CN105802854B - Cellulase high-yield strain and application thereof - Google Patents
Cellulase high-yield strain and application thereof Download PDFInfo
- Publication number
- CN105802854B CN105802854B CN201410853297.6A CN201410853297A CN105802854B CN 105802854 B CN105802854 B CN 105802854B CN 201410853297 A CN201410853297 A CN 201410853297A CN 105802854 B CN105802854 B CN 105802854B
- Authority
- CN
- China
- Prior art keywords
- strain
- cellulase
- trichoderma reesei
- yield
- ppl3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a cellulase high-yield strain and application thereof. The Trichoderma reesei strain PPL3-1 for producing the cellulase with high yield is disclosed for the first time, and the produced cellulase has significant advantages in enzyme activity and yield. The inventor also improves the cellulase yield of the strain through further optimization.
Description
Technical Field
The invention relates to the field of microbiology, in particular to a cellulase high-yield strain and application thereof.
Background
Cellulose is a polymer in which a plurality of glucose residues are linked by β -1, 4-glycosidic bonds, and is the most abundant renewable biomass resource on earth. Lignocellulose is used as a raw material, cellulose is hydrolyzed by cellulase to generate glucose, and then the glucose is fermented into fuel ethanol, so that the method becomes an important way for solving the problems of energy crisis, environmental pollution and the like in the world at present.
Cellulases are a generic term for a series of enzymes capable of converting cellulose to glucose, and mainly include endoglucanases (endo- β -1,4-glucanase, EC 3.2.1.4), exoglucanases (exoglucanases, EC 3.2.1.91) and β -glucosidases (β -glucanases, EC 3.2.1.21). Endoglucanase acts on the inside of cellulose long-chain molecules to cut long fibers into short fibers, exoglucanase acts on one end of the cellulose molecules to cut the cellulose molecules by taking two glucose residues as a unit to generate cellobiose, and beta-glucosidase cuts cellobiose and a plurality of cellooligosaccharides to finally generate single glucose molecules. As one of the important components of the cellulose complex enzyme system, the key role of β -glucosidase is mainly reflected in two aspects: on one hand, the cellobiose accumulation has obvious feedback inhibition effect on the activities of the upstream endoglucanase and exoglucanase, so that the efficient hydrolysis capacity of the beta-glucosidase on the cellobiose plays an important role in the complete degradation of cellulose. On the other hand, beta-glucosidase has transglycosidic activity in addition to hydrolytic activity, and under certain conditions two glucose molecules can be synthesized into one sophorose molecule by transglycosidic action, and sophorose has been found to be a strong inducer of cellulase gene expression. The mechanism by which cellulase synthesis is induced in filamentous fungi is generally believed to be: a small amount of constitutive cellulase existing on the surfaces of conidium and hypha firstly degrades oligosaccharide such as cellulose cellobiose, then under the transglycosylation action of glucosidase combined with a plasma membrane, inducers such as sophorose are generated, and enter human cells through a constitutive permease system on a cell membrane to start the synthesis of the cellulase. Therefore, the catalytic activity of the beta-glucosidase in a cellulose degradation system is improved, and the method has great commercial value and practical significance for improving the conversion efficiency of the cellulose degradation system and reducing the production cost of the cellulose ethanol industry.
The cellulase has various varieties, and a plurality of microorganisms, particularly fungi, have the capability of producing the complex enzyme, wherein trichoderma, aspergillus, rhizopus, penicillium and the like have stronger enzyme production capability, and trichoderma strains are more abundant. Trichoderma reesei (Trichoderma reesei) is the most utilized strain in the cellulase industry. The Trichoderma reesei strain Qm6a is a starting strain of each high-yield cellulase strain, and in order to obtain a new high-yield cellulase strain, the Qm6a is subjected to two-cycle linear accelerator mutagenesis and screening to obtain a more efficient cellulase-producing mutant strain Qm9414, but is still subjected to carbon metabolism repression, the enzyme production condition can be increased along with the increase of fermentation time, the glucose concentration is increased, and the synthesis of cellulase is gradually inhibited. In order to obtain higher cellulase yield, Qm6a was re-bred, and a high-producing strain Rut-C30 resistant to carbon metabolism repression was obtained by three rounds of mutagenesis and screening: the first round obtains the strain M7 through ultraviolet mutagenesis and anti-metabolic repression screening; the second wheel pair M7 obtains a mutant strain NG14 through N-nitroguanidine mutagenesis, and compared with Qm9414, the yield of NG14 extracellular protein and the filter paper enzyme activity are respectively improved by 1 time and 4 times; and the third round obtains a more efficient cellulase-producing strain Rut-C30 through ultraviolet mutagenesis and anti-metabolic repression screening on the basis of NG 14. In addition, another mutant RL-P37 was obtained by UV mutagenesis based on NG14, and another industrially widely used cellulase highly producing strain CL-847 was mutagenized from Qm 9414. Due to its ability to produce cellulase in high yield, it is widely used in the fields of textile, paper making, pulping, biological energy, etc. The current highest fermentation level of the fungus can reach 100g/L protein yield, has strong protein secretion capacity, is safe to human and livestock, and has been developed into a good fungus host for expressing homologous protein and heterologous protein. In the industrial application of cellulase, the further improvement of the enzyme production and protein secretion capacity of trichoderma reesei is helpful for further opening the application market of cellulase. However, high-producing strains of Trichoderma reesei are monopolized by Oumei companies, and the development of cellulase industry in China is limited. Therefore, it is necessary to further improve the trichoderma reesei, improve the enzyme production capability and the protein secretion capability thereof, reduce the industrial production cost of cellulase, and further develop an industrial strain with proprietary property rights.
Because the cellulose exo-enzyme and the endo-enzyme account for 99 percent in the enzyme system composition of the trichoderma reesei, and the beta-glucosidase, other cellulase and hemicellulase account for less than 1 percent; meanwhile, most fungal enzyme systems are acidic and poor in heat resistance, and the fungal enzyme systems become bottlenecks of the Trichoderma reesei cellulase. Although many excellent industrial strains can be obtained by conventional mutation breeding, Kubicek et al have thought that mutants of Trichoderma reesei obtained by a conventional mutagenesis method alone have not been greatly improved in enzyme productivity from 1978 to 1991. In recent years, with the further development of molecular biology, the traditional biology of conventional mutation breeding and fermentation condition improvement is gradually shifted to the systematic biology of comparative genomics, proteomics, transcriptomics and metabonomics, so that the functions and related molecular mechanisms of important mutant genes of some high-yield strains are analyzed and understood, and the mechanisms are further genetically modified to obtain production strains which meet industrial requirements. Particularly, in 2008, genome sequencing of trichoderma reesei Qm6a and Rut-C30 was completed and successively disclosed, and the high-yield molecular mechanism of Rut-C30 has been resolved by a method for comparing genomes, such as deletion of a series of genes of transcription factors, basal metabolism-related enzymes, transport proteins and the like. These findings have been applied by many researchers to the engineering of industrial species: in particular, the discovery of the most critical cre1 mutation in Rut-C30 explains the derepression phenomenon of the mutant. Therefore, the expression of the recombinant strain under glucose and induction conditions can be obviously improved by knocking out the repressor cre1 in a wild strain or introducing cre1 mutation; and Ace1 is another inhibitor for producing cellulase, and in the Ace1 knockout strain, the expression of main cellulase genes is up-regulated under the induction condition of cellulose or sophorose.
In conclusion, there is a need in the art to further study cellulase producing strains and develop strains with superior performance.
Disclosure of Invention
The invention aims to provide a cellulase high-yield strain and application thereof.
In the first aspect of the invention, an isolated Trichoderma reesei strain or spores, mycelia and protoplasts thereof are provided, wherein the preservation number of the strain in China center for type culture Collection is CCTCC NO: M2014561.
In a preferred example, the enzyme activity of the cellulase produced by the trichoderma reesei strain with the preservation number of CCTCC NO: M2014561 or spores thereof is higher than 15 IU/mL; preferably higher than 20 IU/mL.
In another preferred example, the strain with the preservation number of CCTCC NO: M2014561 or spores, mycelium and protoplast thereof are transformed with hygromycin (hygromycin) resistance gene hph.
In another aspect of the invention there is provided a strain of Trichoderma reesei, or spores, mycelium, protoplasts thereof, which strain is a cultured progeny of a strain of Trichoderma reesei as hereinbefore described and which has a deletion mutation in the ura5 gene. Preferably, the enzyme activity of the cellulase produced by the progeny strain is higher than 25 IU/mL.
In another aspect of the invention there is provided a genetically engineered strain of trichoderma reesei, or spores, mycelia, protoplasts thereof, said strain being obtained after transformation of said trichoderma reesei strain with an exogenous ura5 (preferably from penicillium oxalicum) and cellulase activator Xyr 1.
In another preferred embodiment, the nucleotide sequence of ura5 is set forth in SEQ ID NO 5 or 6.
In another preferred embodiment, the nucleotide sequence of the cellulase activator Xyr1 is shown in SEQ ID NO. 7.
In another aspect of the invention, there is provided a strain of trichoderma reesei, or spores, mycelia, protoplasts thereof, said strain being said trichoderma reesei strain, or spores, mycelia, protoplasts thereof, which overexpresses (or is transformed with) cellulase activator Xyr 1. For example, the cellulase activator Xyr1 is endogenously overexpressed by the strain or is exogenously transformed into the cellulase activator Xyr1 coding sequence such that the strain is post-overexpressed.
In another aspect of the invention there is provided the use of a strain of trichoderma reesei, or spores, mycelia, protoplasts thereof, as defined in any one of the preceding, for the production of cellulase (preferably, cellulase produced by using industrial and agricultural waste); or for hydrolysis of beta-1, 4-glycosidic bonds (obtaining reducing sugars).
In a preferred embodiment, the cellulase is used for hydrolyzing lignocellulose; preferably, the lignocelluloses include (but are not limited to): corn stover, corn cobs, rice straw, rice hulls, wheat straw, sorghum stalks, sugar cane bagasse, or combinations thereof.
In another aspect of the present invention, there is provided a method for producing cellulase, the method comprising: culturing any one of the above Trichoderma reesei strains or spores, mycelia or protoplasts thereof to produce cellulase.
In a preferred embodiment, the culture method comprises:
(1) activating Trichoderma reesei strain or spore thereof to obtain a concentration of 106～108Preparing spore suspension per mL, inoculating the seed solution into liquid fermentation culture medium with initial pH of 5.0 + -0.2, and fermenting at 28 + -2 deg.C and 200 + -50 deg.CCulturing in a shaker at rpm for 5-7 days; the fermentation culture medium is an inorganic salt culture solution containing microcrystalline cellulose with the mass volume ratio of 3 +/-1% and bran with the mass volume ratio of 2 +/-0.5%;
(2) and (2) carrying out centrifugal separation on the fermentation liquor obtained in the step (1), and taking supernatant as crude enzyme liquid.
In another aspect of the present invention, there is provided a method of hydrolyzing lignocellulose, the method comprising: (i) producing cellulase using a strain of trichoderma reesei as described in any one of the preceding paragraphs or spores, mycelia, protoplasts thereof, and (ii) hydrolyzing lignocellulose using the obtained cellulase.
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.
Drawings
FIG. 1, transmission electron micrographs of Trichoderma reesei Rut-C30 and highly productive strain PPL3-1 spores. FIG. 1A shows a control strain Rut-C30, FIG. 1B shows a high-producing strain PPL3-1, which shows that the vesicles of PPL3-1 are obviously increased, and the spore wall is partially thickened. This may be related to the ability of the high producing strain to secrete the expressed protein.
FIG. 2, filter paper enzyme activity after vial fermentation of different strains of Trichoderma reesei. In a fermentation system of a Rut-C30 strain in a 10ml small shake flask, after 7 days of bran and cellulose induction, the filter paper enzyme activity (FPA) is 13U/ml, and the PPL3-1 is 20U/ml after 7 days of fermentation under the same conditions, while the high-yield strain PPLU4-6 obtained by further genetic breeding can reach 26U/ml, and the high-yield strain PPLXIM after Xyr1 over-expression can reach 30U/ml.
Detailed Description
The inventor obtains Trichoderma reesei (anamorph)/Hypocrea jeciona (teleomorph) PPL3-1 (hyg) of Trichoderma reesei (Trichoderma reesei) with high cellulase yield by screening through genetic breeding methods such as laboratory domestication, physical-chemical mutagenesis and the liker) (hereinafter abbreviated as PPL3-1) with the preservation number of CCTCC NO: M2014561. Compared with the high-yield strain of trichoderma reesei which is commonly used in industry, the cellulase produced by the strain PPL3-1 has obvious advantages in enzyme activity and yield. The inventors have also improved the PPL by further optimizationCellulase production by strain 3-1. Therefore, the PPL3-1 strain and the modified strain thereof have good industrial application prospects.
As used herein, the terms "Trichoderma reesei highly productive strain PPL3-1 of the invention", "Trichoderma reesei highly productive mutant PPL3-1 of the invention", "fusion PPL3-1 of the invention", "Trichoderma reesei (anamorph)/Hypocrea (teleomorph) PPL3-1 (hyg)r) "," Trichoderma reesei PPL3-1 "," Hypocrea jeciorina PPL3-1 ", and" PPL3-1 "may be used interchangeably.
Trichoderma reesei is a main production microorganism of commercial cellulase, but the proportion and the activity of beta-glucosidase in a cellulase system produced by common strains applied to the industry at present are low, and the beta-glucosidase becomes a limiting factor for efficiently hydrolyzing cellulose, particularly for industrially pretreating straws. Therefore, the current commercial cellulases are prepared by adding or compounding beta-glucosidase produced by other fungi (such as Aspergillus niger with high yield of beta-glucosidase) into enzyme preparations produced by Trichoderma reesei.
The invention carries out laboratory domestication on a trichoderma reesei wild strain on a cellulose plate, selects a strain with higher cellulase yield according to the size of a hydrolysis ring on the cellulose plate, then carries out genetic breeding by methods such as physical chemistry, and the like, carries out protoplast fusion on an obtained high-yield mutant strain to obtain a series of fusions, and carries out large-scale filter paper enzyme activity screening work on the fusions to finally obtain the high-yield strain PPL 3-1. Compared with other Trichoderma reesei industrial strains Rut-C30, the cellulase system of the cellulase high-yield strain has the advantages that the optimum pH value and the optimum temperature are consistent, the beta-glucosidase enzyme activity has certain advantages, the pNPGase enzyme activity of the crude enzyme solution reaches more than 30IU/mL, the bottleneck that the beta-glucosidase of common cellulase industrial production strains is insufficient is overcome, the filter paper enzyme activity is more than 20IU/mL, and the filter paper enzyme activity also has advantages compared with Rut-C30, so that the cellulase high-yield strain is a good industrial cellulase strain. The cellulase can be used in the fields of food, feed, health care, biological energy and the like other industrial strains of trichoderma reesei, and has very high application value.
The high-yield strain is obtained, the activity of beta-glucosidase is obviously improved, and the carbon source fermented and cultured by the transformant is simple and easily-obtained agricultural waste such as bran and the like, so that the high-yield strain has a very obvious effect on improving the hydrolysis efficiency of the cellulase preparation, greatly reduces the production cost if being applied to the production of other food industries, and has wider industrial application potential.
Furthermore, the high-yield cellulase strain PPL3-1 can be used as an original strain, and can be further improved by means of laboratory domestication, genetic breeding, molecular genetic manipulation and the like to obtain a derivative strain with higher yield or more optimized enzyme system. The genetic breeding and screening of the PPL3-1 are carried out to obtain the strain with more improved enzyme activity, and then the monospore separation is carried out, so that the high-yield strain PPLU4-6 with the filter paper enzyme activity improved by 30% can be further screened and obtained, and the high-yield strain can be used as the object of molecular genetic operation to carry out the genetic operation without screening marks, thereby having huge application prospect in industry.
Furthermore, the derivative strain PPLU4-6 (uracil-deficient strain) of the high-yield cellulase strain PPL3-1 can be used as a target of molecular manipulation, such as knocking-in and knocking-out of genes and the like, and purposeful genetic modification can be carried out, or cellulase genes with too low expression level of Trichoderma reesei, such as over-expressed cellulase activator Xyr1 and the like, or cellulase repressor Cre1 and the like can be knocked out.
The strain of the present invention is a living cell, and once a culture mixture of spores, hyphae, protoplasts, and related living cells of the strain of the present invention is obtained, the strain of the present invention can be obtained in large quantities by means of inoculation, passaging, regeneration, and the like. This is usually a method of obtaining the living cells of the present invention by inoculating them into a solid plate medium or a liquid medium to perform scale-up culture of the strain. The obtained living cells can be further subjected to laboratory domestication, genetic breeding, molecular genetic manipulation and the like to obtain mutants and transformants. The invention may also be used as a host cell for heterologous expression.
Methods well known to those skilled in the art can be used to mutagenize living cells of the present invention to cause changes in gene coding, enzymatic activity characteristics, and morphology of the living cells. These methods include physical methods using radiation, particles, laser, ultraviolet light, etc., and chemical mutagenesis methods using alkylating agents, base analogues (base analogues), hydroxylamines (hydroxylamines), acridine pigments, etc. The mutagenesis may be a multiple-generation mutagenesis of the above method or methods and is not limited to these methods. Based on the strain provided by the invention, breeding can be further carried out in a physical and chemical mode, and a new cellulase gene and related regulatory genes can also be introduced, so that the enzyme production performance of the obtained mutant and transformant can be further improved, and the breeding method is one or more than one combination.
Methods well known to those skilled in the art can be used to construct expression constructs (vectors) and further engineer the strains of the invention. For example, further improvements (e.g., increased expression of beneficial factors, decreased expression of deleterious factors) have been made in the signaling pathways, and proteins involved in cellulase production that have been or are newly discovered in the strain.
Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. The procedures used are well known in the art. Such as agrobacterium-mediated fungal transformation methods, protoplast transformation methods, electroporation transformation methods, CRISPR-Cas9 genome editing methods, particle gun methods, and the like, and are not limited to these methods.
The Trichoderma reesei strain PPL3-1 disclosed by the invention can utilize industrial and agricultural production wastes containing lignocellulose, such as bran, corn steep liquor, bean cake powder and other cheap raw materials, to produce cellulase through liquid or solid state fermentation, and has the advantages of high activity of the produced cellulase, reasonable components and strong lignocellulose hydrolysis capacity. Under the same fermentation conditions, the strain has twice yield of the common industrial strain Rut-C30 cellulase. The invention provides a new strain resource for solving the problems of high production cost, low saccharification efficiency and the like caused by low enzyme activity and unreasonable enzyme components in the utilization of cellulose resources.
The application of the invention in preparing cellulase can be realized by liquid fermentationIn a preferred embodiment, the fermentation process comprises: (1) activating Trichoderma reesei PPL3-1 strain on slant or flat plate made of potato culture medium, and making into product with concentration of 106～108mL-1Inoculating the spore suspension into a Saburgh culture medium (seed culture medium: 1% yeast extract, 1% peptone and 4% glucose) according to the inoculation amount of 10%, performing shaking culture at 28 ℃ and 200rpm to obtain a seed solution, then inoculating the seed solution into a liquid fermentation culture medium according to the inoculation amount of 10%, wherein the initial pH is 5.0, the liquid loading amount is 10mL, the liquid loading amount is 50mL, and the seed solution is cultured in a triangular flask at 28 ℃ and 200rpm for 5-7 days; (2) centrifugally separating the fermentation liquor obtained in the step (1), and taking supernatant as crude enzyme liquid; the fermentation medium is an inorganic salt broth (0.4% KH) containing 5% inducer (3% microcrystalline cellulose and 2% bran)2PO4，0.28％(NH4)2SO4，0.06％MgSO4·7H2O，0.05％CaCl2，0.06％urea，0.3％tryptone，0.1％Tween 80，0.5％CaCO3，0.001％FeSO4·7H2O，0.00032％MnSO4·H2O，0.00028％ZnSO4·7H2O，0.0004％CoCl2)。
The medium and the culture method applied to culture the strain of the present invention are not limited to those disclosed above, and other media and culture methods conventionally applied to culture trichoderma reesei may also be applied to the present invention.
The fermentation system can be industrially produced in a system scale-up manner as described above, and those skilled in the art can appropriately adjust the system to facilitate the growth or production of the strain according to the general knowledge grasped depending on the size of the system.
The crude enzyme liquid is fermented by the liquid, and relatively pure cellulase or enzyme powder can be obtained by ultrafiltration, salting out or organic solvent precipitation and other methods. The filter paper enzyme activity (FPA), the CMC enzyme activity and the beta-glucosidase enzyme activity of the produced cellulase are measured through fermentation. It is to be understood that the method for isolating and purifying cellulase is not limited to those provided in the present invention, and other methods known to those skilled in the art may be applied to the present invention.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.
Example 1 cellulase production Using Trichoderma reesei high producing strains
In order to ensure the cellulase production capability of the obtained PPL3-1 (the preservation number is CCTCC NO: M2014561), the method is realized by liquid fermentation and determination of the filter paper enzyme activity of the crude enzyme solution:
(1) inoculating Trichoderma reesei PPL3-1 strain on plate made of potato culture medium, culturing at 28 deg.C for 7 days, and making into 10% extract6～108Inoculating spore suspension of each mL into Saburgh's medium (seed culture medium (v/v): 1% yeast extract, 1% peptone and 4% glucose) with an inoculation amount of 10% (v/v), performing shake culture at 28 ℃ and 200rpm to obtain a seed solution, inoculating the seed solution into a liquid fermentation culture medium with an inoculation amount of 10% (v/v), performing initial pH of 5.0, loading 10mL into a 50mL triangular flask, and performing shake culture at 28 ℃ and 200rpm for 5-7 days; the fermentation medium is an inorganic salt broth (0.4% KH) containing 5% inducer (3% microcrystalline cellulose and 2% bran)2PO4，0.28％(NH4)2SO4，0.06％MgSO4·7H2O，0.05％CaCl20.06% urea, 0.3% peptone, 0.1% Tween 80, 0.5% CaCO3，0.001％FeSO4·7H2O，0.00032％MnSO4·H2O，0.00028％ZnSO4·7H2O，0.0004％CoCl2)，
(2) And (2) carrying out centrifugal separation on the fermentation liquor obtained in the step (1), and taking supernatant as crude enzyme liquid.
(3) Adding the crude enzyme solution of trichoderma reesei PPL3-1 into filter paper in 0.05mol/L acetic acid-sodium acetate or citric acid-sodium citrate buffer solution with pH of 5.0, hydrolyzing for 60min at 50-60 ℃, and determining the enzyme activity of the enzyme on the filter paper. The result shows that the enzyme activity can reach more than 20 IU/mL.
Example 2 degradation of lignocellulose by cellulase
In order to verify the degradation capability of the Trichoderma reesei high-yield cellulase strain PPL3-1 on natural lignocellulose. The inventor adopts 10% dilute sulfuric acid treated corn straws, uses pretreated straws after washing and drying as materials, adds 30 mu L of crude enzyme liquid of cellulase produced by Trichoderma reesei PPL3-1 into 30mg of pretreated corn straws in 1ml of 0.05mol/L acetic acid-sodium acetate or citric acid-sodium citrate buffer solution with the pH value of 5.0, vibrates in a vibration table at the speed of 200rpm, hydrolyzes for 24 hours at 50 ℃, takes supernatant after centrifugation, measures reducing sugar in the supernatant by a DNS method, and converts the total amount of the reducing sugar in the system. Researches find that the cellulase produced by the strain can produce 12-16 mg/mL reducing sugar (simple sugar), while the cellulase of Rut-C30 as a reference only produces 5-8mg/mL reducing sugar (simple sugar), and has obvious advantages.
From the above results, it can be seen that the cellulase produced by the strain of the present invention can hydrolyze the β -1, 4-glucosidic bonds to obtain reducing sugars.
Example 3 characterization of Trichoderma reesei highly producing Strain PPL3-1
Transmission electron microscope observation after sporulation of the PPL3-1 strain shows that the number of vesicles in PPL3-1 is obviously increased compared with Rut-C30, and the cell wall is also obviously thickened (figure 1), which is probably related to the capability of PPL3-1 to produce cellulase at high yield.
Example 4 genetic engineering of Trichoderma reesei strain PPL3-1
Inoculating Trichoderma reesei PPL3-1 strain on plate made of potato culture medium, culturing at 28 deg.C for 7 days, washing spores with Tween-80 (containing 0.85% NaCl and 0.02% Tween-80), and making into 10% concentrate6～108mL-1The spore suspension was uniformly spread on a plate made of a basic culture medium for Trichoderma reesei (supplemented with 2% and 3% ball-milled cellulose powder and 0.1% triton X-100) and cultured. After a single colony grows out on the plate, the single colony with the obviously increased hydrolysis ring is inoculated to 24 holesFurther culturing the plate at 28 ℃ for 7 days, coating the plate on the plate, selecting single bacteria with obviously increased hydrolysis rings, culturing, and selecting a strain with high cellulase yield by cellulase activity determination, thereby selecting a strain with high cellulase yield. The basic culture medium of the trichoderma reesei is basic inorganic salt culture solution (1% KH according to w/v)2PO4，0.6％(NH4)2SO4，0.1％MgSO4·7H2O, 0.3% sodium tricitrate.2H2O，0.0005％FeSO4·7H2O，0.00016％MnSO4·H2O，0.00014％ZnSO4·7H2O，0.0002％CaCl2·2H2O, pH 5.8) and uridine was added to a final concentration of 0.5% (w/v).
And (3) performing monospore separation on the obtained high-yield strain, and selecting a strain PPLU4-6 with stable and high yield of cellulase after passage of not less than 10 generations.
The PPLU4-6 strain is inoculated on a flat plate made of a potato culture medium containing 0.5% (w/v) uridine, the flat plate is cultured for 7 days at 28 ℃, the spores are washed by Tween physiological saline (containing 0.85% NaCl and 0.02% Tween-80), the original strain PPL3-1 is synchronously inoculated, after the flat plate is cultured for 7 days at 28 ℃, liquid fermentation is carried out according to the method described in example 1, and the filter paper enzyme activity of the crude enzyme solution is determined, wherein the filter paper enzyme activity of the PPLU4-6 monospore strain reaches 26U/mL and is improved by 30% compared with the filter paper enzyme activity of the original strain PPL3-1 (figure 2).
The present inventors found that PPLU4-6 did not survive in medium lacking uridine, and therefore examined whether PPLU4-6 has a defect in the uridine synthesis-associated genes ura3, ura 5. According to the genome sequence of Trichoderma reesei RutC-30 in JGI, the amplification primers of ura3 and ura5 genes are designed, and the primer sequences are respectively:
ura3F：5’-GCTCTAGAATGGCACCACACCCGACGCT-3’(SEQ ID NO:1)；
ura3R：5’-GCTCTAGACTATCGCAGCAGCCTCTCGG-3’(SEQ ID NO:2)；
ura5F：5’-GCTCTAGAATGGCTACCACCTCCCAGCT-3’(SEQ ID NO:3)；
ura5R:5’-GCTCTAGATCAGTCAGTCGCCTTGTACT-3’(SEQ ID NO:4)。
amplifying ura3 and ura5 gene fragments of Trichoderma reesei PPL3-1 by using KOD high fidelity enzyme, adding A at the 3' end for treatment, cloning into a pMD18-T simple vector by using a TA cloning kit, verifying positive cloning by PCR, and then, sampling and sequencing. The sequence of the wild type of ura5 gene is shown in SEQ ID NO. 5(711 bp). Sequencing of the sequence obtained by amplification in this example showed a mutation in the amino acid sequence of ura5 gene (L135P, where the corresponding site in the coding sequence was mutated from CTG to CCG). Therefore, it was confirmed that the uridine auxotrophy of PPL3-1 was caused by mutation in ura5 gene. PPLU4-6 can be further genetically engineered using this mutation as a selection marker.
The ura5 gene (SEQ ID NO:6) containing the promoter sequence was amplified from Penicillium oxalicum as a selection marker by PCR using primers:
a forward primer: 5 'TCTAGAGCCGCATAGTTAAGCC 3 (SEQ ID NO:10), which has added to its 5' end an Xba I recognition site: TCTAGA;
reverse primer: 5 'ACTAGTCAGGGCTGGTGACGGAA 3 (SEQ ID NO:11), which has added to its 5' end the Spe I recognition site ACTAGT,
the amplified product was double-digested with Xba I and Spe I and ligated to pHDt/sk (see Microbial Cell facilities, 2012, 11:21) which had been similarly double-digested, to obtain pHDt/sk-ura 5.
Trichoderma reesei cellulase transcriptional activator Xyr1(SEQ ID NO:7) was isolated from the genome of strain PPL3-1 by PCR using the following primers:
a forward primer: 5 ' TCTAGAATGTTGTCCAATCCTCTCCGTCG 3 ' (SEQ ID NO:8), with the addition of an Xba I recognition site at the 5 ' end: TCTAGA;
the reverse primer was 5 ' TCTAGATTAGAGGGCCAGACCGGTTCCGT 3 ' (SEQ ID NO:9) with the addition of an Xba I recognition site at the 5 ' end: TCTAGA.
And (3) purifying the PCR product, carrying out enzyme digestion by using Xba I, recovering an enzyme digested DNA fragment by using an Axygen PCR product column recovery kit, dephosphorylating the DNA fragment and the recovered vector pHDt/sk-ura5 subjected to the same enzyme digestion, and connecting overnight at 16 ℃ by using T4DNA ligase to obtain the recombinant expression vector pHDt/sk-ura5-Xyr 1. His Tag (6 × His-Tag) provided at the N-terminus of the expression product, facilitates subsequent purification. The constructed plasmid pHDt/sk-ura5-Xyr1 is transformed into Agrobacterium tumefaciens AGL1 and transformed into Trichoderma reesei PPLU4-6 strain under the mediation of Agrobacterium tumefaciens. The obtained strain is a strain overexpressing an activator.
The obtained transformant is subjected to liquid fermentation according to the method described in example 1, and the filter paper enzyme activity of the crude enzyme solution is measured, wherein the filter paper enzyme activity of the PPLXIM monospore strain reaches 30U/mL, and the enzyme activity is remarkably improved (figure 2).
Biological material preservation
Trichoderma reesei (anamorph)/Hypocrea jeciona (teleomorph) PPL3-1 (hyg) of the inventionr) (abbreviated as PPL3-1) is preserved in China center for type culture Collection (CCTCC, Wuhan, China) with the preservation number of CCTCC NO: M2014561; the preservation date 2014 11 months and 11 days.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Claims (10)
1. An isolated Trichoderma reesei strain, wherein the preservation number of the strain in China center for type culture Collection is CCTCC NO: M2014561.
2. A spore which is a spore of the trichoderma reesei strain of claim 1.
3. A mycelium of the trichoderma reesei strain of claim 1.
4. A protoplast of the Trichoderma reesei strain of claim 1.
5. Use of a strain of trichoderma reesei according to claim 1, for the production of cellulases; or for hydrolysis of beta-1, 4-glycosidic bonds.
6. Use according to claim 5, wherein the cellulase is for the hydrolysis of lignocellulose.
7. Use according to claim 6, wherein the lignocellulose is present in a material comprising the group consisting of: corn stover, corn cobs, rice straw, rice hulls, wheat straw, sorghum stalks, sugar cane bagasse, or combinations thereof.
8. A method of producing cellulase enzymes, said method comprising: culturing the Trichoderma reesei strain of claim 1, such that it produces cellulase.
9. The method of claim 8, wherein the culturing method comprises:
(1) the method of activating spores of Trichoderma reesei strain according to claim 1 to a concentration of 106～ 108Spore suspension of seed/mL, and preparing into seedInoculating the seed liquid into a liquid fermentation culture medium, culturing at 28 + -2 deg.C and 200 + -50 rpm in a shaking table with initial pH of 5.0 + -0.2 for 5-7 days; the fermentation culture medium is an inorganic salt culture solution containing microcrystalline cellulose with the mass volume ratio of 3 +/-1% and bran with the mass volume ratio of 2 +/-0.5%;
(2) and (2) carrying out centrifugal separation on the fermentation liquor obtained in the step (1), and taking supernatant as crude enzyme liquid.
10. A method of hydrolyzing lignocellulose, the method comprising: (i) producing cellulase using the strain trichoderma reesei according to claim 1, and (ii) hydrolyzing lignocellulose using the obtained cellulase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410853297.6A CN105802854B (en) | 2014-12-30 | 2014-12-30 | Cellulase high-yield strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410853297.6A CN105802854B (en) | 2014-12-30 | 2014-12-30 | Cellulase high-yield strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802854A CN105802854A (en) | 2016-07-27 |
| CN105802854B true CN105802854B (en) | 2020-10-16 |
Family
ID=56421600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410853297.6A Active CN105802854B (en) | 2014-12-30 | 2014-12-30 | Cellulase high-yield strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802854B (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663520A (en) * | 2016-07-29 | 2018-02-06 | 东莞泛亚太生物科技有限公司 | Lift the cellulase of activity |
| CN108251310B (en) * | 2016-12-29 | 2020-12-01 | 青岛蔚蓝生物集团有限公司 | Novel trichoderma host cell and application thereof |
| CN108707595B (en) * | 2018-07-03 | 2021-07-27 | 华东理工大学 | Method for improving yield of cellulase produced by fungi |
| BR112022009620A2 (en) * | 2019-11-18 | 2022-08-02 | Kao Corp | MUTANT FILAMENT FUNGUS AND METHOD FOR PROTEIN PRODUCTION USING THE SAME |
| CN111876335A (en) * | 2020-07-31 | 2020-11-03 | 深圳市顺盛农业科技发展有限公司 | Fungus capable of degrading cellulose and separation method and application thereof |
| CN112961788B (en) * | 2021-02-24 | 2023-06-13 | 江南大学 | Method for high-yield xylanase in Trichoderma reesei and application thereof |
| CN113151264A (en) * | 2021-03-11 | 2021-07-23 | 上海中溶科技有限公司 | Method for constructing high-yield cellulase strain by utilizing forward regulatory gene and application |
| CN114149926B (en) * | 2021-11-22 | 2023-12-05 | 盐城师范学院 | Fungus fusion RZ1 for degrading cellulose and application thereof |
| CN115011647A (en) * | 2022-04-29 | 2022-09-06 | 广西大学 | Method for producing cellulase and application of cellulase in bagasse cellulose |
| CN116574162B (en) * | 2023-06-20 | 2024-05-24 | 山东大学 | Trichoderma reesei transcription activator Xyr mutant and application thereof in improving cellulase and xylanase yields |
| CN116813728B (en) * | 2023-07-07 | 2024-08-09 | 山东大学 | Fungal lignocellulose degrading enzyme synthesis regulatory protein mutant and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602648A (en) * | 2013-12-04 | 2014-02-26 | 中国科学院天津工业生物技术研究所 | Fermentation process for improving cellulase production level |
| CN103740600A (en) * | 2013-12-23 | 2014-04-23 | 湖南鸿鹰生物科技有限公司 | Strain for producing cellulases |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101735993B (en) * | 2010-01-19 | 2012-07-04 | 浙江大学 | Method for efficiently producing cellulase |
-
2014
- 2014-12-30 CN CN201410853297.6A patent/CN105802854B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602648A (en) * | 2013-12-04 | 2014-02-26 | 中国科学院天津工业生物技术研究所 | Fermentation process for improving cellulase production level |
| CN103740600A (en) * | 2013-12-23 | 2014-04-23 | 湖南鸿鹰生物科技有限公司 | Strain for producing cellulases |
Non-Patent Citations (1)
| Title |
|---|
| 饲用高产纤维素酶菌株的诱变选育;张晓煊 等;《中国饲料》;20110705(第13期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802854A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105802854B (en) | Cellulase high-yield strain and application thereof | |
| Zhang et al. | Improvement of cellulase production in Trichoderma reesei Rut-C30 by overexpression of a novel regulatory gene Trvib-1 | |
| DK2342329T3 (en) | Beta-glucosidase variants with improved activity, and use thereof | |
| CN106978360B (en) | High-yield cellulase trichoderma reesei recombinant strain and application thereof | |
| US7510857B2 (en) | Thermostable cellulase and methods of use | |
| Meng et al. | Engineering Trichoderma reesei Rut-C30 with the overexpression of egl1 at the ace1 locus to relieve repression on cellulase production and to adjust the ratio of cellulolytic enzymes for more efficient hydrolysis of lignocellulosic biomass | |
| US11286472B2 (en) | Variants of exoglucanases having improved activity and uses thereof | |
| US10457925B2 (en) | Process for the production of cellulolytic and/or hemicellulolytic enzymes | |
| WO2021143696A1 (en) | Factor regulating protein expression efficiency of trichoderma reesei, and regulation method and use thereof | |
| Zhao et al. | Expression and characterization of GH3 β-Glucosidase from Aspergillus niger NL-1 with high specific activity, glucose inhibition and solvent tolerance | |
| CN113980938B (en) | Method for obtaining high-yield high-stability heterologous beta-glucosidase | |
| US20170152498A1 (en) | Variants of exoglucanases having improved activity and uses thereof | |
| JP7334620B2 (en) | Trichoderma reesei mutant strain and method for producing protein | |
| US9719112B2 (en) | Mutant beta-glucosidases having enhanced activity and a method for producing bioethanol using the same | |
| CN108949579B (en) | Thermoascus thermophilus gene expression system | |
| CN113943662A (en) | Trichoderma reesei strain for heterologous expression of xylanase/cellulase CbXyn10c gene and application thereof | |
| KR101350955B1 (en) | Novel exoglucanase and the Use thereof | |
| US10000780B2 (en) | Endoglucanase variants having improved activity, and uses of same | |
| CN105907737B (en) | Beta-glucosidase mutant with high catalytic efficiency and coding gene and application thereof | |
| CN111088244B (en) | Application of protease gene in promotion of cellulase production and complex nitrogen source utilization | |
| JP6518107B2 (en) | Transcription factor mutant | |
| US9920308B2 (en) | Endoglucanase variants having improved activity, and uses of same | |
| US9765315B2 (en) | Cellulose and/or hemicelluloses degrading enzymes from Macrophomina phaseolina and uses thereof | |
| JP2014168424A (en) | Filamentous fungus mutant with cre1 gene not functioning | |
| US20230303991A1 (en) | Method of Producing Proteins Using a Trichoderma Fungus Strain in Which the CEL1A Gene is Invalidated |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200610 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |