CN110452827A - It is a kind of with the genetic recombination saccharomyces cerevisiae and construction method of detoxification function and its application - Google Patents
It is a kind of with the genetic recombination saccharomyces cerevisiae and construction method of detoxification function and its application Download PDFInfo
- Publication number
- CN110452827A CN110452827A CN201910681249.6A CN201910681249A CN110452827A CN 110452827 A CN110452827 A CN 110452827A CN 201910681249 A CN201910681249 A CN 201910681249A CN 110452827 A CN110452827 A CN 110452827A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- gre2
- genetic recombination
- nta
- pyes2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Abstract
The present invention relates to a kind of genetic recombination saccharomyces cerevisiae with detoxification function, the genetic recombination saccharomyces cerevisiae contains exogenous aldehyde reductase gene, and the exogenous aldehyde reductase gene is the aldehyde reductase gene of the sequence as shown in SEQ ID NO:1.The exogenous aldehyde reductase gene is to carry out PCR amplification by template of pichia stipitis (Pichia stipitis) genomic DNA, two restriction enzyme sites of Xho I and Not I are introduced respectively in C-terminal and N-terminal and are obtained simultaneously, GRE2 genetic fragment is connected on pYES2/NTA plasmid vector, recombinant plasmid pYES2/NTA-GRE2 is obtained, the genetic recombination saccharomyces cerevisiae for obtaining having detoxification function in saccharomyces cerevisiae is then transformed into.The S. cervisiae not only can carry out high-efficiency fermenting to the pretreated material of lignocellulosic and produce alcohol fuel, fermentation process can be removed simultaneously generates the aldehyde material for inhibiting or poisoning, " detoxification " to fermentation inhibitor in lignocellulosic pretreated material is realized, to guarantee the smooth and efficient of ferment cellulose for producing ethanol.
Description
Technical field
The present invention relates to technique for gene engineering more particularly to a kind of genetic recombination saccharomyces cerevisiaes and structure with detoxification function
Construction method and its application.
Background technique
It is that fermenting raw materials produce alcohol fuel using agricultural stalk as petroleum resources shortage, reserves increasingly increasingly decline
And various chemical products, to meet human social development demand, it is considered to be one can clean the energy instead of petroleum.Expert
Think that producing ethyl alcohol as the lignocellulose-like biomass of representative using agricultural crop straw has good development prospect, facilitates simultaneously
The processing for solving the problems, such as agricultural production waste, not only alleviates crisis of resource and crisis in food in this way, and environmental pollution also has
Critically important meaning, more sustainable development provide guarantee.
Lignocellulosic (lignocellulose) is the most affluent resources of the renewable acquisition of nature, is contained huge
Biomass energy.Mainly pass through the processes such as material pretreatment, enzymatic saccharification, fermentation and rectifying using Production of Alcohol from Lignocellulose.
Wherein, material pretreating process is mainly with hydrothermal decomposition, steam blasting, acid [Almeida JRM, Modig T, Petersson
A, Hahn-Hagerdal B, Liden G, GorwaGrauslund MF.Increased tolerance and
conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces
Cerevisiae.J Chem Technol Biotechnol.2007,82:340-349] or alkali [Saha BC, Cotta
MA.Comparison of pretreatment strategies for enzymatic saccharification and
Fermentation of barley straw to ethanol.New Biotechnol.2010,27:10-15.] it is hydrolyzed to
Main, these methods all more or less generate furfural, hydroxymethylfurfural, phenols and organic in lignocellulosic preprocessing process
The noxious materials such as acid, these substances can all generate inhibition to enzymatic hydrolysis and alcohol fermentation, cause to digest insufficient and fermentation not exclusively,
To the development of constraints on fiber element ethyl alcohol and related industry.
Therefore, mortifier contained in pretreated material is effectively removed, i.e., " detoxification " is to improve enzymatic hydrolysis and fermenting property
Required step.Currently, carrying out detoxification mode to material after pretreatment is typically divided into three types, it is physical method, chemistry respectively
Method and bioanalysis.Main physico-chemical method includes: rotary evaporation [Llano T, Quijorna N, Coz
A.Detoxification of a lignocellulosic waste from a pulp mill to enhance its
2017,10 (3): fermentation prospects.Energies 348.], is filtered, active carbon adsorption [Li Yunchao, Wang Xian
China, Yang Haiping wait bamboo charcoal surface texture and its characterization of adsorption [J] Journal of Agricultural Engineering to furfural, 2012,28 (12):
257-263.], excessive alkaline reagent [Alriksson B, Horv á th I S,A, et al.Ammonium
hydroxide detoxification of spruce acid hydrolysates.Applied Biochemistry
Biotechnology, 2005,124 (1-3): 911-922.], macroporous resin adsorption [Jiao Lei furol waste liquid purification and its diluted acid
The Nanning research [D] of molasses fermented alcohol: Guangxi University, 2014.], ion exchange [Alriksson B, Cavka A,L J.Improving the fermentability of enzymatic hydrolysates of
lignocellulose through chemical in-situ detoxification with reducing
Agents.Bioresource Technology, 2011,102 (2): 1254-1263.] or these methods are applied in combination.
But physical and chemical poison-removing method has it to be difficult to the shortcomings that overcoming: single method cannot remove the different mortifier of physicochemical property；Joint
Detoxification cost is then increased substantially with a variety of physical and chemical means, complicated detoxification process becomes infeasible in production；Some reasons
New pollutant can also be generated by changing detoxification means.
Bioanalysis mainly goes degradation to eliminate mortifier using microorganism or enzyme.Including three aspects: first is that before fermentation
The inoculating microbe of addition energy Inhibition of degradation object；Second is that carrying out breeding domestication to fermentative microorganism, including use genetic engineering skill
Art carries out genetic recombination to fermentative microorganism, improves the tolerance to mortifier, or even the ability with Inhibition of degradation object；Three
It is that addition biological enzyme carries out detoxification treatment.Nichols etc. has studied inoculated fungi in corn stover dilute acid hydrolysis liquid
Coniochaeta ligniaria NRRL30616 analyzes component quantifying in the hydrolyzate after culture, finds a variety of aromatic series
The mortifiers such as compound, fatty acid, furfural all significantly reduce, and optimize the Utilization ability in alcohol fermentation processes to xylose
[Nichols N N, Sharma L N, Mowery R A, et al.Fungal metabolism of fermentation
inhibitors present in corn stover dilute acid hydrolysate.Enzyme Microbial
Technology, 2008,42 (7): 624-630.].Saravanakumar T etc. by the way that laccase is fixed on nanofiber,
40 DEG C of reaction 36h can remove furfural, acetosyringone and coniferyl aldehyde in ligno-cellulose hydrolysate completely.The studies above
There is good reference function [Saravanakumar T, Park H for the removing with the by-product generated in treatment process
S, Mo A Y, et al.Detoxification of furanic and phenolic lignocellulose derived
inhibitors of yeast using laccase immobilized on bacterial cellulosic
Nanofibers [J] .Journal of Molecular Catalysis B Enzymatic, 2016,134:196-205.].
It is conducted extensive research in recent years, people are directed to the microorganism with " detoxification " ability.The study found that some
Yeast strain has good detoxification ability.In actual industrial production, it is engineering bacteria that people, which also have begun using saccharomycete,
Strain carries out producing fuel ethyl alcohol by ferment research to lignocellulosic.But not yet obtaining one kind at present both can locate in advance lignocellulosic
It manages the mortifier generated and realizes effectively removing, and the bacterial strain of energy high-efficiency fermenting lignocellulose biomass production alcohol fuel.
This laboratory early period has obtained one plant of saccharomyces cerevisiae that can efficiently utilize xylose by bacterial screening renovation technique
Bacterial strain ZR-1, bacterial strain ZR-1 classification naming are as follows: saccharomyces cerevisiae (Saccharomyces cerevisiae), in 07 month 2019 08
Day is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number are as follows: CGMCC No.18090 is protected
Hide address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.But the strain is in fermenting lignocellulose hydrolyzate, it is wooden
Sugar utilization is very low, and main cause is that the various mortifiers in hydrolyzate inhibit utilization of the bacterial strain to xylose.This research is logical
Crossing, will there is the foreign gene GRE2 of " detoxification " function to imported into ZR-1 strain, mortifier tolerance be made it have, to reach
The purpose of xylose in hydrolyzate can efficiently be utilized.
Summary of the invention
(1) technical problems to be solved
In order to solve the above problem of the prior art, the object of the present invention is to provide a kind of gene weights with detoxification function
The construction method of group saccharomyces cerevisiae, genetic recombination saccharomyces cerevisiae and its application with detoxification function.
(2) technical solution
In order to achieve the above object, the main technical schemes that the present invention uses include:
A kind of genetic recombination saccharomyces cerevisiae with detoxification function, the genetic recombination saccharomyces cerevisiae contain exogenous aldehyde also
Nitroreductase gene, the exogenous aldehyde reductase gene are the aldehyde reductase genes of the sequence as shown in SEQ ID NO:1.
Preferably, the exogenous aldehyde reductase gene is with pichia stipitis (Pichia stipitis) genome
DNA is that template carries out PCR amplification, while introducing two restriction enzyme sites of Xho I and Not I respectively in C-terminal and N-terminal and obtaining, institute
It states pichia stipitis and has been preserved in Chinese industrial Microbiological Culture Collection administrative center, number is CICC 1960.
Saccharomyces cerevisiae starting strain of the invention is bacterial strain ZR-1, bacterial strain ZR-1 classification naming are as follows: saccharomyces cerevisiae
(Saccharomyces cerevisiae) was preserved in China Committee for Culture Collection of Microorganisms on 07 08th, 2019
Common micro-organisms center, deposit number are as follows: CGMCC No.18090, preservation address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number.
The deposit number of genetic recombination saccharomyces cerevisiae with detoxification function of the invention is CGMCC No.17923；In
It is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center within 06 month 2019 13, preservation address: Beijing
The institute 3 of Chaoyang District North Star West Road 1.
The invention further relates to a kind of construction methods of genetic recombination saccharomyces cerevisiae with detoxification function comprising following step
It is rapid:
S1. pichia stipitis genomic DNA is extracted；
S2. using the pichia stipitis genomic DNA of extraction as template, design primer carries out PCR amplification, recycles after amplification
And purified pcr product；
S3. target gene band is cut from PCR product, is purified, is obtained GRE2 genetic fragment；
S4. Not I and Xho I double digestion are carried out to GRE2 genetic fragment and pYES2/NTA plasmid, then by GRE2 gene
Segment is connected on pYES2/NTA carrier, obtains new recombinant plasmid pYES2/NTA-GRE2；
S5. recombinant plasmid pYES2/NTA-GRE2 is transformed into saccharomyces cerevisiae, constructs genetic recombination saccharomyces cerevisiae.
Preferably, in the step S2, the primer includes:
Upstream primer are as follows:
TCGCGGCCGCATGACCTCCGTTTTCGTATCAGGTGCCACCGGCTTTAT；Underscore is Not I digestion position
Point；
Downstream primer are as follows:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT；Underscore is Xho I restriction enzyme site.
Preferably, in the step S3, target gene band is cut from PCR product using blade, and molten with buffer
Change, adsorption column absorption, centrifugation, ultrapure water desorption, centrifugation, the GRE2 genetic fragment purified.
Preferably, in the step S4, GRE2 gene is connected to by pYES2/NTA carrier using Gibson connection method
On, obtain new recombinant plasmid.
Preferably, the conversion process of the step S5 includes: that recombinant plasmid is added into the bacteria suspension of saccharomyces cerevisiae
PYES2/NTA-GRE2, ice bath after mixing are transferred in the electric revolving cup being pre-chilled, are shocked by electricity using 1500V, obtain transformant.
Preferably, the step S5 further include: cultivated and extracted by the monoclonal transformant of picking saccharomyces cerevisiae
Plasmid carries out double digestion and gel electrophoresis with plasmid of Not I and Xho the I enzyme to extraction, and whether verifying recombinant plasmid successfully turns
Change into saccharomyces cerevisiae.
The invention further relates to a kind of genetic recombination saccharomyces cerevisiaes with detoxification function in lignocellulose for fermentation ethyl alcohol
In application.
It is demonstrated experimentally that the genetic recombination saccharomyces cerevisiae with detoxification function, using furfural and hydroxymethylfurfural as
Substrate can produce a large amount of aldehyde reductase when carrying out inducing expression as coenzyme using NADPH.Therefore, described with detoxification function
Genetic recombination saccharomyces cerevisiae can will be applied in the production of lignocellulose for fermentation ethanol, not only can the wooden fibre of high-efficiency fermenting
The pretreated material of dimension element produces alcohol fuel, while also with furfural, hydroxymethylfurfural in removal pretreated material etc. to second
The aldehydes organic matter of the toxic effect of alcohol fermentation, to guarantee that cellulose fermentation is more thorough, zymotechnique is more efficient.
(3) beneficial effect
The beneficial effects of the present invention are:
A kind of base with aldehyde restoring function is obtained by being transferred to GRE2 aldehyde reductase gene (1151bp) to saccharomyces cerevisiae
Because of recombinant Saccharomyces cerevisiae, which not only can carry out high-efficiency fermenting to the pretreated material of lignocellulosic and produce fuel
Ethyl alcohol, while the GRE2 gene table in saccharomyces cerevisiae can also be enable under with furfural and hydroxymethylfurfural pressure condition
Up to a large amount of aldehyde reductases are generated, make to generate inhibition or the organic aldehydes quilt such as the furfural poisoned and hydroxymethylfurfural to fermentation process originally
Reduction is converted to other substances (realize detoxification) to fermentation nonhazardous, with guarantee the smooth of ferment cellulose for producing ethanol and
Efficiently carry out.
Detailed description of the invention
Fig. 1 is the agarose gel electrophoresis figure of pichia stipitis genomic DNA；Wherein: M is maker band, and 1,2 are
Pichia stipitis genomic DNA band.
Fig. 2 is the agarose gel electrophoresis figure of GRE2 aldehyde reductase genetic fragment；Wherein: M is maker band, and 1 is GRE2
Gene band.
Fig. 3 is the bacterium solution PCR agar that recombinant plasmid pYES2/NTA-GRE2 has been transformed into Escherichia coli T1 competent cell
Sugared gel electrophoresis figure；Wherein: M is maker band, and 1-5 is GRE2 gene band, illustrates recombinant plasmid pYES2/NTA-GRE2 energy
Enough it is transformed into bacterial host.
Fig. 4 is the double enzymes of transformant extraction plasmid progress that saccharomyces cerevisiae has been transformed into recombinant plasmid pYES2/NTA-GRE2
The agarose gel electrophoresis figure cut；Wherein: M is maker band, and 1-5 is plasmid double digestion band.
Fig. 5 is the saccharomyces cerevisiae that contains GRE2 gene using furfural and hydroxymethylfurfural as substrate, using NADPH as coenzyme
When carrying out inducing expression, the PAGE gel electrophoretogram of GRE2 enzyme (aldehyde reductase)；Wherein: M is maker band, and 1 is gene
The protein band of recombinant Saccharomyces cerevisiae expression.
Specific embodiment
In order to preferably explain the present invention, in order to understand, with reference to the accompanying drawing, by specific embodiment, to this hair
It is bright to be described in detail.
A kind of genetic recombination saccharomyces cerevisiae with detoxification function in order to obtain, can carry out as follows:
(1) pichia stipitis genomic DNA is extracted
Pichia stipitis genomic DNA is extracted using the pastoris genomic dna extracts kit of Suo Laibao company, is extracted
It is verified after the completion with 1% agarose gel electrophoresis, specific steps are as follows:
(1) yeast cells 1-5ml, 12000rpm is taken to be centrifuged 1min, as far as possible absorption supernatant.
(2) 470ul sorbierite Buffer is added into yeast thallus.25ul yeast wall breaking enzyme is added in abundant suspension thalline
With 5ul SH-group reductant, mix well.During which 30 DEG C of processing 1-2h can overturn centrifuge tube and mix for several times.
(3) 12000rpm is centrifuged 1min, abandons supernatant, collects precipitating.
(4) 200ul solution A is added into precipitating, sufficiently suspend precipitating, and the RNaseA of 20ul is added into suspension
(10mg/ml), is sufficiently mixed by inversion, and is placed at room temperature for 10min.
(5) Proteinase K (10mg/ml) of 20ul is added, is sufficiently mixed by inversion.65 DEG C of water-baths digest 15-30min, digestion
Period can overturn centrifuge tube and mix for several times, until treatments of the sample is complete.
(6) 200ul solution B is added, adds 200ul dehydrated alcohol, is sufficiently mixed by inversion, it is at this time it is possible that cotton-shaped
Precipitating, does not influence the extraction of DNA, solution and flocculent deposit can all be added in adsorption column, be placed at room temperature for 2min.
(7) 12000rpm is centrifuged 2min, abandons waste liquid, adsorption column is put into collecting pipe.
(8) 600ul rinsing liquid (please first check whether before use and dehydrated alcohol has been added) is added into adsorption column.
12000rpm is centrifuged 1min, abandons waste liquid, adsorption column is put into collecting pipe.
(9) 600ul rinsing liquid is added into adsorption column, 12000rpm is centrifuged 1min, abandons waste liquid, adsorption column is put into collection
Guan Zhong.
(10) 12000rpm is centrifuged 2min, and adsorption column opening is placed in room temperature or 50 DEG C of incubators are placed several minutes, it is therefore an objective to
By rinsing liquid removal remaining in adsorption column, otherwise the ethyl alcohol in rinsing liquid will affect subsequent experimental such as digestion, PCR etc..
(11) adsorption column is put into a clean centrifuge tube, to the hanging 50-200ul that is added dropwise in adsorbed film center through 65 DEG C
The eluent of water-bath preheating, is placed at room temperature for 5min, and 12000rpm is centrifuged 1min.
(12) centrifugation gained eluent adds in adsorption column, and 12000rpm is centrifuged 2min, and the base of high quality can be obtained
Because of a group DNA.
As shown in Figure 1, the agarose gel electrophoresis figure of pichia stipitis genomic DNA；Wherein: M is maker band,
1,2 be pichia stipitis genomic DNA band.
(2) PCR amplification is carried out by template of Pichia pastoris genomic DNA
Using the pichia stipitis genomic DNA of extraction as template, design primer carries out PCR, solidifying by running 1% agarose
Glue verifying.
Upstream (N-terminal) primer GRE2-F:
TCGCGGCCGC(underscore is Not I digestion position to ATGACCTCCGTTTTCGTATCAGGTGCCACCGGCTTTAT
Point)
Downstream (C-terminal) primer GRE2-R:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT (underscore is Xho I restriction enzyme site)
PCR reaction system: DNA mix 10L, each 0.4 1, DNA template (10ng/L) 0.2 of upstream and downstream primer (10ng/L)
1, DMSO 0.8L, aqua sterilisa 8.2L, total volume 20L.
PCR reaction condition: 95 DEG C of initial denaturation 5min, 95 DEG C of deformation 30s, 50 DEG C of annealing 1min, 72 DEG C of extension 10min are followed
Ring 20 times, 72 DEG C re-extend 20min, 4 DEG C of preservations.PCR product is subjected to 1% agarose electrophoresis after reaction.
As shown in Fig. 2, the agarose gel electrophoresis figure of GRE2 aldehyde reductase genetic fragment；Wherein: M be maker band, 1
For GRE2 gene band.
As shown in Figure 2, there are a specific band, as GRE2 gene (1151bp) piece between 2000bp-1000bp
Fragment position, the GRE2 gene order are following (rear attached sequence table):
(3) PCR product recycles, cuts glue and purifying
PCR product is recycled using NEB company DNA Gel Extraction Kit pillar DNA plastic recovery kit, according to
The mode that Fig. 2 is obtained in step (2) carries out electrophoresis, then cuts glue, concrete operation step are as follows:
(1) PCR product cuts target gene item with blade under ultraviolet light after the separation of 1% agarose gel electrophoresis
Band, then the glue cut is placed in 1.5mL centrifuge tube, its weight is weighed, the Binding Buffer of the weight such as addition is put in 65
It is dissolved completely in DEG C water-bath to glue；
(2) sol solution is all moved in adsorption column, stands 10min, 12000rpm is centrifuged 1min；
(3) liquid in the collecting pipe being centrifuged is moved again in adsorption column, stands 5min, 12000rpm centrifugation
1min outwells the liquid in collecting pipe；
(4) 700L SPW Wash Buffer is added into adsorption column, 12000rpm is centrifuged 1min, outwells liquid in collecting pipe
Adsorption column is put into same collecting pipe by body, and it is primary to repeat this step；
(5) suction attached column is centrifuged 3min in 12000rpm, room temperature dries 15min；
(6) 30L ultrapure water is added into suction attached column, is stored at room temperature 5min, 12000rpm is centrifuged 3min；
(7) solution in centrifuge tube is the aqueous solution of the DNA fragmentation containing templet gene band；
(8) it takes 3L to carry out agarose gel electrophoresis detection, has obvious band in correct position, surplus DNA sample is in -20
DEG C storage.
(4) GRE2 gene, pYES2/NTA plasmid enzyme restriction and construction recombination plasmid
Obtained to PCR amplification GRE2 genetic fragment and pYES2/NTA plasmid (purchased from vast clever plasmid platform, article No.:
P1680 Not I and Xho I double digestion) are carried out, GRE2 gene is then connected to by pYES2/NTA using Gibson connection method
On carrier, new recombinant plasmid pYES2/NTA-GRE2 is obtained.
Double digestion system: Not I and Xho I enzyme each 1.5L, cut smart Buffer 5L, DNA 2g are (according to densimeter
Calculate) water polishing is to 50L, and 37 DEG C, 3h.
Gibson linked system: enzyme 6L, carrier and the total 4L of segment, ratio 1: 3~5,50 DEG C of metal bath, 1h.
(5) recombinant plasmid pYES2/NTA-GRE2 is transformed into Escherichia coli T1
10L connection product in previous step is mixed with the Escherichia coli T1 competent cell of 100L, ice bath 30min, 42
DEG C heat shock 90s, is refitted in 3-5min on ice immediately, adds 800LLB fluid nutrient medium, 37 DEG C of culture 50-60min；It is coated on
LB solid plate (ampicillin containing 10g/mL), 37 DEG C of overnight incubations.
(6) bacterium solution PCR Preliminary Identification
It is robbed after picking transformant monoclonal cultivates 6-8h into LB liquid medium with liquid relief, carries out bacterium solution PCR.
Upstream primer F:5 '-ATGTCAGTTTTCGTTTCAGG-3 '
Downstream primer R:5 '-TTATATTCTGCCCTCAAATT-3 '
Bacterium solution PCR system: enzyme 5L, each 0.5L of upstream and downstream primer, bacterium solution 0.5L, aqua sterilisa 3.5L total volume is 10L.
Bacterium solution PCR process: 94 DEG C of 10min of initial denaturation are denaturalized 94 DEG C of 30s, and anneal 55 DEG C of 30s, extend 72 DEG C of 2min,
Re-extend 72 DEG C of 10min, 30 circulations, 4 DEG C of preservations.PCR product the detection of 1% agarose electrophoresis is carried out after reaction to test
Card, verifies correct bacterium colony.
It is illustrated in figure 3 the bacterium solution that recombinant plasmid pYES2/NTA-GRE2 has been transformed into Escherichia coli T1 competent cell
PCR agarose gel electrophoresis figure；Wherein: M is maker band, and 1-5 is GRE2 gene band.From the figure 3, it may be seen that passing through bacterium solution PCR
Existing GRE2 gene band is verified, illustrates recombinant plasmid successful conversion into Escherichia coli T1 competent cell.
(7) recombinant plasmid dna is sequenced
The bacterium colony PCR transformant for being accredited as positive colony is subjected to 5mLLB liquid tube culture 12-16h, and is sent to and holds up section
Biological (Beijing) limited liability company carries out DNA sequencing；The sequence obtained after sequencing is compared with DNAMAN software to test
Demonstrate,prove the correctness of sequence and the reliability of this method.Sequencing result shows that DNA fragmentation obtained contains aldehyde reductase code area
Gene illustrates construction of recombinant plasmid success.
(8) extraction of pYES2/NTA-GRE2 recombinant plasmid
Plasmid, concrete operation step are extracted using NEB company Plamid Miniprep Kit kit in a small amount are as follows:
(1) will verifying correctly the Escherichia coli T1 containing pYES2/NTA-GRE2 plasmid is inoculated into 5mL and contains ammonia benzyl
In the LB liquid medium of penicillin (100g/mL), shaken cultivation 10h or so；
(2) it takes out bacterium solution to be added in 1.5mL centrifuge tube, room temperature, 12000rpm is centrifuged 1min, abandons supernatant to the greatest extent；
(3) 250L solution I is added, piping and druming mixes；250L solution II is added, gently overturns for several times, mixes up and down, room temperature is quiet
Set 2min；
(4) 350L solution III is added, gently overturns for several times up and down, lysate is made to be uniformly dispersed, room temperature stands 2min, often
Warm 12000rpm is centrifuged 10min；
(5) transfer supernatant stands 5min, room temperature into adsorption column, and 12000rpm is centrifuged 1min, outwells the liquid in collecting pipe
Body；
(6) 700L DNA Wash Buffer is added into adsorption column, room temperature 12000rpm is centrifuged 1min, outwells collecting pipe
In liquid, adsorption column is put into same collecting pipe, repeat this step it is primary；
(7) suction attached column is then centrifuged 2min in 12000rpm, room temperature dries 15min；
(8) 30L ultrapure water is added into suction attached column, is stored at room temperature 5min, 12000rpm is centrifuged 3min；In centrifuge tube
Solution is Plasmid DNA aqueous solution；
(9) it takes 3L to carry out 1% agarose gel electrophoresis detection, occurs obvious band in correct position, by surplus DNA sample
Product are stored in -20 DEG C.
Demonstrating recombinant plasmid pYES2/NTA-GRE2 as a result, has the ability being transformed into host cell.
(9) recombinant plasmid is electroporated into saccharomyces cerevisiae
The saccharomyces cerevisiae starting strain is bacterial strain ZR-1, bacterial strain ZR-1 classification naming are as follows: saccharomyces cerevisiae
(Saccharomyces cerevisiae) was preserved in China Committee for Culture Collection of Microorganisms on 07 08th, 2019
Common micro-organisms center, deposit number are as follows: CGMCC No.18090, preservation address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number.
The method of recombinant plasmid transformed to saccharomyces cerevisiae is as follows:
(1) saccharomyces cerevisiae yeast is inoculated with to 30mL YPD fluid nutrient medium, 30 DEG C of culture 12h；
(2) culture is taken to be transferred in the fresh YPD fluid nutrient medium of 30mL with 1% inoculum concentration, 30 DEG C of culture 8h make bacterium
Body reaches synchronous growth state；
(3) yeast culture is placed in after placing 30min on ice, 6000rpm is centrifuged 5min and collects thallus；
(4) supernatant is abandoned, it is primary that the 15mL milli-Q water thallus being pre-chilled is added；
(5) 6000rpm is centrifuged 5min and collects thallus, three times with 15mL 1mol/L sorbierite repeated washing thallus；
(6) thalline were collected by centrifugation, and 200L 1mol/L sorbierite resuspension thallus is added, takes the bacteria suspension of 200L to 1.5mL
In centrifuge tube；
(7) 20L (≤5g) recombinant plasmid to be transformed is added in bacteria suspension obtained, mixes gently rear ice bath 10min；
(8) bacteria suspension after ice bath is transferred in the electric revolving cup being pre-chilled, 1500V electric shock 5ms；
(9) the 1mol/L sorbierite that appropriate volume is added washes out the bacteria suspension after electricity turn from electric revolving cup, and 200L is taken to apply
The corresponding resistant panel of cloth；
(10) 30 DEG C of cultures select transformant in 3-5 days.
(10) saccharomyces cerevisiae recombinant plasmid is extracted for verifying
Monoclonal transformant in picking (nine) is cultivated, and extracts plasmid, the method is as follows:
(1) 1-5ml yeast culture is taken, 12000rpm is centrifuged 1min, as far as possible absorption supernatant.
(2) 470ul sorbierite Buffer is added into yeast thallus, 25ul yeast wall breaking enzyme is added in abundant suspension thalline
It with 5ul SH-group reductant, mixes well, 30 DEG C of processing 1-2h, during which can overturn centrifuge tube and mix for several times.12000rpm centrifugation
1min abandons supernatant, collects precipitating.250ulYP1 (please first check whether and RNaseA has been added) is added into precipitating, sufficiently suspends
Precipitating.
(3) 250ul YP2 is added into centrifuge tube, leniently spinning upside down 6-8 times cracks thallus sufficiently.
(4) 350ul YP3 is added into centrifuge tube, leniently spins upside down 6-8 times, mixes well immediately, can go out at this time
Existing white flock precipitate.12000rpm is centrifuged 10min, and supernatant is carefully transferred to another clean centrifuge tube with pipettor
In, it tries not that precipitating is sucked out.
(5) supernatant obtained by previous step is added in adsorption column, is placed at room temperature for 2min, 12000rpm is centrifuged 1min, outwells
Waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.
(6) 600ul rinsing liquid (please first check whether before use and dehydrated alcohol has been added) is added into adsorption column,
12000rpm is centrifuged 1min, abandons waste liquid, adsorption column is put into collecting pipe.
(7) 600ul rinsing liquid is added into adsorption column, 12000rpm is centrifuged 1min, abandons waste liquid, adsorption column is put into collection
Guan Zhong.
(8) 12000rpm is centrifuged 2min, and adsorption column opening is placed in room temperature or 50 DEG C of incubators are placed several minutes.
(9) adsorption column is put into a clean centrifuge tube, to the hanging 50-200ul that is added dropwise in adsorbed film center through 65 DEG C
The eluent of water-bath preheating, is placed at room temperature for 2min, and 12000rpm is centrifuged 1min.
(10) in order to increase the recovery efficiency of plasmid, obtained eluent can be rejoined in adsorption column, is placed at room temperature for
2min, 12000rpm are centrifuged 1min.
The double digestion of (11) recombinant plasmid is verified
Double digestion verifying, the verifying of 1% agarose gel electrophoresis are carried out with recombinant plasmid of the NotI and XhoI enzyme to extraction.
Double digestion system: Not I and Xho I enzyme each 1.5L, cut smart Buffer 5L, DNA 2g are (according to densimeter
Calculate) water polishing is to 50L, and 37 DEG C, 3h.Electrophoresis result is as shown in Figure 4.
Fig. 4 is the double enzymes of transformant extraction plasmid progress that saccharomyces cerevisiae has been transformed into recombinant plasmid pYES2/NTA-GRE2
The agarose gel electrophoresis figure cut；Wherein: M is maker band, and 1-5 is plasmid double digestion band.As shown in Figure 4, to extraction
Recombinant plasmid carries out double digestion and simultaneously runs glue (electrophoresis) verifying, and 1-5 has two specific bands, illustrate construction of recombinant plasmid at
Function, and successful conversion has arrived in saccharomyces cerevisiae.
The expression and verifying of GRE2 gene in (12) genetic recombination saccharomyces cerevisiae
Inducing expression is carried out by coenzyme of NADPH as substrate using furfural and hydroxymethylfurfural, and is made with wild-type strain
For control, enzyme activity the result is as follows:
The different mortifiers of table 1. induce lower control strain compared with the GRE2 enzyme activity of recombinant bacterial strain
Fig. 5, which is shown, carries out PAGE gel electrophoresis to the albumen that genetic recombination saccharomyces cerevisiae generates under aforesaid environmental
Experimental result.The molecular size range of GRE2 aldehyde reductase (albumen) is 42kDa.As shown, going out slightly larger than near 40kDa
Now obvious band illustrates have a large amount of GRE2 enzymes to generate, and contained GRE2 gene can good representation in genetic recombination saccharomyces cerevisiae.
Verifying of (13) the genetic recombination saccharomyces cerevisiae to xylose utilization in cellulosic hydrolysate
Using saccharomyces cerevisiae starting strain as control strain, genetic recombination bacterial strain is verified to xylose in dilute acid pretreatment hydrolyzate
Utilization power, it is as a result as follows:
2. control strain of table is compared with recombinant bacterial strain is to xylose utilization situation in hydrolyzate
Claims (10)
1. a kind of genetic recombination saccharomyces cerevisiae with detoxification function, which is characterized in that the genetic recombination saccharomyces cerevisiae contains
Exogenous aldehyde reductase gene, the exogenous aldehyde reductase gene are the aldehyde reductase bases of the sequence as shown in SEQ ID NO:1
Cause.
2. a kind of genetic recombination saccharomyces cerevisiae with detoxification function according to claim 1, which is characterized in that described outer
Property aldehyde reductase gene in source is to carry out PCR amplification by template of pichia stipitis (Pichia stipitis) genomic DNA,
Two restriction enzyme sites of Xho I and NotI are introduced respectively in C-terminal and N-terminal and are obtained simultaneously, and the pichia stipitis has been preserved in
Chinese industrial Microbiological Culture Collection administrative center, number are CICC 1960.
3. a kind of genetic recombination saccharomyces cerevisiae with detoxification function according to claim 1, which is characterized in that wine brewing ferment
Female starting strain is bacterial strain ZR-1, bacterial strain ZR-1 classification naming are as follows: saccharomyces cerevisiae (Saccharomyces cerevisiae), in
It is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number on 07 08th, 2019 are as follows: CGMCC
No.18090, preservation address are as follows: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
4. a kind of genetic recombination saccharomyces cerevisiae with detoxification function according to claim 1, which is characterized in that the tool
The deposit number for having the genetic recombination saccharomyces cerevisiae of detoxification function is CGMCC No.17923；It was preserved on 06 13rd, 2019
China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
No. 3.
5. a kind of construction method of the genetic recombination saccharomyces cerevisiae with detoxification function, which comprises the steps of:
S1. pichia stipitis genomic DNA is extracted；
S2. using the pichia stipitis genomic DNA of extraction as template, design primer carries out PCR amplification, recycles after amplification and pure
Change PCR product；
S3. target gene band is cut from PCR product, is purified, is obtained GRE2 genetic fragment；
S4. NotI and Xho I double digestion is carried out to GRE2 genetic fragment and pYES2/NTA plasmid, then by GRE2 genetic fragment
It is connected on pYES2/NTA plasmid vector, obtains new recombinant plasmid pYES2/NTA-GRE2；
S5. recombinant plasmid pYES2/NTA-GRE2 is transformed into saccharomyces cerevisiae, constructs genetic recombination saccharomyces cerevisiae.
6. construction method according to claim 4, which is characterized in that in the step S2, the primer includes:
Upstream primer are as follows:
TCGCGGCCGCATGACCTCCGTTTTCGTATCAGGTGCCACCGGCT TTAT；Underscore is NotI restriction enzyme site；
Downstream primer are as follows:
TCCTCGAGCCTTGATTCGGCATTTGGACCTAGACCCATTATTTT；
Underscore is XhoI restriction enzyme site.
7. construction method according to claim 4, which is characterized in that in the step S3, using blade from PCR product
Target gene band is cut, and is dissolved with buffer, adsorption column absorption, centrifugation, ultrapure water desorption, centrifugation, is purified
GRE2 genetic fragment.
8. construction method according to claim 4, which is characterized in that in the step S4, using Gibson connection method
GRE2 gene is connected on pYES2/NTA carrier, new recombinant plasmid is obtained.
9. construction method according to claim 4, which is characterized in that the conversion process of the step S5 includes: to wine brewing
Recombinant plasmid pYES2/NTA-GRE2 is added in the bacteria suspension of yeast, ice bath after mixing is transferred in the electric revolving cup being pre-chilled, and is used
1500V electric shock, obtains transformant；
The step S5 further include: plasmid is cultivated and extracted by the monoclonal transformant of picking saccharomyces cerevisiae, with NotI
Double digestion and gel electrophoresis carried out to the plasmid of extraction with Xho I enzyme, whether successful conversion is to saccharomyces cerevisiae for verifying recombinant plasmid
In.
10. a kind of genetic recombination saccharomyces cerevisiae (deposit number CGMCCNo.17923) with detoxification function is in wood fibre
Application in element fermentation ethyl alcohol processed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910681249.6A CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910681249.6A CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110452827A true CN110452827A (en) | 2019-11-15 |
| CN110452827B CN110452827B (en) | 2020-07-31 |
Family
ID=68483545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910681249.6A Active CN110452827B (en) | 2019-07-24 | 2019-07-24 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452827B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101627109A (en) * | 2006-12-01 | 2010-01-13 | 格沃股份有限公司 | Engineered microorganisms for producing n-butanol and related methods |
| CN102639705A (en) * | 2009-12-03 | 2012-08-15 | Bp北美公司 | Methods and apparatuses for producing renewable materials from inhibiting compounds |
| CN105985915A (en) * | 2015-02-09 | 2016-10-05 | 中国农业科学院作物科学研究所 | Saccharomyces cerevisiae recombinant strain for regulating expression activity of GRE3 genes and application of recombinant strain |
| CN107937296A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application |
| CN107937297A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | Mortifier stress tolerance saccharomyces cerevisiae more than one plant and preparation method, application |
| CN108504584A (en) * | 2018-05-24 | 2018-09-07 | 齐鲁工业大学 | A kind of culture medium and application for being suitable for improving co-fermentation of glucose and xylose saccharomyces cerevisiae and being resistant to a variety of pretreatment mortifiers |
| CN109312373A (en) * | 2016-03-09 | 2019-02-05 | 布拉斯肯有限公司 | For producing microorganism and the method for ethylene glycol and C3compounds altogether |
| CN109486693A (en) * | 2018-11-30 | 2019-03-19 | 吉林中粮生化有限公司 | A kind of S. cervisiae and its purposes in alcohol fermentation |
| CN109706089A (en) * | 2019-02-14 | 2019-05-03 | 中国石油化工股份有限公司 | A kind of xylose-fermenting strains being resistant to mortifier and its construction method and application |
-
2019
- 2019-07-24 CN CN201910681249.6A patent/CN110452827B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101627109A (en) * | 2006-12-01 | 2010-01-13 | 格沃股份有限公司 | Engineered microorganisms for producing n-butanol and related methods |
| CN102639705A (en) * | 2009-12-03 | 2012-08-15 | Bp北美公司 | Methods and apparatuses for producing renewable materials from inhibiting compounds |
| CN105985915A (en) * | 2015-02-09 | 2016-10-05 | 中国农业科学院作物科学研究所 | Saccharomyces cerevisiae recombinant strain for regulating expression activity of GRE3 genes and application of recombinant strain |
| CN109312373A (en) * | 2016-03-09 | 2019-02-05 | 布拉斯肯有限公司 | For producing microorganism and the method for ethylene glycol and C3compounds altogether |
| CN107937296A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application |
| CN107937297A (en) * | 2017-11-29 | 2018-04-20 | 大连理工大学 | Mortifier stress tolerance saccharomyces cerevisiae more than one plant and preparation method, application |
| CN108504584A (en) * | 2018-05-24 | 2018-09-07 | 齐鲁工业大学 | A kind of culture medium and application for being suitable for improving co-fermentation of glucose and xylose saccharomyces cerevisiae and being resistant to a variety of pretreatment mortifiers |
| CN109486693A (en) * | 2018-11-30 | 2019-03-19 | 吉林中粮生化有限公司 | A kind of S. cervisiae and its purposes in alcohol fermentation |
| CN109706089A (en) * | 2019-02-14 | 2019-05-03 | 中国石油化工股份有限公司 | A kind of xylose-fermenting strains being resistant to mortifier and its construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110452827B (en) | 2020-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Qian et al. | Ethanol production from dilute-acid softwood hydrolysate by co-culture | |
| Chandel et al. | Bioconversion of pentose sugars into ethanol: a review and future directions | |
| ES2376636T3 (en) | PROCEDURE FOR THE PRODUCTION OF CELLULOSE ENVELOPES, TICAS AND HEMICELLULOL, TICAS USING THE RESIDUES OF DISTILLATION OF ETHANOLIC FERMENTATION OF HYDROLYZED ENZYMIS, TICOS MATERIALS (LIGN) CELLULOSTICS. | |
| Zhu et al. | A comparison of the production of ethanol between simultaneous saccharification and fermentation and separate hydrolysis and fermentation using unpretreated cassava pulp and enzyme cocktail | |
| Hsu et al. | Pretreatment and hydrolysis of cellulosic agricultural wastes with a cellulase-producing Streptomyces for bioethanol production | |
| Abbi et al. | Bioconversion of pentose sugars to ethanol by free and immobilized cells of Candida shehatae (NCL-3501): Fermentation behaviour | |
| Singh et al. | Ethanol production at elevated temperatures and alcohol concentrations: Part II–Use of Kluyveromyces marxianus IMB3 | |
| Khalil et al. | Production of cellulase by Pleurotus ostreatus and Pleurotus sajor-caju in solid state fermentation of lignocellulosic biomass | |
| RU2508403C2 (en) | Method for obtaining alcohol in biorefining context | |
| Asada et al. | Efficient extraction of starch from microalgae using ultrasonic homogenizer and its conversion into ethanol by simultaneous saccharification and fermentation | |
| WO2011125056A1 (en) | Rapid and low cost enzymatic full conversion of lignocellulosic biomass | |
| Chang et al. | Comparison of batch and fed-batch fermentations using corncob hydrolysate for bioethanol production | |
| Tiwari et al. | Bioethanol production from rice bran with optimization of parameters by Bacillus cereus strain McR-3: ‘Fermentation of rice bran for fuel ethanol production’ | |
| Wu et al. | Microbial hydrolysis and fermentation of rice straw for ethanol production | |
| CN101638673A (en) | Method for manufacturing alcohol by utilizing fermentation of plant straws | |
| CN101649331A (en) | Comprehensive treatment method of vinegar residues | |
| EP3307898A1 (en) | Cellulosic biofuel and co-products | |
| CN103374542B (en) | A kind of method improving Clostridium beijerinckii xylose consumption rate | |
| CN102080050B (en) | Trichoderma viride W2 capable of producing thermophilic ethanol-resistant beta-glucosidase and application thereof | |
| CN103459588A (en) | Kluyveromyces yeast mutant and method for producing ethanol using same | |
| CN110452827A (en) | It is a kind of with the genetic recombination saccharomyces cerevisiae and construction method of detoxification function and its application | |
| Gomathi et al. | Production of bio-ethanol from pretreated agricultural byproduct using enzymatic hydrolysis and simultaneous saccharification | |
| Ntaikou et al. | Saccharification of starchy food waste through thermochemical and enzymatic pretreatment, towards enhanced bioethanol production via newly isolated non-conventional yeast strains | |
| Gehlot et al. | In situ distillation strategy to improve the sequential fermentation process using Zymomonas mobilis and Pichia stipitis for bioethanol production from kans grass biomass hydrolysate | |
| CN102030417A (en) | Method for performing hydrolytic treatment on waste liquid during production of biofuel ethanol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200617 Address after: 063000 No. 1, front road, Fengrun District, Hebei, Tangshan City Applicant after: ZHONGRONG TECHNOLOGY Corp.,Ltd. Address before: Seat 008, 19th Floor, 1200 Century Avenue, China (Shanghai) Free Trade Pilot Area, Pudong New Area, Shanghai, 2001 Applicant before: Shanghai Zhongrong Technology Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |