CN113151264A

CN113151264A - Method for constructing high-yield cellulase strain by utilizing forward regulatory gene and application

Info

Publication number: CN113151264A
Application number: CN202110262850.9A
Authority: CN
Inventors: 杨明; 李秋园; 代淑梅
Original assignee: Shanghai Zhongrong Technology Co ltd
Current assignee: Shanghai Zhongrong Technology Co ltd
Priority date: 2021-03-11
Filing date: 2021-03-11
Publication date: 2021-07-23

Abstract

The invention relates to a method for constructing a high-yield cellulase strain by utilizing a forward regulatory gene and application thereof. The invention firstly connects PpgdA gene and forward regulatory gene Xyr1 gene to a plasmid vector to obtain a new recombinant plasmid, wherein the base sequence of the PpgdA gene is shown as SEQ ID NO.1, and the gene sequence of the forward regulatory gene Xyr1 is shown as SEQ ID NO. 2. And then the recombinant plasmid containing the PpgdA gene and the positive regulatory gene Xyr1 gene is transformed into a corresponding host cell to prepare an expression transformant. And finally, transforming the recombinant expression transformant into trichoderma reesei to obtain a recombinant strain. Compared with the prior art, the invention constructs an expression element of the positive regulatory gene Xyr1 with the strong promoter PpgdA, and transforms the expression element into Trichoderma reesei to obtain a genetic engineering strain with high cellulase yield, thereby improving the expression level of the cellulase.

Description

Method for constructing high-yield cellulase strain by utilizing forward regulatory gene and application

Technical Field

The invention relates to the technical field of bioengineering, in particular to a method for constructing a high-yield cellulase strain by utilizing a forward regulatory gene and application thereof.

Background

With the increasing shortage and decreasing reserves of petroleum resources, agricultural straws are used as raw materials to produce fuel ethanol and various chemical products by fermentation so as to meet the development requirements of human society, and the fuel ethanol is considered to be a clean energy source capable of replacing petroleum. Experts think that the production of ethanol by lignocellulose substances represented by crop straws has good development prospect, and is helpful to solve the problem of treatment of agricultural production wastes, so that the resource crisis and the grain crisis are relieved, the method has important significance on environmental pollution, and the sustainable development is guaranteed.

At present, all countries in the world actively research and utilize non-food means to produce biofuel so as to solve the increasingly serious problems of energy crisis, climate and food shortage. Lignocellulose, which is the most abundant polysaccharide substance on earth, has been the hot field of research in various countries to produce fuel ethanol by using it.

Lignocellulose comprises a major component including cellulose, hemicellulose and lignin, as well as minor amounts of other components such as acetyl, mineral and phenolic substituents. Depending on the type of lignocellulosic biomass, polymers form complex three-dimensional heterogeneous structures with different degrees of polymerization and different compositions. The classical theory holds that cellulose degradation is completed under the synergistic action of three cellulase components, and endo-1, 4-beta-glucanase randomly inscribes a cellulose chain; exo-1, 4-beta-glucanase is hydrolyzed from the reducing end or the non-reducing end of the cellulose polymer; beta-glucosidase hydrolyzes endo and exo-enzymes to cellobiose, which is formed, further to glucose.

However, in the process of bioconversion of lignocellulosic biomass, high production cost of cellulase is one of the most important bottlenecks that restrict its industrial application. Therefore, the improvement of the production efficiency of the strain cellulase and the reduction of the production cost are very important.

In view of this, many researchers have made a lot of studies on how to increase the expression level of cellulase and reduce the cost. At present, the following researches are mainly carried out to improve the expression of cellulase through genetic engineering and molecular biology technologies:

1. heterologous expression of cellulase genes. Bjorn Alriksson and the like express the gene Cel7B of the Hypocrea jecorina endoglucanase in Aspergillus niger, ethanol fermentation still distillate is taken as a substrate for fermentation, the enzyme activity is obviously improved compared with that of an original strain EG, and Aspergillus niger can also convert byproducts in the fermentation process, including acetic acid, furan aldehyde, phenols and other inhibitors [ ALRIKSSON B, ROSE S H, VAN ZYL W H, SJODE A, NILVEBRANT N-O, JONSSON L J.Cellulase product from specific Lignocellulose hydrotalcites by recombined Aspergillus niger [ J ]. Applied and Environmental Microbiology,2009,75(8):2366-74 ]. Luxixiutine drives cbhB gene to express in Aspergillus niger by glaA strong promoter, so that the filter paper enzyme activity is improved by 1.52 times, and the CBH enzyme activity is improved by 1.61 times [ construction of Trichoderma reesei CBH1 gene expression vector and expression in Aspergillus niger [ D ], Shanxi university of agriculture, 2014 ]; sujin et al respectively express Clostridium thermocellum cellulosome, endoglucanase, exoglucanase CBH II from Riemerella and beta-glycosidase BGL I from Aspergillus oryzae in Saccharomyces cerevisiae by surface display technology, and finally the ethanol yield reaches 1.8g/L by optimizing the proportion of different yeast engineering bacteria, which is 20% higher than the original yield [ KIM S, BAEK S H, LEE K, HAHN J S.Cellulosic ethanol production using a yeast consortium displaya minimululosome and beta-glucopyranosase [ J ]. Microbial cells industries, 2013,12:7 ].

2. The expression of cellulase is regulated by a transcription regulatory factor. Research shows that for the production of filamentous fungus cellulase, the global regulation of cellulase transcription factor is more effective than the directional improvement of main cellulase activity, and the growth incompatibility repressor gene vib1_trTransformed into Trichoderma reesei Rut-C30 to obtain Trichoderma reesei. Strain Vib1 was extracellular compared to Trichoderma reesei Rut-C30Protein secretion and cellulase production are obviously improved, the cellulase activity of Vib1 in cellulose and bran culture medium is improved by about 200 percent compared with that of Rut-C30, 3.3U/ml is reached, and the enzyme activities of exo-cellulase, endo-cellulase and beta-glucosidase are all improved (Journal of Industrial Microbiology)&Biotechnology 2013, 40: 633-641; mcrobiology open, 2013, 2: 595 and 609; PLoS Genetics, 2015, 11: e 1005509); liu Fu Chuan and the like adopt an interleaved thermoasymmetric PCR method to clone and obtain a cellulase transcription regulatory factor bglr gene and upstream and downstream sequences thereof, and a strain EU7-11 delta bglr of which the bglr gene is knocked out is obtained through homologous exchange. Compared with a control strain, the highest values of the produced filter paper enzyme, exoglucanase, xylanase activity and secretory protein are respectively increased by 39%, 22%, 16% and 20%, while the beta-glucosidase activity is reduced by 47%, and the expression level of the beta-glucosidase gene bgl1 is obviously reduced. Further analysis revealed that the deletion of BglR inhibited the growth of strain EU7-22 on a medium with specific poly/oligosaccharides as carbon source and caused a change in the pH of the fermentation broth. The results prove that BglR plays a positive regulation role on beta-glucosidase, and can provide reference for constructing engineering strains for efficiently degrading cellulose (Liu Fuchuan, Xue Yong, Liu Jian, etc.. transcription regulation factor BglR influences on the expression of the hypocrea orientalis cellulase [ J]The university of Xiamen journal (Nature science edition), 2018,57(04): 494-.

Disclosure of Invention

The invention aims to provide a method for constructing a high-yield cellulase strain by utilizing a forward regulatory gene and application thereof.

The purpose of the invention can be realized by the following technical scheme:

in a first aspect of the invention, a strong promoter PpgdA is provided, and the gene sequence of the promoter PpgdA is shown in SEQ ID No. 1.

In a second aspect of the invention, a method for obtaining said strong promoter PpgdA is provided.

The PpgdA promoter was obtained in the following manner:

the primers were designed for PCR using pPK2 plasmid as template and verified by 1% agarose gel electrophoresis.

The upstream primer PpgdA-F:

5'-ACCTCCCCACATCACAGAAATCAAAACTAGTTGTGACGAACTCGTGA GCTC-3' (SpeI restriction site underlined)

The downstream primer PpgdA-R:

5'-AGTAACGTTAAGTGGATCCGAATTCGATATCGGTGATGTCTGCTCAAG CGG-3' (EcoR V cleavage site underlined)

And (3) PCR reaction system: 10. mu.L of DNA mix, 0.4. mu.L of each of the upstream and downstream primers (10 ng/. mu.L), 0.2. mu.L of DNA template (10 ng/. mu.L), 0.8. mu.L of DMSO, and 8.2. mu.L of sterile water in a total volume of 20. mu.L.

And (3) PCR reaction conditions: pre-denaturation at 95 deg.C for 5min, deformation at 95 deg.C for 30s, annealing at 50 deg.C for 1min, extension at 72 deg.C for 10min, circulation for 20 times, extension at 72 deg.C for 20min, and storage at 4 deg.C. After the reaction, the PCR product was subjected to 1% agarose electrophoresis.

Then, PCR product recovery and purification are also included, and the PCR product recovery and purification can be realized by adopting the technical means commonly used in the field.

In a third aspect of the invention, a recombinant plasmid containing the PpgdA gene is provided.

The recombinant plasmid containing the PpgdA gene is a novel recombinant plasmid obtained by connecting the PpgdA gene to a plasmid vector, and the base sequence of the PpgdA gene is shown as SEQ ID NO. 1.

In one embodiment of the invention, the plasmid vector is a PGPD-hph plasmid.

In one embodiment of the present invention, there is provided a method for constructing a recombinant plasmid containing PpgdA gene, comprising:

carrying out Spe I and EcoR V double enzyme digestion on the PGPD-hph plasmid, and then connecting the PpgdA gene to the PGPD-hph vector by adopting a Gibson connection method to obtain a new recombinant plasmid pGPDA-hph.

A double enzyme digestion system: 1.5. mu.L each of Spe I and EcoR V enzymes, 5. mu.L of cut smart Buffer, and 2. mu.g (by concentration) of DNA were supplemented with water to 50. mu.L, 37 ℃ for 3 hours.

Gibson ligation system: enzyme of 6 mu L, carrier and fragment of 4 mu L in total, the proportion is 1: 3-5, the temperature of metal bath is 50 ℃, and the time is 1 h.

In a fourth aspect of the present invention, there is provided a recombinant expression transformant containing the PpgdA gene. The recombinant expression transformant can be prepared by transforming the recombinant plasmid containing the PpgdA gene into a corresponding host cell by a conventional technique in the field. The host cell is a conventional host cell in the art as long as it is sufficient that the recombinant expression vector (recombinant plasmid containing PpgdA gene) can stably self-replicate and the PpgdA gene can be efficiently expressed.

In one embodiment of the present invention, there is provided an obtaining manner of a recombinant expression transformant containing a PpgdA gene: the recombinant plasmid containing PpgdA gene was transformed into E.coli competent DH5 alpha.

Transforming the recombinant plasmid containing the PpgdA gene into escherichia coli competent DH5 alpha, identifying colony PCR as a positive clone transformant, performing 5ml LB liquid test tube culture for 12-16h, and sending to Pungkoku organism (Beijing) GmbH for DNA sequencing; the sequences obtained after sequencing were aligned using DNAMAN software to verify the correctness of the sequences and the reliability of the method. Sequencing results show that the obtained DNA fragment contains a promoter PpgdA gene, which indicates that the recombinant plasmid is successfully constructed.

The invention also provides a small-scale extraction method of the promoter recombinant plasmid pGPDA-hph, which can be realized by adopting a Plamid Miniprep Kit of NEB company.

In the fifth aspect of the invention, a forward regulatory gene Xyr1 and an acquisition method thereof are provided.

The gene sequence of the forward regulatory gene Xyr1 is shown in SEQ ID NO. 2. Among them, the forward regulatory gene Xyr1 gene is a positive regulatory transcription factor known to have a significant effect on cellulase production.

The acquisition mode of the forward regulatory gene Xyr1 can be as follows:

the DNA of the Trichoderma reesei genome is used as a template, a primer is designed to amplify Xyr1 gene, and the gene is verified by 1% agarose gel electrophoresis.

Upstream primer Xyr 1-F:

5'-TAACAGCTACCCCGCTTGAGCAGACATCACCGATATCATGTTGTCCAAT CCTCTCCG-3'

downstream primer Xyr 1-R:

5'-TTTCAGTAACGTTAAGTGGATCCGAATTCGATATCTTAGAGGGCCAGA CCGGTTCC-3'

the forward regulatory gene Xyr1 can be obtained by PCR amplification.

In a sixth aspect of the present invention, there is provided a recombinant plasmid containing both the PpgdA gene and the forward regulatory gene Xyr1 gene.

The recombinant plasmid containing the PpgdA gene and the forward regulatory gene Xyr1 gene simultaneously refers to a new recombinant plasmid obtained by connecting the PpgdA gene and the forward regulatory gene Xyr1 gene to a plasmid vector, wherein the base sequence of the PpgdA gene is shown as SEQ ID No.1, and the gene sequence of the forward regulatory gene Xyr1 is shown as SEQ ID No. 2.

In one embodiment of the present invention, there is provided a method for obtaining a recombinant plasmid containing both a PpgdA gene and a forward regulatory gene Xyr1 gene:

carrying out EcoR V single enzyme digestion on the obtained recombinant plasmid pGPDA-hph plasmid containing the PpgdA gene, then carrying out dephosphorylation on the plasmid subjected to enzyme digestion, and finally connecting the Xyr1 gene to the pGPDA-hph vector by adopting a Gibson connection method to obtain a new recombinant plasmid pGPDA-hph-Xyr 1.

Single enzyme digestion system: 5 μ L of EcoR V enzyme, 5 μ L of cut smart Buffer, 2 μ g (by concentration) of DNA in water to 50 μ L, 37 ℃ for 3 hours.

Dephosphorizing system: dephosphorylation enzyme 0.5. mu.l, Buffer 5. mu.l, enzyme digestion product 30. mu.l, DDW to 50. mu.l.

In the seventh aspect of the present invention, there is provided a recombinant expression transformant containing both the PpgdA gene and the forward regulatory gene Xyr1 gene. The recombinant expression transformant can be prepared by transforming the recombinant plasmid containing the PpgdA gene and the positive regulatory gene Xyr1 gene into corresponding host cells by using a conventional technology in the field. The host cell is conventional in the art, as long as it is sufficient that a recombinant expression vector (a recombinant plasmid containing both the PpgdA gene and the forward regulatory gene Xyr1 gene) can stably replicate by itself and that the PpgdA gene and the forward regulatory gene Xyr1 gene can be efficiently expressed.

In one embodiment of the present invention, there is provided a manner of obtaining a recombinant expression transformant containing both a PpgdA gene and a forward regulatory gene Xyr1 gene: the recombinant plasmid containing both PpgdA gene and positive control gene Xyr1 gene is transformed into Escherichia coli competent DH5 alpha.

The invention also provides PCR preliminary identification of recombinant expression transformant bacterial liquid simultaneously containing PpgdA gene and positive control gene Xyr1 gene

Designing an identifying primer, wherein the size of the identified fragment is 3210 bp.

An upstream primer F: 5'-TCCTTCCCATCCCTTATTCC-3'

A downstream primer R: 5'-GCACTCTTTGCTGCTTGGAC-3'

The PCR system and reaction procedure were as above. And (3) after the reaction is finished, carrying out 1% agarose electrophoresis detection and verification on the PCR product, and verifying the correct colony.

The invention also carries out sequencing on the recombinant plasmid pGPDA-hph-Xyr 1: performing 5ml LB liquid test tube culture for 12-16h for the transformant identified as positive clone by colony PCR, and sending to Darkshire organism (Beijing) GmbH for DNA sequencing; the sequences obtained after sequencing were aligned using DNAMAN software to verify the correctness of the sequences and the reliability of the method. Sequencing results show that the obtained DNA fragment contains a promoter Xyr1 gene, which indicates that the recombinant plasmid is successfully constructed.

The invention also provides a small-scale extraction method of the recombinant plasmid pGPDA-hph-Xyr1, which adopts a Plamid Miniprep Kit of NEB company to extract the plasmid in a small scale, and the specific operation steps are the same as the small-scale extraction method of the recombinant plasmid pGPDA-hph.

The recombinant expression transformant of the present invention, which contains both the PpgdA gene and the forward regulatory gene Xyr1 gene, can also be referred to as an expression element of the forward regulatory gene Xyr1 having a strong promoter PpgdA.

The present invention also provides a method for amplifying an expression element of the forward regulatory gene Xyr1 with a strong promoter PpgdA

The recombinant plasmid pGPDA-hph-Xyr1 is used as a template, a primer is designed, a transformation element is amplified, and the fragment size is 6800 bp. Verified by electrophoresis on a 1% agarose gel.

The PCR system and procedure were as above.

An upstream primer PCH-F: 5'-TCCCGCCTGTATCGGACCTGCGCGA-3'

The downstream primer PCH-R: 5'-ATGTGCTGCAAGGCGATTAAGTTGG-3'

In an eighth aspect of the present invention, there is provided a recombinant strain, wherein the recombinant strain is:

the expression element of the positive regulatory gene Xyr1 with the strong promoter PpgdA is transformed into Trichoderma reesei to obtain a new recombinant strain, and the recombinant strain has high cellulase yield and improves the expression quantity of cellulase.

The recombinant strain is named as ZR/TR-xyr1, and is classified and named as: trichoderma reesei (Trichoderma reesei) with the preservation number of CGMCC No.21432, the preservation place of No. 3 Silu-1 Kyoto-Yang district of Beijing, and the preservation date of 2021 year, 1 month and 19 days.

In one embodiment of the invention, the starting strain used for obtaining the recombinant strain is Trichoderma reesei (Trichoderma reesei) with the preservation number of CGMCC NO. 17798. Trichoderma reesei (Trichoderma reesei) having accession number CGMCC NO.17798 has been disclosed in patent CN110205250A, and is a known strain.

In the present invention, the method of transforming the expression element of the forward regulatory gene Xyr1 having the strong promoter PpgdA into trichoderma reesei may be performed by a conventional technique in the field of biotechnology.

In addition, the invention also verifies the enzyme production capability of the recombinant strain obtained after genetic engineering modification, and compared with the unmodified common Trichoderma reesei (Trichoderma reesei) of CGMCC NO.17798, the modified recombinant strain has greatly improved enzyme production capability, and the enzymolysis application effect is better when the enzyme activity addition is the same.

The invention also provides application of the recombinant strain in producing cellulase.

Compared with the prior art, the invention constructs an expression element of the positive regulatory gene Xyr1 with the strong promoter PpgdA, and transforms the expression element into Trichoderma reesei to obtain a genetic engineering strain with high cellulase yield, thereby improving the expression level of the cellulase.

Drawings

FIG. 1 is an agarose gel electrophoresis of the PpgdA gene; in FIG. 1, M is a maker band, and 1-5 are PpgdA gene bands;

FIG. 2 is the agarose gel electrophoresis chart of PCR of the bacteria liquid, in FIG. 2, M is the marker band, 1-4 are PpgdA gene bands;

FIG. 3: the recombinant plasmid pGPDA-hph map;

FIG. 4: xyr1 agarose gel electrophoresis picture of gene, FIG. 4: m is a marker band, and 1 is an Xyr1 gene band;

FIG. 5: a PCR agarose gel electrophoresis picture of the bacterial liquid, wherein M in figure 5 is a marker band, and 1 is an Xyr1 gene band;

FIG. 6: the recombinant plasmid pGPDA-hph-Xyr1 map;

FIG. 7: xyr1 agarose gel electrophoresis picture of gene; in FIG. 7, M is a marker band, and 1 and 2 are Xyr1 transformation element gene bands.

FIG. 8: microscopic examination of trichoderma reesei protoplast;

FIG. 9: transforming a colony map by using trichoderma reesei protoplasts;

FIG. 10: single colony transfer resistant panels;

FIG. 11: xyr1 agarose gel electrophoresis picture, in FIG. 11, M is marker band, 1, 2 are transformants, 3 is negative control, 4 is positive control;

FIG. 12: a cellulase SDA-PAGE gel electrophoresis picture, wherein in figure 12, M is a marker band, 1 is a control strain, and 2 is a recombinant strain;

FIG. 13: the change of the enzyme activity and the fermentation time in the shake flask fermentation of the cellulase;

FIG. 14: the change of enzyme activity and fermentation time in the fermentation of the cellulase fermentation tank;

FIG. 15: the concentration of glucose in the hydrolysate changes along with the hydrolysis time;

FIG. 16: the concentration of xylose in the hydrolysate changes along with the hydrolysis time.

Detailed Description

The invention is described in detail below with reference to the figures and specific embodiments.

Example 1

1. Acquisition of PpgdA promoter

The upstream primer PpgdA-F:

The downstream primer PpgdA-R:

FIG. 1 shows an agarose gel electrophoresis of PpgdA gene, and it can be seen from FIG. 1 that a specific band is present around 1000bp, which is the position of PpgdA gene (903bp) fragment. The PpgdA gene base sequence is shown in SEQ ID NO. 1.

2. PpgdA gene PCR product recovery and purification

Adopting a column type DNA glue recovery Kit of DNA Gel Extraction Kit of NEB company to recover PCR products, carrying out electrophoresis according to the step 1, and then cutting glue, wherein the specific operation steps are as follows:

(1) separating PCR products by 1% agarose gel electrophoresis, cutting off target gene bands by a blade under ultraviolet light, putting the cut-off gel into a 1.5mL centrifuge tube, weighing the gel, adding Binding Buffer with equal weight, and putting the gel in a water bath at 65 ℃ until the gel is completely dissolved;

(2) transferring the glue solution into an adsorption column, standing for 10min, and centrifuging at 12000rpm for l min;

(3) transferring the liquid in the centrifuged collection tube to an adsorption column again, standing for 5min, centrifuging at 12000rpm for 1min, and pouring out the liquid in the collection tube;

(4) adding 700 μ L of SPW Wash Buffer into the adsorption column, centrifuging at 12000rpm for 1min, pouring off liquid in the collection tube, placing the adsorption column into the same collection tube, and repeating the steps once;

(5) centrifuging the empty adsorption column at 12000rpm for 3min, and air drying at room temperature for 15 min;

(6) adding 30 μ L of ultrapure water into the empty adsorption column, standing at room temperature for 5min, and centrifuging at 12000rpm for 3 min;

(7) the solution in the centrifugal tube is the water solution of the recovered DNA fragments;

(8) 3 μ L of the DNA was detected by agarose gel electrophoresis, a band was evident at the correct position, and the remaining DNA samples were stored at-20 ℃.

3. PGPD-hph plasmid restriction enzyme and construction of promoter recombinant plasmid pGPDA-hph

4. Transformation into E.coli competent DH5 alpha

Mixing 10 μ L of the ligation product in the previous step with 100 μ L of Escherichia coli DH5 α competent cells, ice-cooling for 30min, heat-shocking for 90s at 42 deg.C, immediately placing on ice for 3-5min, adding 800 μ L of LB liquid culture medium, and culturing at 37 deg.C for 50-60 min; spread on LB solid plates (containing 10. mu.g/m L ampicillin), and incubated overnight at 37 ℃.

5. PCR preliminary identification of bacterial liquid

And (4) using a liquid transfer gun to pick a transformant for monoclonal culture in an LB liquid culture medium for 6-8h, and then carrying out bacteria liquid PCR.

An upstream primer F: 5'-TGTGACGAACTCGTGAGCTC-3'

A downstream primer R: 5'-GGTGATGTCTGCTCAAGCGG-3'

Bacterial liquid PCR system: 5 mul of enzyme, 0.5 mul of upstream primer and downstream primer respectively, 0.5 mul of bacterial liquid, and 3.5 mul of sterilized water, wherein the total volume is 10 mul.

PCR process of bacterial liquid: pre-denaturation at 94 deg.C for 10min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 2min, extension at 72 deg.C for 10min, 30 cycles, and storage at 4 deg.C. And (3) after the reaction is finished, carrying out 1% agarose electrophoresis detection and verification on the PCR product, and verifying the correct colony.

FIG. 2 is a PCR agarose gel electrophoresis chart of bacterial liquid, wherein in FIG. 2, M is a maker band, and 1-4 are PpgdA gene bands, and as can be seen from FIG. 2, the PpgdA gene band exists through the bacterial liquid PCR verification, which indicates that the recombinant plasmid is successfully transformed into DH5 alpha.

6. Sequencing the recombinant plasmid pGPDA-hph.

Performing 5ml LB liquid test tube culture for 12-16h for the transformant identified as positive clone by colony PCR, and sending to Darkshire organism (Beijing) GmbH for DNA sequencing; the sequences obtained after sequencing were aligned using DNAMAN software to verify the correctness of the sequences and the reliability of the method. Sequencing results show that the obtained DNA fragment contains a promoter PpgdA gene, which indicates that the recombinant plasmid is successfully constructed.

7. Small-scale extraction of promoter recombinant plasmid pGPDA-hph

Plasmid is extracted in small quantity by adopting a Plamid Miniprep Kit of NEB company, and the specific operation steps are as follows: (1) inoculating Escherichia coli DH5 alpha containing pGPDA-hph plasmid which is verified to be correct into 5mL of liquid LB culture medium containing ampicillin (100 mug/mL), and carrying out shake culture for about 10 h;

(2) taking out the bacterial liquid, adding the bacterial liquid into a 1.5mL centrifuge tube, centrifuging at normal temperature and 12000rpm for l min, and discarding the supernatant; (3) adding 250 mu L of the solution I, blowing and stirring uniformly; adding 250 μ L of solution II, slightly inverting the solution from top to bottom for several times, mixing, and standing at room temperature for 2 min;

(4) adding 350 μ L of solution III, slightly inverting for several times to disperse the lysate uniformly, standing at room temperature for 2min, and centrifuging at 12000rpm for 10 min;

(5) transferring the supernatant to an adsorption column, standing for 5min, centrifuging at 12000rpm at normal temperature for l min, and pouring out the liquid in the collection tube;

(6) adding 700 mu L of DNA Wash Buffer into an adsorption column, centrifuging at the normal temperature of 12000rpm for L min, pouring out liquid in a collecting pipe, putting the adsorption column into the same collecting pipe, and repeating the step once;

(7) centrifuging the empty adsorption column at 12000rpm for 2min, and air drying at room temperature for 15 min;

(8) adding 30 μ L of ultrapure water into the empty adsorption column, standing at room temperature for 5min, and centrifuging at 12000rpm for 3 min; the solution in the centrifugal tube is plasmid DNA aqueous solution;

(9) 3 μ L of the DNA was subjected to 1% agarose gel electrophoresis, and the band was evident at the correct position, and the remaining DNA sample was stored at-20 ℃.

The recombinant plasmid pGPDA-hph map is shown in FIG. 3.

8. Trichoderma reesei genome extraction

The method adopts a fungal genome DNA extraction kit of Solebao company for extraction, and comprises the following specific operation steps:

(1) sample treatment: taking 50-100mg hypha, adding 200ul solution A, grinding with glass grinder to disperse hypha, adding 20ul RNase A, adding 100mg glass bead, and shaking on high speed shaker for about 30 min.

(2) Adding 20ul proteinase K (10mg/ml), mixing well, digesting in 55 deg.C water bath for 30min, and mixing with the centrifuge tube reversed several times during digestion. Centrifuge at 12000rpm for 2 min. The supernatant was transferred to a new centrifuge tube. If precipitated, it may be centrifuged again.

(3) Add 200ul of solution B to the supernatant and mix well. If white precipitate appears, the solution can be put in a water bath at 55 ℃ for 5min, and the precipitate disappears without influencing subsequent experiments. If the solution is not clear, it indicates that the sample is not digested completely, which may result in a small amount of extracted DNA and impurities, and may also result in column plugging after loading, please increase digestion time.

(4) Adding 200ul of anhydrous ethanol, mixing well, wherein flocculent precipitate may appear, without affecting DNA extraction, adding the solution and flocculent precipitate into adsorption column, and standing for 2 min.

(5) Centrifuging at 12000rpm for 1min, discarding waste liquid, and placing the adsorption column into the collection tube.

(6) Adding 600ul rinsing liquid into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into the collection tube.

(7) Adding 600ul rinsing liquid into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into the collection tube.

(8) Centrifuging at 12000rpm for 2min, placing the adsorption column in a room temperature or 50 deg.C incubator for several minutes to remove residual rinsing liquid in the adsorption column, otherwise, ethanol in the rinsing liquid will affect subsequent experiments such as enzyme digestion, PCR, etc.

(9) Placing the adsorption column into a clean centrifuge tube, suspending and dripping 50-200ul of eluent preheated by 65 deg.C water bath into the center of the adsorption membrane, standing at room temperature for 5min, and centrifuging at 12000rpm for 1 min.

(10) Adding the eluent obtained by centrifugation into an adsorption column, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min to obtain high-quality genome DNA.

9. Acquisition of Forward regulatory Gene Xyr1

And (3) designing a primer to amplify Xyr1 gene by taking the trichoderma reesei genome DNA extracted in the step (8) as a template, and verifying through 1% agarose gel electrophoresis.

The PCR system and procedure were the same as in step 1.

Upstream primer Xyr 1-F:

5'-TAACAGCTACCCCGCTTGAGCAGACATCACCGATATCATGTTGTCCAAT CCTCTCCG-3'

downstream primer Xyr 1-R:

5'-TTTCAGTAACGTTAAGTGGATCCGAATTCGATATCTTAGAGGGCCAGA CCGGTTCC-3'

xyr1 agarose gel electrophoresis pattern of gene is shown in FIG. 4, in FIG. 4: m is a marker band, and 1 is an Xyr1 gene band; as can be seen from FIG. 4, a specific band is present around 3000bp, which is the position of the Xyr1 gene (2950bp) fragment. The gene sequence of the forward regulatory gene Xyr1 is shown in SEQ ID NO. 2.

10. pGPDA-hph plasmid linearization and construction of pGPDA-hph-Xyr1 recombinant plasmid

And (3) carrying out EcoR V single enzyme digestion on the pGPDA-hph plasmid extracted in the step (6), then carrying out dephosphorylation on the plasmid subjected to enzyme digestion, and finally connecting the Xyr1 gene to a pGPDA-hph vector by adopting a Gibson connection method to obtain a new recombinant plasmid pGPDA-hph-Xyr 1.

11. Transformation into E.coli competent DH5 alpha

The specific operation is the same as that in step 4.

12. PCR preliminary identification of bacterial liquid

An upstream primer F: 5'-TCCTTCCCATCCCTTATTCC-3'

A downstream primer R: 5'-GCACTCTTTGCTGCTTGGAC-3'

The PCR system and reaction procedure were the same as in step 5. And (3) after the reaction is finished, carrying out 1% agarose electrophoresis detection and verification on the PCR product, and verifying the correct colony.

FIG. 5 is the PCR agarose gel electrophoresis of the bacterial liquid, in FIG. 5, M is the marker band, and 1 is the Xyr1 gene band. As shown in FIG. 5, a specific gene band existed around 3000-3500bp verified by PCR of bacterial liquid, which indicates that the recombinant plasmid was successfully transformed into DH5 α.

13. The recombinant plasmid pGPDA-hph-Xyr1 was sequenced.

Performing 5ml LB liquid test tube culture for 12-16h for the transformant identified as positive clone by colony PCR, and sending to Darkshire organism (Beijing) GmbH for DNA sequencing; the sequences obtained after sequencing were aligned using DNAMAN software to verify the correctness of the sequences and the reliability of the method. Sequencing results show that the obtained DNA fragment contains a promoter Xyr1 gene, which indicates that the recombinant plasmid is successfully constructed.

14. Small extraction of recombinant plasmid pGPDA-hph-Xyr1

The extraction method is the same as that in step 7.

The recombinant plasmid pGPDA-hph-Xyr1 map is shown in FIG. 6.

15. Amplification transformation trichoderma reesei forward regulation gene element

And (3) taking the plasmid extracted in the step 14 as a template, designing a primer, amplifying a transformation element, and obtaining a 6800bp fragment. Verified by electrophoresis on a 1% agarose gel.

The PCR system and procedure were the same as in step 1.

An upstream primer PCH-F: 5'-TCCCGCCTGTATCGGACCTGCGCGA-3'

The downstream primer PCH-R: 5'-ATGTGCTGCAAGGCGATTAAGTTGG-3'

The agarose gel electrophoresis chart of Xyr1 gene is shown in FIG. 7, wherein M is marker band in FIG. 7, and 1 and 2 are Xyr1 transformation element gene bands.

As can be seen from FIG. 7, a specific band was found around 6000-8000bp, which is the position of the Xyr1 transformation element gene (68000bp) fragment.

16. Preparation of Trichoderma reesei protoplast

(1) Sterilized cellophane discs were laid flat on MEX plates and pre-prepared Trichoderma reesei spore solution (50. mu.l) was spread on cellophane plates, presumably to prepare five such plates. Incubate overnight (16-20 hours) at 30 ℃.

(2) 0.075g of lyase was added to 15ml of solution A, dissolved and filter-sterilized into a 50ml sterile tube. Pipette 2-3ml of lyase solution onto a sterilized plate, flip the cultured glass disc with germinated Trichoderma reesei spores onto the plate, add 2-3ml of solution again, add glass disc again, repeat this to ensure that each disc must be contacted with solution. The plates were incubated at 30 ℃ for 90min and gently shaken at intervals to allow the lysis solution to diffuse properly.

(3) After 90min, the cellophane in the plate was removed from the solution, the hyphae were left in the petri dish, the suspension was pipetted away with a tip-cutting pipette, removing a large number of hyphae fragments, and then filtered through sterilized paper for lens into a sterile 50ml centrifuge tube.

(4) The filtrate was centrifuged at 2000rpm for 10min at 4 ℃, the supernatant carefully removed and the protoplasts were resuspended with 4ml of solution B. Centrifugation was again carried out for 10min, the supernatant removed and the protoplasts resuspended in 600. mu.l of solution B.

(5) Counting was performed on a hemocytometer plate with normal ranges: 4-6*10⁸One per ml.

In this example, the starting strain was Trichoderma reesei (Trichoderma reesei) having a accession number of CGMCC NO. 17798. Trichoderma reesei (Trichoderma reesei) having accession number CGMCC NO.17798 has been disclosed in patent CN110205250A, and is a known strain.

A microscopic image of a Trichoderma reesei protoplast is shown in FIG. 8.

17. Transformation of Gene fragments into protoplasts

(1) The fragment to be transformed is obtained in step 15;

(2) transformation system: 10 μ l of the purified DNA fragment, 200 μ l of the protoplast suspension, 50 μ l of polyethylene glycol, mixed well in a 15ml tube, on ice for 20 min;

(3) adding 2ml polyethylene glycol, mixing (without vortex shaking), and culturing at room temperature (20 deg.C) for 5 min;

(4) 4ml of solution B was added, carefully mixed, 1ml of the above mixed solution was added to 4ml of overlay medium (100. mu.g/ml of hygromycin B resistance was added), mixed and poured into the bottom medium.

(5) Incubating at 30 deg.C for 3-4d to obtain transformant;

(6) each transformant was excised and transferred to a resistant selection plate and grown at 30 ℃ for several days until sporulation occurred.

(7) These single spore colonies were transferred again to resistant plates for growth until sporulation, after a second round of single spore isolation, further analytical validation could begin.

Transformed colonies of the Trichoderma reesei protoplast are shown in FIG. 9, and single colony transfer resistant plates are shown in FIG. 10.

18. Extraction of trichoderma reesei transformant genome DNA and identification of resistance gene

The extraction of genomic DNA is performed in the same manner as in step 8. Then, the extracted transformant genome DNA is used as a template, a primer is designed to amplify the hygromycin B resistance gene, the size of the identified fragment is 1900bp, and a positive control and a negative control are set at the same time.

The PCR system and procedure were the same as in step 1.

An upstream primer hph-F: 5'-TAATCCTTCTTGAATTAATTCCAAT-3'

The downstream primer hph-R: 5'-CGGCCGCCTACTACTATTCCTTTGC-3'

FIG. 11 is an agarose gel electrophoresis of Xyr1 gene, in FIG. 11, M is marker band, 1 and 2 are transformants, 3 is negative control, and 4 is positive control; as can be seen from FIG. 11, 1 and 2 both have specific bands around 2000bp, which indicates that hygromycin B gene can be amplified from the genomic DNA of these two strains, and indicates that the gene fragment has been successfully transferred into Trichoderma reesei.

The expression element of the positive regulatory gene Xyr1 with the strong promoter PpgdA is transformed into Trichoderma reesei, the recombinant strain is named ZR/TR-xyr1, the preservation number is CGMCC No.21432, the preservation place is No. 3 Xilu No.1 Xin of Beijing Kogyo, and the preservation date is 2021 year, 1 month and 19 days.

19. Recombinant strain cellulase expression and protein electrophoresis verification

And carrying out enzyme-producing fermentation on the recombinant strain and the initial control strain, and carrying out SDS-PAGE gel electrophoresis on fermentation supernatant. As shown in the following figure, the number and position of protein bands of the two strains were substantially the same, and the protein bands of the recombinant strain at the same spot size were slightly coarser than those of the control.

FIG. 12 is a gel electrophoresis chart of cellulase SDA-PAGE, in FIG. 12, M is a marker band, 1 is a control strain, and 2 is a recombinant strain.

20. Recombinant strain cellulase fermentation verification

20.1500 ml shake flask enzyme production verification

The media and reagents required for validation were as follows:

seed culture medium: 2 percent of glucose, 1 percent of corn steep liquor powder, 1 percent of nutrient salt, 0.2 percent of trace elements, 100mL/500mL triangular flask, 120-126 ℃ moist heat sterilization for 20-40min, and the inoculation amount: adding 2-3mL of sterile water into the spore slant, washing the spores, inoculating all the seed solutions, and culturing at 28-30 ℃ for 24-36h at the speed of 100-;

fermentation medium: 1-2% of nutrient salt, 0.1-0.3% of trace elements, 1-1.5% of corn pulp powder, 1-1.5% of cellulose powder, 0.5-1% of bran, 1-2% of pulp powder, pH4.5-5.0, 100mL/500mL triangular flask, sterilization at the temperature of 122-;

the nutrient salt is one or more of magnesium sulfate, ammonium sulfate, potassium sulfate, urea, calcium chloride or potassium dihydrogen phosphate, and each is added in an amount of 0.1-0.5%;

FIG. 13 shows the change of enzyme activity and fermentation time in shake flask fermentation of cellulase, and it can be seen from FIG. 13 that after 500ml shake flask fermentation for 7d, the filter paper enzyme activity of the recombinant strain reaches 85.1U/ml, which is increased by about 23% compared with the control strain.

20.2 fermentation tank enzyme production verification

The media and reagents required for validation were the same as for shake flask validation. The fermentation tank verification method comprises the following steps:

seed liquid culture: inoculating the screened strain into a 500ml shake flask filled with the seed culture medium, wherein the liquid filling amount is 150ml and the rotating speed is 100-.

Culturing in a fermentation tank: the liquid loading of the culture medium is 4-8L, and the fermentation conditions are as follows: the temperature is 25-32 ℃ (self-control), the pH is 4.5-5.5 (adding 5-25% sodium carbonate solution, sodium hydroxide solution or ammonia water solution, on-line real-time self-control adjustment), the stirring speed (on-line real-time adjustment) is 100r/min-500r/min, the air flow is 3L/min-15L/min, and the tank pressure is 0.02MPa-0.08 MPa. Meanwhile, the sugar and nitrogen contents of the fermentation liquor are periodically detected, and sugar liquor and a nitrogen source are timely supplemented according to the consumption of the sugar. The enzyme-producing fermentation time is 8 d.

FIG. 14 shows the variation of enzyme activity and fermentation time in a cellulase fermenter fermentation; as shown in FIG. 14, after fermentation in a 10L fermentor for 8 days, the filter paper enzyme activity of the recombinant strain reaches 226.5U/ml, which is improved by about 25% compared with that of the control strain.

21. Verification of cellulase hydrolysis

The enzymatic properties of the cellulase can be more intuitively reflected by hydrolyzing the pretreated biomass raw material. And (3) performing hydrolysis experiments on the corn straws pretreated by 1% dilute sulfuric acid by using cellulase produced by the control strain and the recombinant strain, and analyzing the concentrations of generated glucose and xylose. The reaction conditions are as follows: the total volume of the reaction is 500ml, the concentration of the pretreated straws is 25 percent, the addition of cellulase is 20U/g substrate, the pH value is 4.8-5.0, the stirring speed is 300rpm at 50 ℃, and the enzymolysis is carried out in a water bath shaker. Sampling and detecting every 12h until the reaction is stopped for 72h, and measuring the contents of glucose and xylose in the reaction solution by high performance liquid chromatography.

FIG. 15 is a graph of glucose concentration in the hydrolysate as a function of hydrolysis time; FIG. 16 is a graph of xylose concentration in the hydrolysate as a function of hydrolysis time.

According to hydrolysis data, after hydrolysis is carried out for 72 hours, the final glucose concentration of the straws pretreated by hydrolysis with cellulase produced by the recombinant strain is 7.67g/100ml, the xylose concentration is 5.48g/100ml, and the glucose concentration is respectively increased by 21% and 22% compared with that of the control strain. The results show that after the strain is transformed by genetic engineering, the enzyme production capacity is greatly improved, the enzyme activity addition is the same, and the enzymolysis application effect is better.

The embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.

Sequence listing

<110> Shanghai Zhongshi Techni Co Ltd

<120> method for constructing high-yield cellulase strain by using forward regulatory gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 903

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgtgacgaac tcgtgagctc tgtacagtga ccggtgactc tttctggcat gcggagagac 60

ggacggacgc agagagaagg gctgagtaat aagcgccact gcgccagaca gctctggcgg 120

ctctgaggtg cagtggatga ttattaatcc gggaccggcc gcccctccgc cccgaagtgg 180

aaaggctggt gtgcccctcg ttgaccaaga atctattgca tcatcggaga atatggagct 240

tcatcgaatc accggcagta agcgaaggag aatgtgaagc caggggtgta tagccgtcgg 300

cgaaatagca tgccattaac ctaggtacag aagtccaatt gcttccgatc tggtaaaaga 360

ttcacgagat agtaccttct ccgaagtagg tagagcgagt acccggcgcg taagctccct 420

aattggccca tccggcatct gtagggcgtc caaatatcgt gcctctcctg ctttgcccgg 480

tgtatgaaac cggaaaggcc gctcaggagc tggccagcgg cgcagaccgg gaacacaagc 540

tggcagtcga cccatccggt gctctgcact cgacctgctg aggtccctca gtccctggta 600

ggcagctttg ccccgtctgt ccgcccggtg tgtcggcggg gttgacaagg tcgttgcgtc 660

agtccaacat ttgttgccat attttcctgc tctccccacc agctgctctt ttcttttctc 720

tttcttttcc catcttcagt atattcatct tcccatccaa gaacctttat ttcccctaag 780

taagtacttt gctacatcca tactccatcc ttcccatccc ttattccttt gaacctttca 840

gttcgagctt tcccacttca tcgcagcttg actaacagct accccgcttg agcagacatc 900

acc 903

<210> 2

<211> 2950

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgttgtcca atcctctccg tcgctattct gcctaccccg acatctcctc ggcgtcattt 60

gacccgaact accatggctc acagtcgcat ctccactcga tcaacgtcaa cacattcggc 120

aacagccacc cctatcccat gcagcacctc gcacagcatg cggagctttc gagttcacgc 180

atgataaggg ccagtccggt gcagccaaag cagcgccagg gctctcttat tgctgccagg 240

aagaattcaa cgggtactgc tgggcccatt cggcggagga tcagtcgcgc ttgtgaccag 300

tgcaaccagc ttcgtaccaa gtgcgatggc ttacacccat gtgcccattg tataggtatg 360

tcccttttcc tctacacagt gatgctgcgc tcaagcacat gtactgatcg atcttgttta 420

gaattcggcc ttggatgcga atatgtccga gagagaaaga agcgtggcaa agcttcgcgc 480

aaggatattg ctgcccagca agccgcggcg gctgcagcac aacactccgg ccaggtccag 540

gatggtccag aggatcaaca tcgcaaactc tcacgccagc aaagcgaatc ttcgcgtggc 600

agcgctgagc ttgcccagcc tgcccacgac ccgcctcatg gccacattga gggctctgtc 660

agctccttca gcgacaatgg cctttcccag catgctgcca tgggcggcat ggatggcctg 720

gaagatcacc atggccacgt cggagttgat cctgccctgg gccgaactca gctggaagcg 780

tcatcagcaa tgggcctggg cgcatacggt gaagtccacc ccggctatga gagccccggc 840

atgaatggcc atgtgatggt gcccccgtcg tatggcgcgc agaccaccat ggccgggtat 900

tccggtatct cgtatgctgc gcaagccccg agtccggcta cgtatagcag cgacggtaac 960

tttcgactca ccggtcacat ccatgattac ccgctggcaa atgggagctc gccctcatgg 1020

ggagtctcgc tggcctcgcc ttcgaaccag ttccagcttc agctctcgca gcccatcttc 1080

aagcaaagcg atttgcgata tcctgtgctt gagcctctgc tgcctcacct gggaaacatc 1140

ctccccgtgt ctttggcgtg cgatctgatt gacctgtact tctcctcgtc ttcatcagca 1200

cagatgcacc caatgtcccc atacgttctg ggcttcgtct tccggaagcg ctccttcttg 1260

caccccacga acccacgaag gtgccagccc gcgctgcttg cgagcatgct gtgggtggcg 1320

gcacagacta gcgaagcgtc cttcttgacg agcctgccgt cggcgaggag caaggtctgc 1380

cagaagctgc tcgagctgac cgttgggctt cttcagcccc tgatccacac cggcaccaac 1440

agcccgtctc ccaagactag ccccgtcgtc ggtgctgctg ccctgggagt tcttggggtg 1500

gccatgccgg gctcgctgaa catggattca ctggccggcg aaacgggtgc ttttggggcc 1560

atagggagcc ttgacgacgt catcacctat gtgcacctcg ccacggtcgt ctcggccagc 1620

gagtacaagg gcgccagcct gcggtggtgg ggtgcggcat ggtctctcgc cagagagctc 1680

aagcttggcc gtgagctgcc gcctggcaat ccacctgcca accaggagga cggcgagggc 1740

cttagcgaag acgtggatga gcacgacttg aacagaaaca acactcgctt cgtgacggaa 1800

gaggagcgcg aagagcgacg gcgagcatgg tggctcgttt acatcgtcga caggcacctg 1860

gcgctctgct acaaccgccc cttgtttctt ctggacagcg agtgcagcga cttgtaccac 1920

ccgatggacg acatcaagtg gcaggcaggc aaatttcgca gccacgatgc agggaactcc 1980

agcatcaaca tcgatagctc catgacggac gagtttggcg atagtccccg ggcggctcgc 2040

ggcgcacact acgagtgccg cggtcgtagc atttttggct acttcttgtc cttgatgaca 2100

atcctgggcg agattgtcga tgtccaccat gctaaaagcc acccccggtt cggcgttgga 2160

ttccgctccg cgcgggattg ggacgagcag gttgctgaaa tcacccgaca cctggacatg 2220

tatgaggaga gcctcaagag gttcgtggcc aagcatctgc cattgtcctc aaaggacaag 2280

gagcagcatg agatgcacga cagtggagcg gtaacagaca tgcaatctcc actctcggtg 2340

cggaccaacg cgtccagccg catgacggag agcgagatcc aggccagcat cgtggtggct 2400

tacagcaccc atgtgatgca tgtcctccac atcctccttg cggataagtg ggatcccatc 2460

aaccttctag acgacgacga cttgtggatc tcgtcggaag gattcgtgac ggcgacgagc 2520

cacgcggtat cggctgccga agctattagc cagattctcg agtttgaccc tggcctggag 2580

tttatgccat tcttctacgg cgtctatctc ctgcagggtt ccttcctcct cctgctcatc 2640

gccgacaagc tgcaggccga agcgtctcca agcgtcatca aggcttgcga gaccattgtt 2700

agggcacacg aagcttgcgt tgtgacgctg agcacagagt atcaggtaag ccctatcagt 2760

tcaaacgtct atcttgctgt gaatcaaaga ctgacttgga catcagcgca actttagcaa 2820

ggttatgcga agcgcgctgg ctctgattcg gggccgtgtg ccggaagatt tagctgagca 2880

gcagcagcga cgacgcgagc ttcttgcact ataccgatgg actggtaacg gaaccggtct 2940

ggccctctaa 2950

Claims

1. A strong promoter PpgdA is characterized in that the gene sequence is shown in SEQ ID NO. 1.

2. A recombinant plasmid containing PpgdA gene is characterized in that PpgdA gene is connected to a plasmid vector to obtain a novel recombinant plasmid, and the base sequence of the PpgdA gene is shown in SEQ ID NO. 1.

3. A recombinant expression transformant containing a PpgdA gene, which is obtained by transforming the PpgdA gene-containing recombinant plasmid according to claim 2 into a corresponding host cell.

4. The recombinant plasmid simultaneously containing the PpgdA gene and the forward regulatory gene Xyr1 is characterized in that the recombinant plasmid simultaneously containing the PpgdA gene and the forward regulatory gene Xyr1 is a new recombinant plasmid obtained by connecting the PpgdA gene and the forward regulatory gene Xyr1 to a plasmid vector, the base sequence of the PpgdA gene is shown as SEQ ID No.1, and the gene sequence of the forward regulatory gene Xyr1 is shown as SEQ ID No. 2.

5. A method for obtaining the recombinant plasmid containing both PpgdA gene and forward regulatory gene Xyr1 gene according to claim 4,

carrying out EcoR V single enzyme digestion on recombinant plasmid pGPDA-hph plasmid containing PpgdA gene, then carrying out dephosphorylation on the plasmid after enzyme digestion, and finally connecting Xyr1 gene to pGPDA-hph vector by Gibson connection method to obtain new recombinant plasmid pGPDA-hph-Xyr 1.

6. A recombinant transformant containing both a PpgdA gene and a forward regulatory gene Xyr1, which is obtained by transforming the recombinant plasmid containing both a PpgdA gene and a forward regulatory gene Xyr1 according to claim 4 into a host cell.

7. A recombinant strain, wherein the recombinant strain is: a recombinant strain obtained by transforming the recombinant expression transformant according to claim 6, which comprises both the PpgdA gene and the forward regulatory gene Xyr1, into Trichoderma reesei.

8. The recombinant strain according to claim 7, wherein the preservation number of the recombinant strain is CGMCC No.21432, the preservation site is No. 3 of Xilu 1 of Beijing, Chaoyang, and the preservation date is 2021 year, 1 month and 19 days.

9. The recombinant strain according to claim 7, wherein the original strain used for obtaining the recombinant strain is Trichoderma reesei (Trichoderma reesei) with the preservation number of CGMCC NO. 17798.

10. Use of the recombinant strain according to claim 7 for the production of cellulase.