CN110452827B - Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof - Google Patents
Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof Download PDFInfo
- Publication number
- CN110452827B CN110452827B CN201910681249.6A CN201910681249A CN110452827B CN 110452827 B CN110452827 B CN 110452827B CN 201910681249 A CN201910681249 A CN 201910681249A CN 110452827 B CN110452827 B CN 110452827B
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- gene
- gre2
- recombinant
- nta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a gene recombinant saccharomyces cerevisiae with a detoxification function, which contains an exogenous aldehyde reductase gene, wherein the exogenous aldehyde reductase gene is shown as SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof. The exogenous aldehyde reductase gene is obtained by performing PCR amplification by taking Pichia stipitis (Pichia stipitis) genome DNA as a template, introducing two enzyme cutting sites of Xho I and Not I at the C end and the N end respectively, connecting a GRE2 gene fragment to a pYES2/NTA plasmid vector to obtain a recombinant plasmid pYES2/NTA-GRE2, and then converting the recombinant plasmid into saccharomyces cerevisiae to obtain the gene recombinant saccharomyces cerevisiae with the detoxification function. The saccharomyces cerevisiae can not only efficiently ferment the pretreated lignocellulose materials to produce fuel ethanol, but also remove the aldehyde substances which are generated or poisoned in the fermentation process, realize the detoxification of fermentation inhibitors in the pretreated lignocellulose materials, and ensure the smoothness and high efficiency of the process for producing the ethanol by cellulose fermentation.
Description
Technical Field
The invention relates to a gene engineering technology, in particular to a gene recombinant saccharomyces cerevisiae with a detoxification function, a construction method and application thereof.
Background
With the increasing shortage and the decreasing reserves of petroleum resources, agricultural straws are used as raw materials to produce fuel ethanol and various chemical products by fermentation so as to meet the development requirements of human society, and the fuel ethanol is considered to be a clean energy source capable of replacing petroleum. Experts think that the production of ethanol by lignocellulose biomass represented by crop straws has good development prospect, and is helpful to solve the problem of treatment of agricultural production wastes, so that the resource crisis and the grain crisis are relieved, the method has important significance on environmental pollution, and the sustainable development is guaranteed.
Lignocellulose (lignocellulose) is the most abundant resource which can be obtained renewably in the nature and contains huge biomass energy, the production of ethanol by using lignocellulose is mainly subjected to the processes of material pretreatment, enzymolysis saccharification, fermentation, rectification and the like, wherein the material pretreatment process mainly comprises hydrothermal decomposition, steam explosion, acid [ Almeida JRM, Modig T, Petersson A, Hahn-Hagerdal B, L iden G, Gorwash granular MF. incorporated biomass and conversion of microorganisms in lignocellulosic hydrology and hydrolysis of alkaline [ Saha, Cottoma. company of microorganisms for fermentation of cellulose, and hydrolysis of furfural, and the like, so that the production of ethanol by using lignocellulose is more or less completely inhibited by the processes of hydrolysis of furfural, fermentation of methanol, fermentation of ethanol, furfural production, and hydrolysis of ethanol production, and the like are more or less inhibited by the processes of furfural.
At present, the mode of detoxification of pretreated materials is generally divided into three types, namely physical, chemical and biological methods, and the main physicochemical methods include rotary evaporation [ L lano T, Quijorna N, CozA. Detoxification of a lignocellulosic water mill from a pulp to fermentation promotion projects.Energies, 2017, 10 (3): 348.]Filtering, active carbon adsorption [ Li allowed super, Wangxianghua, Yanghaiping, etc.. bamboo charcoal surface structure and its adsorption characteristic to furfural [ J]Agricultural engineering journal, 2012, 28 (12): 257-263.]Excess alkaline reagent [ Alriksson B, Horv th I S,
A，et al.Ammoniumhydroxide detoxification of spruce acid hydrolysates.Applied BiochemistryBiotechnology，2005，124(1-3)：911-922.]macroporous resin adsorption (epi-furfural waste liquid purification and alcohol fermentation research by diluted acid molasses) thereof [ D]The south is: university of Guangxi, 2014.]Ion exchange [ Alriksson B, Cavka A,
L J.Improving the fermentability of enzymatic hydrolysates oflignocellulose through chemical in-situ detoxification with reducingagents.Bioresource Technology，2011，102(2)：1254-1263.]or a combination of these methods. However, the physicochemical detoxification method has the defects that are difficult to overcome: a single method cannot remove inhibitors with different physicochemical properties; the combined application of various physicochemical means greatly improves the detoxification cost, and the complex detoxification process becomes infeasible in production; some physicochemical detoxification means can also generate new pollutants.
The biological method mainly utilizes microorganisms or enzymes to degrade and eliminate inhibitors, and comprises the three aspects of adding exogenous microorganisms capable of degrading inhibitors before fermentation, breeding and domesticating the fermentation microorganisms, including applying a genetic engineering technology to carry out gene recombination on the fermentation microorganisms, improving the tolerance to the inhibitors, even having the ability of degrading the inhibitors, adding biological enzymes to carry out detoxification treatment, Nichols and the like research on inoculating fungal Coniochia lignaria NRR L30616 in a corn straw dilute acid hydrolysate, and quantitatively analyzing components in the cultured hydrolysate to find that various aromatic compounds, fatty acids, furfural and other inhibitors are remarkably reduced, optimizing the utilization capability of xylose in the ethanol fermentation process [ Nichols N, Sharma L N, Mowery R A, et al. Funginescence metabolism of dietary fiber sensor in biological cellulose hydrolysate, hydrolysis reaction, such as hydrolysis of cellulose, cellulose removal, cellulose hydrolysis reaction, cellulose removal.
In recent years, extensive research has been conducted on microorganisms having the ability to "detoxify". Research shows that some yeast strains have good detoxification capability. In actual industrial production, research on the production of fuel ethanol by fermenting lignocellulose by using yeast as an engineering strain has also been started. However, a strain which can effectively remove the inhibitor generated by lignocellulose pretreatment and can efficiently ferment the lignocellulose biomass to produce fuel ethanol is not obtained at present.
A saccharomyces cerevisiae strain ZR-1 capable of efficiently utilizing xylose is obtained by strain screening and modifying technology in the early stage of the laboratory, and the strain ZR-1 is classified and named as: saccharomyces cerevisiae (Saccharomyces cerevisiae) was deposited in China general microbiological culture Collection center on 2019 at 07-08 month with the following deposition numbers: CGMCC No.18090, the preservation address is: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North. However, the utilization rate of xylose is low when the strain is used for fermenting lignocellulose hydrolysate, and the main reason is that various inhibitors in the hydrolysate inhibit the utilization of xylose by the strain. In the research, the exogenous gene GRE2 with the detoxification function is introduced into ZR-1 strains, so that the strains have inhibitor tolerance, and the aim of efficiently utilizing xylose in hydrolysate is fulfilled.
Disclosure of Invention
Technical problem to be solved
In order to solve the above problems in the prior art, the present invention aims to provide a method for constructing a genetically recombinant saccharomyces cerevisiae with a detoxification function, a genetically recombinant saccharomyces cerevisiae with a detoxification function and applications thereof.
(II) technical scheme
In order to achieve the purpose, the invention adopts the main technical scheme that:
a gene recombination saccharomyces cerevisiae with a detoxification function contains an exogenous aldehyde reductase gene, wherein the exogenous aldehyde reductase gene is shown as SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof.
Preferably, the exogenous aldehyde reductase gene is obtained by performing PCR amplification by using Pichia stipitis (Pichia stipitis) genome DNA as a template and introducing two enzyme cutting sites of Xho I and Not I at the C end and the N end respectively, wherein the Pichia stipitis is preserved in China center for culture Collection of industrial microorganisms and is numbered as CICC 1960.
The saccharomyces cerevisiae starting strain is a strain ZR-1, and the strain ZR-1 is classified and named as: saccharomyces cerevisiae (Saccharomyces cerevisiae) was deposited in China general microbiological culture Collection center on 2019 at 07-08 month with the following deposition numbers: CGMCC No.18090, the preservation address is: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North.
The preservation number of the gene recombinant saccharomyces cerevisiae with the detoxification function is CGMCC No. 17923; and (3) in 2019, the strain is preserved in China general microbiological culture Collection center at 06 and 13, and the preservation address is as follows: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North.
The invention also relates to a construction method of the gene recombinant saccharomyces cerevisiae with the detoxification function, which comprises the following steps:
s1, extracting Pichia stipitis genome DNA;
s2, taking the extracted Pichia stipitis genome DNA as a template, designing a primer for PCR amplification, and recovering and purifying a PCR product after the PCR amplification;
s3, cutting an objective gene band from the PCR product, and purifying to obtain a GRE2 gene fragment;
s4, carrying out Not I and Xho I double enzyme digestion on the GRE2 gene fragment and the pYES2/NTA plasmid, and then connecting the GRE2 gene fragment to a pYES2/NTA vector to obtain a new recombinant plasmid pYES2/NTA-GRE 2;
s5, transforming the recombinant plasmid pYES2/NTA-GRE2 into saccharomyces cerevisiae to construct gene recombinant saccharomyces cerevisiae.
Preferably, in step S2, the primers include:
the upstream primer is as follows:
TCGCGGCCGCATGACCTCCGTTTTCGTATCAGGTGCCACCGGCTTTAT, respectively; not I restriction sites are underlined;
the downstream primer is:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT, respectively; xho I cleavage sites are underlined.
Preferably, in step S3, the target gene band is cut from the PCR product by using a razor blade, and the purified GRE2 gene fragment is obtained by dissolving the target gene band with a buffer solution, adsorbing the target gene band on an adsorption column, centrifuging the target gene band, desorbing the target gene band with ultrapure water, and centrifuging the target gene band.
Preferably, in the step S4, GRE2 gene is ligated to pYES2/NTA vector by Gibson ligation to obtain a new recombinant plasmid.
Preferably, the conversion process of step S5 includes: adding the recombinant plasmid pYES2/NTA-GRE2 into the bacterial suspension of the saccharomyces cerevisiae, uniformly mixing, carrying out ice bath, transferring into a precooled electric rotating cup, and carrying out electric shock at 1500V to obtain a transformant.
Preferably, the step S5 further includes: the method comprises the steps of selecting a monoclonal transformant of the saccharomyces cerevisiae for culturing, extracting plasmids, carrying out double enzyme digestion and gel electrophoresis on the extracted plasmids by using Not I and Xho I enzymes, and verifying whether the recombinant plasmids are successfully transformed into the saccharomyces cerevisiae.
The invention also relates to application of the genetically recombinant saccharomyces cerevisiae with the detoxification function in the preparation of ethanol by lignocellulose fermentation.
Experiments prove that the gene recombinant saccharomyces cerevisiae with the detoxification function can generate a large amount of aldehyde reductase when furfural and hydroxymethyl furfural are used as substrates and NADPH is used as coenzyme for induction expression. Therefore, the gene recombinant saccharomyces cerevisiae with the detoxification function can be applied to the production of the process for preparing ethanol by fermenting lignocellulose, not only can efficiently ferment the pretreatment materials of lignocellulose to produce fuel ethanol, but also can remove aldehyde organic matters such as furfural and hydroxymethylfurfural in the pretreatment materials which have toxic action on ethanol fermentation, so as to ensure that the cellulose fermentation is more thorough and the fermentation process is more efficient.
(III) advantageous effects
The invention has the beneficial effects that:
the genetic recombinant saccharomyces cerevisiae with the aldehyde reduction function is obtained by transferring GRE2 aldehyde reductase gene (1151bp) into saccharomyces cerevisiae, the saccharomyces cerevisiae can not only carry out high-efficiency fermentation on lignocellulose pretreatment materials to produce fuel ethanol, but also can express GRE2 gene in the saccharomyces cerevisiae to produce a large amount of aldehyde reductase under the condition of furfural and hydroxymethyl furfural pressure, so that organic aldehydes such as furfural, hydroxymethyl furfural and the like which originally inhibit or poison the fermentation process are reduced and converted into other substances which are not toxic to the fermentation (detoxification is realized), and the smooth and high-efficiency proceeding of the process for producing ethanol by cellulose fermentation is ensured.
Drawings
FIG. 1 is an agarose gel electrophoresis of Pichia stipitis genomic DNA; wherein: m is marker band, 1, 2 are tree trunk Pichia genome DNA band.
FIG. 2 is an agarose gel electrophoresis of a fragment of the aldehyde reductase gene of GRE 2; wherein: m is a marker band, and 1 is a GRE2 gene band.
FIG. 3 is a PCR agarose gel electrophoresis chart of the bacterial liquid from which recombinant plasmid pYES2/NTA-GRE2 has been transformed into competent cells of Escherichia coli T1; wherein: m is marker band, 1-5 is GRE2 gene band, which shows that recombinant plasmid pYES2/NTA-GRE2 can be transformed into bacterial host.
FIG. 4 is a diagram of agarose gel electrophoresis of double restriction on plasmid extracted from a transformant in which recombinant plasmid pYES2/NTA-GRE2 has been transformed into Saccharomyces cerevisiae; wherein: m is a maker band, and 1-5 are plasmid double-enzyme cutting bands.
FIG. 5 is an SDS-PAGE gel electrophoresis of GRE2 enzyme (aldehyde reductase) in the case of inducible expression of Saccharomyces cerevisiae containing GRE2 gene with furfural and hydroxymethylfurfural as substrates and NADPH as a coenzyme; wherein: m is a marker band, and 1 is a protein band expressed by the gene recombination saccharomyces cerevisiae.
Detailed Description
For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings.
In order to obtain the gene recombination saccharomyces cerevisiae with the detoxification function, the method can be carried out as follows:
(I) extracting Pichia stipitis genome DNA
The pichia stipitis genome DNA is extracted by a yeast genome DNA extraction kit of Solebao company, and is verified by 1 percent agarose gel electrophoresis after the extraction is finished, and the specific operation steps are as follows:
(1) 1-5ml of yeast cells were centrifuged at 12000rpm for 1min, and the supernatant was aspirated as much as possible.
(2) 470ul sorbitol Buffer was added to the yeast cells. Fully suspending the thallus, adding 25ul of yeast wall breaking enzyme and 5ul of sulfhydryl reducing agent, and fully and uniformly mixing. Treating at 30 deg.C for 1-2h, and mixing by inverting the centrifuge tube several times.
(3) Centrifuging at 12000rpm for 1min, discarding the supernatant, and collecting the precipitate.
(4) Adding 200ul of solution A to the precipitate, suspending the precipitate thoroughly, adding 20ul of RNase A (10mg/ml) to the suspension, mixing thoroughly by inversion, and standing at room temperature for 10 min.
(5) 20ul of proteinase K (10mg/ml) was added and mixed well by inversion. Digesting in water bath at 65 ℃ for 15-30min, and reversing the centrifuge tube to mix uniformly for several times during digestion until the sample is completely digested.
(6) Adding 200ul of solution B, adding 200ul of anhydrous ethanol, fully reversing and mixing, wherein flocculent precipitate may appear at this time, without affecting DNA extraction, adding the solution and flocculent precipitate into adsorption column, and standing at room temperature for 2 min.
(7) Centrifuging at 12000rpm for 2min, discarding waste liquid, and placing the adsorption column into the collection tube.
(8) 600ul of rinse solution was added to the column (check for absolute ethanol addition before use). Centrifuging at 12000rpm for 1min, discarding waste liquid, and placing the adsorption column into the collection tube.
(9) Adding 600ul rinsing liquid into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into the collection tube.
(10) Centrifuging at 12000rpm for 2min, and placing the adsorption column in an open room temperature or 50 deg.C incubator for several minutes to remove residual rinsing liquid in the adsorption column, otherwise ethanol in the rinsing liquid will affect subsequent experiments such as enzyme digestion, PCR, etc.
(11) Placing the adsorption column into a clean centrifuge tube, suspending and dripping 50-200ul of eluent preheated by 65 deg.C water bath into the center of the adsorption membrane, standing at room temperature for 5min, and centrifuging at 12000rpm for 1 min.
(12) Adding the eluent obtained by centrifugation into an adsorption column, and centrifuging at 12000rpm for 2min to obtain high-quality genome DNA.
FIG. 1 shows agarose gel electrophoresis of Pichia stipitis genomic DNA; wherein: m is marker band, 1, 2 are tree trunk Pichia genome DNA band.
(II) PCR amplification with Pichia pastoris genome DNA as template
The extracted pichia stipitis genome DNA is used as a template, a primer is designed for PCR, and the PCR is verified by running 1% agarose gel.
Upstream (N-terminal) primer GRE 2-F:
TCGCGGCCGCATGACCTCCGTTTTCGTATCAGGTGCCACCGGCTTTAT (Not I restriction site underlined)
Downstream (C-terminal) primer GRE 2-R:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT (Xho I restriction site underlined)
The PCR reaction system comprises DNA mix 10L, upstream and downstream primers (10 ng/L) 0.41 respectively, DNA template (10 ng/L) 0.21, DMSO 0.8L, sterile water 8.2L and the total volume of 20L.
And (3) PCR reaction conditions: pre-denaturation at 95 deg.C for 5min, deformation at 95 deg.C for 30s, annealing at 50 deg.C for 1min, extension at 72 deg.C for 10min, circulation for 20 times, extension at 72 deg.C for 20min, and storage at 4 deg.C. After the reaction, the PCR product was subjected to 1% agarose electrophoresis.
FIG. 2 shows an agarose gel electrophoresis of the fragment of the GRE2 aldehyde reductase gene; wherein: m is a marker band, and 1 is a GRE2 gene band.
As can be seen from FIG. 2, a specific band exists between 2000bp and 1000bp, namely the position of the fragment of the GRE2 gene (1151bp), and the GRE2 gene has the following sequence (attached sequence table):
(III) PCR product recovery, gel cutting and purification
Adopting a column type DNA glue recovery Kit of DNA Gel Extraction Kit of NEB company to recover PCR products, carrying out electrophoresis according to the mode of obtaining the figure 2 in the step (II), and then cutting glue, wherein the specific operation steps are as follows:
(1) separating PCR products by 1% agarose gel electrophoresis, cutting off a target gene band by a blade under ultraviolet light, putting the cut gel into a centrifugal tube of 1.5m L, weighing the gel, adding Binding Buffer with equal weight, and putting the gel in a water bath at 65 ℃ until the gel is completely dissolved;
(2) transferring the glue solution into an adsorption column, standing for 10min, and centrifuging at 12000rpm for 1 min;
(3) transferring the liquid in the centrifuged collection tube to an adsorption column again, standing for 5min, centrifuging at 12000rpm for 1min, and pouring out the liquid in the collection tube;
(4) adding 700L SPW Wash Buffer into the adsorption column, centrifuging at 12000rpm for 1min, pouring off liquid in the collection tube, placing the adsorption column into the same collection tube, and repeating the steps once;
(5) centrifuging the empty adsorption column at 12000rpm for 3min, and air drying at room temperature for 15 min;
(6) adding 30L ultrapure water into the empty adsorption column, standing at room temperature for 5min, and centrifuging at 12000rpm for 3 min;
(7) the solution in the centrifugal tube is the aqueous solution of the DNA fragment containing the template gene strip;
(8) 3L was subjected to agarose gel electrophoresis and the band was evident at the correct position and the remaining DNA samples were stored at-20 ℃.
(IV) GRE2 gene, pYES2/NTA plasmid enzyme digestion and recombinant plasmid construction
The GRE2 gene fragment obtained by PCR amplification and pYES2/NTA plasmid (purchased from vast Ling plasmid platform, cat number: P1680) are subjected to Not I and Xho I double enzyme digestion, and then the GRE2 gene is connected to pYES2/NTA vector by a Gibson connection method, so that a new recombinant plasmid pYES2/NTA-GRE2 is obtained.
The double enzyme digestion system comprises 1.5L of Not I enzyme and 1.5 of Xho I enzyme respectively, and the water of cut smart Buffer 5L 2g (calculated according to the concentration) is supplemented to 50L, 37 ℃ and 3 h.
The Gibson connection system comprises enzyme 6L, carrier and fragment 4L in a ratio of 1: 3-5, and is carried out at 50 ℃ for 1h in a metal bath.
(V) the recombinant plasmid pYES2/NTA-GRE2 is transformed into Escherichia coli T1
The ligation product of 10L from the previous step was mixed with competent E.coli T1 cells of 100L, ice-washed for 30min, heat-shocked for 90s at 42 ℃ and immediately replaced on ice for 3-5min, followed by addition of 800 LL B liquid medium, incubation at 37 ℃ for 50-60min, plating on L B solid plates (containing 10g/m L ampicillin), and incubation at 37 ℃ overnight.
(VI) PCR preliminary identification of bacterial liquid
And (4) using a liquid transfer gun to pick a transformant, carrying out monoclonal culture in L B liquid culture medium for 6-8h, and then carrying out bacteria liquid PCR.
An upstream primer F: 5'-ATGTCAGTTTTCGTTTCAGG-3'
A downstream primer R: 5'-TTATATTCTGCCCTCAAATT-3'
The PCR system of bacterial liquid comprises enzyme 5L, upstream and downstream primers 0.5L, bacterial liquid 0.5L, and sterilized water 3.5L, wherein the total volume is 10L.
PCR process of bacterial liquid: pre-denaturation at 94 deg.C for 10min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 2min, extension at 72 deg.C for 10min, 30 cycles, and storage at 4 deg.C. And (3) after the reaction is finished, carrying out 1% agarose electrophoresis detection and verification on the PCR product, and verifying the correct colony.
FIG. 3 shows PCR agarose gel electrophoresis of the plasmid pYES2/NTA-GRE2 transformed into competent cells of Escherichia coli T1; wherein: m is marker band, 1-5 is GRE2 gene band. As can be seen from FIG. 3, the presence of the GRE2 gene band is verified by PCR of the bacterial liquid, which indicates that the recombinant plasmid is successfully transformed into the competent cells of Escherichia coli T1.
(VII) recombinant plasmid DNA sequencing
The transformant identified as positive clone by colony PCR is cultured in a liquid test tube of 5m LL B for 12-16h and sent to the Qincuo organism (Beijing) corporation for DNA sequencing, and the sequence obtained after sequencing is compared by DNAMAN software to verify the correctness of the sequence and the reliability of the method.
(eight) extraction of pYES2/NTA-GRE2 recombinant plasmid
Plasmid is extracted in small quantity by adopting a Plamid Miniprep Kit of NEB company, and the specific operation steps are as follows:
(1) escherichia coli T1 containing pYES2/NTA-GRE2 plasmid which is verified to be correct is inoculated into liquid L B culture medium containing ampicillin (100g/m L) at 5m L, and the culture is carried out for about 10h by shaking;
(2) taking out the bacterial liquid, adding the bacterial liquid into a centrifugal tube of 1.5m L, centrifuging for 1min at normal temperature and 12000rpm, and discarding the supernatant;
(3) adding 250L solution I, blowing, stirring, adding 250L solution II, slightly reversing for several times, mixing, and standing at room temperature for 2 min;
(4) adding 350L solution III, slightly inverting for several times to disperse the lysate uniformly, standing at room temperature for 2min, and centrifuging at 12000rpm for 10 min;
(5) transferring the supernatant to an adsorption column, standing for 5min, centrifuging at 12000rpm for 1min at normal temperature, and pouring out the liquid in the collection tube;
(6) adding 700L DNA Wash Buffer into an adsorption column, centrifuging at normal temperature 12000rpm for 1min, pouring out liquid in a collecting pipe, putting the adsorption column into the same collecting pipe, and repeating the steps once;
(7) centrifuging the empty adsorption column at 12000rpm for 2min, and air drying at room temperature for 15 min;
(8) adding 30L ultrapure water into an empty adsorption column, standing for 5min at room temperature, and centrifuging for 3min at 12000rpm, wherein the solution in the centrifugal tube is plasmid DNA aqueous solution;
(9) 3L was subjected to 1% agarose gel electrophoresis and a band was evident at the correct position, and the remaining DNA samples were stored at-20 ℃.
Thus, it was verified that the recombinant plasmid pYES2/NTA-GRE2 had the ability to be transformed into host cells.
(nine) recombinant plasmid shock transformation into Saccharomyces cerevisiae
The saccharomyces cerevisiae starting strain is a strain ZR-1, and the strain ZR-1 is classified and named as: saccharomyces cerevisiae (Saccharomyces cerevisiae) was deposited in China general microbiological culture Collection center on 2019 at 07-08 month with the following deposition numbers: CGMCC No.18090, the preservation address is: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North.
The method for transforming the recombinant plasmid into the saccharomyces cerevisiae comprises the following steps:
(1) inoculating Saccharomyces cerevisiae to 30m L YPD liquid culture medium, and culturing at 30 deg.C for 12 hr;
(2) transferring the culture into 30m L fresh YPD liquid culture medium with an inoculum size of 1%, and culturing at 30 deg.C for 8 hr to make thallus grow synchronously;
(3) placing the yeast culture on ice, standing for 30min, centrifuging at 6000rpm for 5min, and collecting thallus;
(4) discarding the supernatant, and adding pre-cooled 15m L ultrapure water to wash the thalli once;
(5) centrifuging at 6000rpm for 5min, collecting thallus, and repeatedly washing the thallus with 15m L1 mol/L sorbitol for three times;
(6) centrifuging to collect thalli, adding 200L 1 mol/L sorbitol to resuspend thalli, taking 200L bacterial suspension to a 1.5m L centrifugal tube;
(7) adding 20L (less than or equal to 5g) recombinant plasmid to be transformed into the prepared bacterial suspension, gently mixing uniformly, and carrying out ice bath for 10 min;
(8) transferring the bacterial suspension subjected to ice bath into a pre-cooled electric transfer cup, and electrically shocking for 5ms at 1500V;
(9) adding 1 mol/L sorbitol with proper volume to wash out the bacterial suspension after the electrotransfer from the electrotransfer cup, and taking 200L to coat a corresponding resistant plate;
(10) the transformant was selected by culturing at 30 ℃ for 3 to 5 days.
(Ten) extracting saccharomyces cerevisiae recombinant plasmid for verification
And (4) selecting the monoclonal transformant in the step (nine) for culturing, and extracting a plasmid by the following method:
(1) 1-5ml of the yeast culture was centrifuged at 12000rpm for 1min and the supernatant was aspirated as much as possible.
(2) Adding 470ul sorbitol Buffer into yeast, suspending the yeast completely, adding 25ul yeast cell wall breaking enzyme and 5ul sulfhydryl reducing agent, mixing well, treating at 30 deg.C for 1-2 hr, and mixing with centrifuge tube for several times. Centrifuging at 12000rpm for 1min, discarding the supernatant, and collecting the precipitate. 250ul YP1 was added to the pellet (please first check if RNaseA had been added) and the pellet was fully suspended.
(3) 250ul YP2 was added to the tube and gently turned upside down 6 to 8 times to lyse the cells sufficiently.
(4) 350ul YP3 was added to the tube and gently turned up and down 6-8 times immediately, and mixed well, at which time white flocculent precipitate appeared. Centrifuge at 12000rpm for 10min, and carefully transfer the supernatant to another clean centrifuge tube with a pipette, trying not to aspirate the pellet.
(5) And adding the supernatant obtained in the last step into an adsorption column, standing at room temperature for 2min, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and replacing the adsorption column into the collection tube again.
(6) Adding 600ul rinsing solution (before use, checking whether absolute ethanol is added), centrifuging at 12000rpm for 1min, discarding waste solution, and placing the adsorption column into the collection tube.
(7) Adding 600ul rinsing liquid into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into the collection tube.
(8) Centrifuging at 12000rpm for 2min, and placing the adsorption column in an open room or 50 deg.C incubator for several minutes.
(9) Placing the adsorption column into a clean centrifuge tube, suspending and dripping 50-200ul of eluent preheated by 65 deg.C water bath into the center of the adsorption membrane, standing at room temperature for 2min, and centrifuging at 12000rpm for 1 min.
(10) In order to increase the recovery efficiency of plasmid, the obtained eluent can be added into the adsorption column again, placed for 2min at room temperature, and centrifuged for 1min at 12000 rpm.
(eleven) double restriction enzyme digestion verification of recombinant plasmid
The extracted recombinant plasmid was verified by double digestion with NotI and XhoI enzymes and by electrophoresis in 1% agarose gel.
The double digestion system comprises 1.5L of Not I and Xho I enzymes respectively, and 50L of cut smart Buffer 5L 2g (calculated according to the concentration) of water, and the electrophoresis result is shown in figure 4 at 37 ℃ for 3 h.
FIG. 4 is a diagram of agarose gel electrophoresis of double restriction on plasmid extracted from a transformant in which recombinant plasmid pYES2/NTA-GRE2 has been transformed into Saccharomyces cerevisiae; wherein: m is a maker band, and 1-5 are plasmid double-enzyme cutting bands. As can be seen from FIG. 4, the extracted recombinant plasmid was double-digested and gel-filled (electrophoresis) verified that 1-5 had two specific bands, indicating that the recombinant plasmid was successfully constructed and successfully transformed into Saccharomyces cerevisiae.
Expression and verification of GRE2 gene in (twelve) gene recombinant saccharomyces cerevisiae
The furfural and hydroxymethyl furfural are used as substrates, NADPH is used as coenzyme for induction expression, wild strains are used as a reference, and the enzyme activity results are as follows:
TABLE 1 comparison of GRE2 enzyme activities of control and recombinant strains under the induction of different inhibitors
FIG. 5 shows the results of SDS-PAGE gel electrophoresis of proteins produced by the genetically recombinant Saccharomyces cerevisiae in the aforementioned environment. The molecular weight of GRE2 aldehyde reductase (protein) is 42 kDa. As shown in the figure, a band is obvious in the vicinity of slightly larger than 40kDa, which indicates that a large amount of GRE2 enzyme is produced, and the GRE2 gene contained in the gene recombination saccharomyces cerevisiae can be well expressed.
(thirteen) verification of xylose utilization in cellulose hydrolysate by genetically recombinant saccharomyces cerevisiae
The utilization condition of the gene recombinant strain on xylose in the dilute acid pretreatment hydrolysate is verified by taking a saccharomyces cerevisiae starting strain as a control strain, and the result is as follows:
TABLE 2 comparison of xylose utilization in hydrolysate by control and recombinant strains
atgtcagttt tcgtttcagg tgctaacggg ttcattgccc aacacattgt cgatctcctg 60
ttgaaggaag actataaggt catcggttct gccagaagtc aagaaaaggc cgagaattta 120
acggaggcct ttggtaacaa cccaaaattc tccatggaag ttgtcccaga catatctaag 180
ctggacgcat ttgaccatgt tttccaaaag cacggcaagg atatcaagat agttctacat 240
acggcctctc cattctgctt tgatatcact gacagtgaac gcgatttatt aattcctgct 300
gtgaacggtg ttaagggaat tctccactca attaaaaaat acgccgctga ttctgtagaa 360
cgtgtagttc tcacctcttc ttatgcagct gtgttcgata tggcaaaaga aaacgataag 420
tctttaacat ttaacgaaga atcctggaac ccagctacct gggagagttg ccaaagtgac 480
ccagttaacg cctactgtgg ttctaagaag tttgctgaaa aagcagcttg ggaatttcta 540
gaggagaata gagactctgt aaaattcgaa ttaactgccg ttaacccagt ttacgttttt 600
ggtccgcaaa tgtttgacaa agatgtgaaa aaacacttga acacatcttg cgaactcgtc 660
aacagcttga tgcatttatc accagaggac aagataccgg aactatttgg tggatacatt 720
gatgttcgtg atgttgcaaa ggctcattta gttgccttcc aaaagaggga aacaattggt 780
caaagactaa tcgtatcgga ggccagattt actatgcagg atgttctcga tatccttaac 840
gaagacttcc ctgttctaaa aggcaatatt ccagtgggga aaccaggttc tggtgctacc 900
cataacaccc ttggtgctac tcttgataat aaaaagagta agaaattgtt aggtttcaag 960
ttcaggaact tgaaagagac cattgacgac actgcctccc aaattttaaa atttgagggc1020
agaatataa 1029
Claims (6)
1. A gene recombinant saccharomyces cerevisiae with a detoxification function is characterized in that the gene recombinant saccharomyces cerevisiae contains an exogenous aldehyde reductase gene which is shown as SEQ ID NO: 1, and is named as GRE2 gene;
the GRE2 gene is obtained by performing PCR amplification by taking Pichia stipitis (Pichia stipitis) genome DNA as a template and introducing two enzyme cutting sites of Xho I and Not I at the C end and the N end respectively, wherein the Pichia stipitis is preserved in China center for culture preservation and management of industrial microorganisms and is numbered CICC 1960;
the starting strain of the gene recombinant saccharomyces cerevisiae is a strain ZR-1 which is classified and named as: saccharomyces cerevisiae (Saccharomyces cerevisiae) was deposited in China general microbiological culture Collection center on 2019 at 07-08 month with the following deposition numbers: CGMCC No.18090, the preservation address is: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North;
the starting strain ZR-1 can ferment lignocellulose biomass to produce fuel ethanol, and the aldehyde reductase expressed by the GRE2 gene can degrade furfural and hydroxymethyl furfural produced in the lignocellulose pretreatment process;
the construction method of the gene recombinant saccharomyces cerevisiae with the detoxification function comprises the following steps:
s1, extracting Pichia stipitis genome DNA with a preservation number of CICC 1960;
s2, taking the extracted Pichia stipitis genome DNA as a template, designing a primer for PCR amplification, and recovering and purifying a PCR product after the PCR amplification;
the primer comprises:
an upstream primer:
TCGCGGCCGCATGACCTCCGTTTTCGTATCAGGTGCCACCGGCTTTAT, respectively; not I restriction sites are underlined;
a downstream primer:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT；
xho I cleavage sites are underlined;
s3, cutting an objective gene band from the PCR product, and purifying to obtain the GRE2 gene;
s4, carrying out NotI and Xho I double enzyme digestion on the GRE2 gene and pYES2/NTA plasmid, and then connecting the GRE2 gene to a pYES2/NTA plasmid vector to obtain a new recombinant plasmid pYES2/NTA-GRE 2;
s5, transforming the recombinant plasmid pYES2/NTA-GRE2 into the original strain ZR-1 to construct the gene recombinant saccharomyces cerevisiae with the detoxification function.
2. The genetically recombinant saccharomyces cerevisiae with detoxification function as claimed in claim 1, wherein the genetically recombinant saccharomyces cerevisiae with detoxification function has a preservation number of CGMCC No.17923, is preserved in the general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 13.06.2019, and has a preservation address: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North.
3. The genetically modified saccharomyces cerevisiae with detoxification function as claimed in claim 1, wherein in step S3, the target gene band is cut from the PCR product by using a blade, and the purified GRE2 gene fragment is obtained by dissolving with buffer solution, adsorbing with an adsorption column, centrifuging, desorbing with ultrapure water, and centrifuging.
4. The genetically recombinant Saccharomyces cerevisiae with detoxification function as claimed in claim 1, wherein in step S4, GRE2 gene is ligated to pYES2/NTA vector by Gibson ligation to obtain a new recombinant plasmid.
5. The genetically recombinant Saccharomyces cerevisiae with detoxification function as claimed in claim 1, wherein the transformation process of step S5 comprises: adding recombinant plasmid pYES2/NTA-GRE2 into the bacterial suspension of the saccharomyces cerevisiae, uniformly mixing, carrying out ice bath, transferring into a precooled electric rotating cup, and carrying out electric shock at 1500V to obtain a transformant;
the step S5 further includes: the method comprises the steps of selecting a monoclonal transformant of the saccharomyces cerevisiae for culturing, extracting plasmids, carrying out double enzyme digestion and gel electrophoresis on the extracted plasmids by using Not I and Xho I enzymes, and verifying whether the recombinant plasmids are successfully transformed into the saccharomyces cerevisiae.
6. The application of the gene recombinant saccharomyces cerevisiae with the detoxification function in the preparation of ethanol by lignocellulose fermentation is disclosed, wherein the preservation number of the gene recombinant saccharomyces cerevisiae is CGMCC No. 17923.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910681249.6A CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910681249.6A CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110452827A CN110452827A (en) | 2019-11-15 |
| CN110452827B true CN110452827B (en) | 2020-07-31 |
Family
ID=68483545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910681249.6A Active CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452827B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101627109A (en) * | 2006-12-01 | 2010-01-13 | 格沃股份有限公司 | Engineered microorganisms for producing n-butanol and related methods |
| CN102639705A (en) * | 2009-12-03 | 2012-08-15 | Bp北美公司 | Methods and apparatuses for producing renewable materials from inhibiting compounds |
| CN105985915A (en) * | 2015-02-09 | 2016-10-05 | 中国农业科学院作物科学研究所 | Saccharomyces cerevisiae recombinant strain for regulating expression activity of GRE3 genes and application of recombinant strain |
| CN107937296A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application |
| CN107937297A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | Mortifier stress tolerance saccharomyces cerevisiae more than one plant and preparation method, application |
| CN108504584A (en) * | 2018-05-24 | 2018-09-07 | 齐鲁工业大学 | A kind of culture medium and application for being suitable for improving co-fermentation of glucose and xylose saccharomyces cerevisiae and being resistant to a variety of pretreatment mortifiers |
| CN109312373A (en) * | 2016-03-09 | 2019-02-05 | 布拉斯肯有限公司 | For producing microorganism and the method for ethylene glycol and C3compounds altogether |
| CN109486693A (en) * | 2018-11-30 | 2019-03-19 | 吉林中粮生化有限公司 | A kind of S. cervisiae and its purposes in alcohol fermentation |
| CN109706089A (en) * | 2019-02-14 | 2019-05-03 | 中国石油化工股份有限公司 | A kind of xylose-fermenting strains being resistant to mortifier and its construction method and application |
-
2019
- 2019-07-24 CN CN201910681249.6A patent/CN110452827B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101627109A (en) * | 2006-12-01 | 2010-01-13 | 格沃股份有限公司 | Engineered microorganisms for producing n-butanol and related methods |
| CN102639705A (en) * | 2009-12-03 | 2012-08-15 | Bp北美公司 | Methods and apparatuses for producing renewable materials from inhibiting compounds |
| CN105985915A (en) * | 2015-02-09 | 2016-10-05 | 中国农业科学院作物科学研究所 | Saccharomyces cerevisiae recombinant strain for regulating expression activity of GRE3 genes and application of recombinant strain |
| CN109312373A (en) * | 2016-03-09 | 2019-02-05 | 布拉斯肯有限公司 | For producing microorganism and the method for ethylene glycol and C3compounds altogether |
| CN107937296A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application |
| CN107937297A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | Mortifier stress tolerance saccharomyces cerevisiae more than one plant and preparation method, application |
| CN108504584A (en) * | 2018-05-24 | 2018-09-07 | 齐鲁工业大学 | A kind of culture medium and application for being suitable for improving co-fermentation of glucose and xylose saccharomyces cerevisiae and being resistant to a variety of pretreatment mortifiers |
| CN109486693A (en) * | 2018-11-30 | 2019-03-19 | 吉林中粮生化有限公司 | A kind of S. cervisiae and its purposes in alcohol fermentation |
| CN109706089A (en) * | 2019-02-14 | 2019-05-03 | 中国石油化工股份有限公司 | A kind of xylose-fermenting strains being resistant to mortifier and its construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110452827A (en) | 2019-11-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Berłowska et al. | Simultaneous saccharification and fermentation of sugar beet pulp for efficient bioethanol production | |
| Kuhad et al. | Bioethanol production from pentose sugars: Current status and future prospects | |
| Chandel et al. | Bioconversion of pentose sugars into ethanol: a review and future directions | |
| CN104540956B (en) | The method for processing lignocellulose biomass using single-stage automatic hydrolysis and with the C5 enzymatic hydrolysis bypassed and rear hydrolysis | |
| Wu et al. | Single-cell protein and xylitol production by a novel yeast strain Candida intermedia FL023 from lignocellulosic hydrolysates and xylose | |
| Qureshi et al. | Bioconversion of renewable resources into ethanol: an economic evaluation of selected hydrolysis, fermentation, and membrane technologies | |
| JP2011529345A (en) | Methods and compositions for improving production of products in microorganisms | |
| JP2013500019A (en) | Methods and compositions for promoting sugar transport, mixed sugar fermentation and biofuel production | |
| US20120301928A1 (en) | Preprocessing method of hydrolyzing lignocellulosic biomass and methods of manufacturing sugar compound and bioethanol from biomass processed using the preprocessing method | |
| JP2013545491A (en) | Enhancement of ethanol production by xylose-utilizing zymomonas mobilis in biomass hydrolyzate medium | |
| WO2013106113A2 (en) | Integrated processes for conversion of lignocellulosic biomass to bioproducts and systems and apparatus related thereto | |
| Wu et al. | Microbial hydrolysis and fermentation of rice straw for ethanol production | |
| Chen et al. | Producing bioethanol from pretreated-wood dust by simultaneous saccharification and co-fermentation process | |
| CN107207572A (en) | The variant of Gal2 transport proteins and their purposes | |
| Goel et al. | Ethanol production from rice (Oryza sativa) straw by simultaneous saccharification and cofermentation | |
| CN103374542B (en) | A kind of method improving Clostridium beijerinckii xylose consumption rate | |
| Zhang et al. | Fermentation of glucose and xylose in cattail processed by different pretreatment technologies. | |
| CN110452827B (en) | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof | |
| CN112280700A (en) | Acetic acid and formic acid resistant fermentation strain and construction method thereof | |
| CN103180451B (en) | Method for producing ethanol using recombinant yeast strain | |
| CN114410562B (en) | Klebsiella engineering bacterium and application thereof in ethanol production | |
| CN106554924B (en) | Recombinant saccharomyces cerevisiae strain for producing ethanol, construction method thereof and method for producing ethanol by using strain | |
| CN113481116B (en) | Heat-resistant yeast with high tolerance to lignocellulose-derived inhibitor, and construction method and application thereof | |
| CN112646797B (en) | Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene | |
| CN101671698A (en) | Method for improving fermentation speed of starchy raw material alcohol and liquor yield by using xylanase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200617 Address after: 063000 No. 1, front road, Fengrun District, Hebei, Tangshan City Applicant after: ZHONGRONG TECHNOLOGY Corp.,Ltd. Address before: Seat 008, 19th Floor, 1200 Century Avenue, China (Shanghai) Free Trade Pilot Area, Pudong New Area, Shanghai, 2001 Applicant before: Shanghai Zhongrong Technology Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |