-7 days; the fermentation medium contains 3 ± 1% microcrystalline cellulose and According to the mass volume ratio of 2±0.5% bran inorganic salt culture solution; (2) Centrifuge the fermentation broth obtained in step (1), and take the supernatant as crude enzyme liquid. 10. A method for hydrolyzing lignocellulose, wherein the method comprises: (i) utilizing the Trichoderma reesei strain of claim 1 to produce cellulase, and (ii) utilizing the obtained cellulase Hydrolysis of lignocellulose.

Images