CN103205403A - Method for producing ligninolytic enzymes - Google Patents
Method for producing ligninolytic enzymes Download PDFInfo
- Publication number
- CN103205403A CN103205403A CN 201210498993 CN201210498993A CN103205403A CN 103205403 A CN103205403 A CN 103205403A CN 201210498993 CN201210498993 CN 201210498993 CN 201210498993 A CN201210498993 A CN 201210498993A CN 103205403 A CN103205403 A CN 103205403A
- Authority
- CN
- China
- Prior art keywords
- peroxidase
- laccase
- yeast
- saccharomyces cerevisiae
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for producing ligninolytic enzymes, and belongs to the biotechnical field. The method comprises the following steps: 1, respectively cloning lignin peroxidase, manganese peroxidase and laccase genes from microbes; 2, constructing a Pichia pastoris expression vector containing the expression cassettes of the above three genes, and a Saccharomyces cerevisiae expression vector containing the expression cassettes, and converting the above vectors to corresponding host bacteria to obtain engineering bacteria; and 3, respectively fermenting Pichia pastoris expression engineering bacteria and Saccharomyces cerevisiae engineering bacteria to produce recombinant lignin peroxidase, manganese peroxidase and laccase. The method has the following advantages: engineering bacteria are used to substitute natural bacterial strains to produce the lignin peroxidase, manganese peroxidase and laccase, so the enzyme outputs are improved through increasing the copy numbers of the genes; and the engineering bacteria containing three enzyme gene expression cassettes substitute engineering bacteria containing a single enzyme gene expression cassette to produce single enzymes, so the raw material, the energy consumption and the manpower resource are saved.
Description
Technical field
The invention belongs to biological technical field, relate to the method that microbial engineering bacteria is produced recombinant protein that makes up.Specifically be that using microbe engineering bacteria production reorganization mixes lignin peroxidase, violent peroxidase and laccase.
Background technology
Lignin peroxidase (Lignin Peroxidase, LiP), violent peroxidase (Manganese Peroxidase, MnP) and laccase (Laccase) have the effect of common lignin degrading.
Plant resources is constantly regenerated, and is very abundant.The basal component of plant is Mierocrystalline cellulose, hemicellulose and xylogen.Wherein useful composition is Mierocrystalline cellulose in making biogas and ethanol industry, and taking second place is hemicellulose.The former basal component is glucose, and the latter's basal component is pentose.These sugar all are the materials that is converted into ethanol and biogas.Xylogen is the aromaticity superpolymer that contains oxo phenylpropyl alcohol or derivatives thereof structural unit in a kind of unbodied, molecular structure that extensively is present in the plant materials.It forms fibrous framework, has the effect of strengthening wood fibre.Inlayed by xylogen between the cellulosic molecule, the Mierocrystalline cellulose of being inlayed can not be hydrolyzed.Utilize Mierocrystalline cellulose, must be earlier with the xylogen hydrolysis.Lignin peroxidase, violent peroxidase and laccase have the function of common hydrolytic lignin.Lignin-degrading enzymes not only is applied to the production ethanol of plant material and produces the biogas industry, also is widely used in industries such as paper industry and environment protection.Some natural microorganism has the expression lignin peroxidase, and the ability of violent peroxidase and laccase is to carry out these three kinds of enzymes of fermentative production with natural product bacterial strain on the industrial production at present.But, because the poor growth of natural bacterium producing multi enzyme preparation or (with) the nutritional requirement height, make production cost higher.Current have research to produce this three kinds of enzymes respectively with engineering bacteria, owing to be to use a bacterial strain production a kind of enzyme wherein respectively, producing three kinds of enzymes so then needs three process, makes its production cost too high.
Pichia spp (Pichia pastoris) and yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) all are the host bacterium that is usually used in producing recombinant protein, but respectively have feature.The principal character of pichia spp is the characteristics that the few oneself protein of secretion is conducive to the purifying of expression product, and yeast saccharomyces cerevisiae has facultative aerobic characteristic, is suitable at anaerobism or aerobic environment.
Summary of the invention
The present invention makes up and contains Pichia yeast engineering and the saccharomyces cerevisiae engineered yeast that lignin peroxidase gene expression construct, violent peroxidase and laccase gene are expressed framework; Express Pichia yeast engineering and the saccharomyces cerevisiae engineered yeast production reorganization mixing lignin peroxidase of framework, violent peroxidase and laccase with containing lignin peroxidase gene expression construct, violent peroxidase and laccase gene respectively.
The technical solution adopted in the present invention is:
1. clone gene: from natural product lignin peroxidase, produce violent peroxidase, produce the natural bacterial strain of laccase and clone peroxidase, violent peroxidase and laccase gene.
2. obtain promotor, recombination sequence, signal peptide, Transcription Termination subsequence and the resistant gene sequence of construction of expression vector.
3. make up respectively and contain these three kinds of gene expression constructs (gene expression construct: yeast expression vector promotor-signal peptide-gene-transcription terminator) and yeast saccharomyces cerevisiae expression vector.Promotor on the carrier is the promoter sequence of glyceraldehyde phosphate dehydrogenase gene.Other element also has G418 resistant gene and ampicillin resistance gene sequence on the carrier; The guiding carrier is reconstituted in the homologous sequence of pichia spp genome or genes of brewing yeast group; The intestinal bacteria replication orgin.
4. by the yeast expression vector conversion pichia spp of electric method for transformation with above structure, with the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae of above structure.Screen the recon of high expression level lignin peroxidase, violent peroxidase and laccase respectively as engineering bacteria.
5. the above Pichia yeast engineering that makes up of fermentation and saccharomyces cerevisiae engineered yeast production reorganization mix lignin peroxidase, violent peroxidase and laccase respectively.
The present invention make up advantage applies that the Pichia yeast engineering contain the mould gene expression construct of lignin peroxidase, violent peroxidase and laccase wood and saccharomyces cerevisiae engineered yeast production reorganization mix lignin peroxidase, violent peroxidase and laccase in:
(1) it is mould to replace natural bacterial strain production lignin peroxidase, violent peroxidase and laccase wood with engineering bacteria, by increasing the output that gene copy number improves enzyme.
(2) express the engineering bacteria of framework and replace the engineering bacteria that contains the single enzyme gene and produce enzyme with containing lignin peroxidase, violent peroxidase and laccase gene, produce lignin peroxidase, violent peroxidase and laccase wood mould replacement with three operations simultaneously with a fermentation procedure and produce recombinate lignin peroxidase or peroxidase or laccase suddenly respectively.Starting material, energy consumption and manpower have been saved.
(3) yeast saccharomyces cerevisiae and pichia spp each tool feature aspect the production recombinant protein, the present invention makes up respectively and contains saccharomyces cerevisiae engineered yeast and the Pichia yeast engineering that lignin peroxidase, violent peroxidase and laccase gene are expressed framework, glycan excision enzyme gene expression construct, selects for its recombinase production provides two kinds of bacterial strains.
Embodiment
The invention will be further described to adopt indefiniteness embodiment below.
Embodiment one
1.1 structure cloning vector
By the two strands of two base complementrities of the synthetic intestinal bacteria replication orgin of the dna sequence dna composite formula of specialty, and form sticky end at the two ends of every DNA chain-ordering.Effect by the T4DNA ligase enzyme makes its cyclisation, forms dna cloning vector.With this cloning vector called after PM.
1.2 obtain the dna sequence dna of target gene and construction of expression vector related elements
1.2.1 lignin peroxidase gene and violent peroxidase gene with reverse transcription PCR amplification white-rot fungi
Synthetic following PCR primer:
Primer 1.5 ' TC
GAATTCGCCACCTGTTCCAACGGCAAGACCGTCGGC3 ' [illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2 .5 ' CA
GCGGCCGCCTAAGCACCCGGAGGCGGAGGGATGCGCTG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer 3.5 ' TT
GAATTCGCGGTCTGCCCCGACGGCACCCGCGTCAGCC3 ' [illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 4.5 ' CT
GCGGCCGCCTATGCGGGACCGTTGAACTGGACACCGGG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Using RNA and extract total RNA that test kit extracts the white-rot fungi Pseudomonas, is template with total RNA, uses the reverse transcription of cDNA synthetic agent box and becomes cDNA.Be template with above-mentioned synthetic cDNA, use primer 1 and primer 2 and carry out pcr amplification that the PCR product of acquisition is through sequential analysis and prove the lignin peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides; Be template with above-mentioned synthetic cDNA, use primer 3 and primer 4 and carry out pcr amplification that the PCR product of acquisition is through sequential analysis and prove the violent peroxidase gene sequence of white-rot fungi with the BLAST software analysis that NCBI provides
1.2.2 the laccase gene sequence with the pcr amplification subtilis is synthesized following PCR primer:
Primer 1.5 ' CG
CCTAGGATGACACTTGAAAAATTTGTGGATGCTCTCCC 3 ' [illustrate: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2 .5 ' CA
GCGGCCGCCTATTTATGGGGATCAGTTATA TCCATCGG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Extracting the subtilis genomic dna, is template with the genomic dna, carries out pcr amplification with primer 1 and 2, and the PCR product of acquisition proves subtilis laccase gene sequence through sequential analysis with the BLAST software analysis that NCBI provides.
1.2.3 the glyceraldehyde 3-phosphate dehydrogenase promoter sequence with the pcr amplification pichia spp.
Primer 1:
5’CC
TACGTAGGATCCTTTTTTGTAGAAATGTCTTGG?3’
Primer 2:
5’GG
GCATGCTGTGTTTTGATAGTTGTTC?3’
[illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is wherein arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and primer 2 and carries out pcr amplification, and the PCR product is through sequencing and prove the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides.[illustrate: the pichia spp genome DNA extracting method: the helicase solution (helicase dissolves with the 1mol/L sorbyl alcohol) that the pichia spp cell is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then.]
1.2.4 synthetic alpha factor signal peptide [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
1.2.5 synthetic Transcription Termination subsequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATC GATCC
1.2.6 synthetic following G418 resistant gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
1.2.7 synthetic following ampicillin resistance gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the ampicillin resistance gene sequence]
5’
CCGGTACCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCG?TTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATAAGCTTCC3’
1.2.8 pcr amplification rDNA sequence from the pichia spp genome
Primer 1:
5’CC
GGTACCaggttcacctacggaaaccttg3’
Primer 2:
5’CC
TTCGAAtgtctcaaagattaagccatgc?3’
[illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and primer 2 and carries out pcr amplification, and the PCR product of acquisition proves rDNA sequence in the pichia spp genome through sequential analysis and the BLAST software analysis that provides with NCBI.
1.3 construction of expression vector
1.3.1 express the building process of framework (promotor-signal peptide-gene-Transcription Termination subsequence)
1.3.1.1 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the lignin peroxidase gene order of white-rot fungi and the multiple clone site that the Transcription Termination subsequence is reconstituted in the PM carrier successively of pichia spp.This carrier is called PM1.
1.3.1.2 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the violent peroxidase gene sequence of white-rot fungi and the multiple clone site that the Transcription Termination subsequence is reconstituted in the PM carrier successively of pichia spp.This carrier is called PM2.
1.3.1.3 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the laccase gene sequence of subtilis and the multiple clone site that the Transcription Termination subsequence is reconstituted in the PM carrier successively of pichia spp.This carrier is called PM3.
1.3.1.4 the effect by DNA restriction enzyme and T4DNA ligase enzyme cut the expression framework of PM2 and PM3 carrier, and the expression framework that will downcut is inserted in the multiple clone site of PM1 successively.This carrier is called PM123.
1.3.1.5 the effect by DNA restriction enzyme and T4DNA ligase enzyme is reconstituted in the rDNA sequence of ampicillin resistance gene, G418 gene and pichia spp the multiple clone site of PM123 carrier successively, thereby finishes the structure of expression vector.
1.4 structure Pichia yeast engineering
Calcium chloride method with routine prepares the intestinal bacteria competence, and the carrier DNA of above structure is transformed in intestinal bacteria, extracts plasmid (carrier) DNA.Prepare the pichia spp competence according to ordinary method, the electricity consumption method for transformation transforms pichia spp with the plasmid of above structure, to coat through the pichia spp cell of transformation and contain YPD Agar flat board (2% peptone that G418 concentration is 700 μ g/ml, 1% yeast extract, 2% glucose), cultivated 3 days for 30 ℃.Picking colony increases bacterium on the G418 resistant panel.The pichia spp transformant is carried out shake flask fermentation express, according to the expression of SDS-PAGE electrophoresis initial analysis target protein.With ion-exchange and molecular sieve layer analysis method separation and purification all types of target albumen, then with the target protein of separation and purification with Western blotting verify (explanation. Western blot: entrust 35 aminoacid sequences of the above three kinds of protein sequence C end of the synthetic service company of polypeptide synthetic of specialty, polypeptide that these are synthetic are injected in the antibody of anti-these polypeptide of rabbit preparation respectively and are applied to Western blot) prove that above-described 3 kinds of genes express and be secreted into outside the born of the same parents in pichia spp.Therefrom screening is expressed the high clone of production of enzyme as Pichia yeast engineering.
Mix lignin peroxidase, manganese peroxidase and laccase 1.5 produce reorganization
The Pichia yeast engineering of above structure is inoculated in the YPD liquid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) is cultured to OD
600=1.5 as seed liquor.In capacity is 1 ton fermentor tank, pack into 700 liters of YPD substratum, by inserting 7 liters of seed liquor, in 30 ℃ by stirring and adding air for continuous fermentation 32 hours.The centrifuging and taking fermented liquid supernatant, the lignin peroxidase activity of measuring fermented liquid supernatant is 〉=2000 units/L, the manganese peroxidase enzymic activity is that 〉=1300 units/L and laccase activity are 〉=1400 units/L.
Illustrate: conventional reddish black B measuring method is used in the lignin peroxidase determination of activity, and manganese peroxidase enzymic activity and laccase activity are measured and all adopted conventional methyl catechol measuring method.
Embodiment two
2.1 structure cloning vector
By the two strands of two base complementrities of the synthetic intestinal bacteria replication orgin of the dna sequence dna composite formula of specialty, and form sticky end at the two ends of every DNA chain-ordering.Effect by the T4DNA ligase enzyme makes its cyclisation, forms dna cloning vector.With this cloning vector called after NM.
2.2 obtain the dna sequence dna of target gene and construction of expression vector related elements
2.2.1 lignin peroxidase gene and the synthetic following PCR primer of violent peroxidase gene with reverse transcription PCR amplification white-rot fungi:
Primer 1.5 ' TC
GAATTCGCCACCTGTTCCAACGGCAAGACCGTCGGC3 ' [illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2 .5 ' CA
GCGGCCGCCTAAGCACCCGGAGGCGGAGGGATGCGCTG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Primer 3.5 ' TT
GAATTCGCGGTCTGCCCCGACGGCACCCGCGTCAGCC3 ' [illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 4.5 ' CT
GCGGCCGCCTATGCGGGACCGTTGAACTGGACACCGGG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Using RNA and extract total RNA that test kit extracts the white-rot fungi Pseudomonas, is template with total RNA, uses the reverse transcription of cDNA synthetic agent box and becomes cDNA.Be template with above-mentioned synthetic cDNA, use primer 1 and primer 2 and carry out pcr amplification that the PCR product of acquisition is through sequential analysis and prove the lignin peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides; Be template with above-mentioned synthetic cDNA, use primer 3 and primer 4 and carry out pcr amplification that the PCR product of acquisition is through sequential analysis and prove the violent peroxidase gene sequence of white-rot fungi with the BLAST software analysis that NCBI provides
2.2.2 the laccase gene sequence with the pcr amplification subtilis
Synthetic following PCR primer:
Primer 1.5 ' CG
CCTAGGATGACACTTGAAAAATTTGTGGATGCTCTCCC 3 ' [illustrate: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2 .5 ' CA
GCGGCCGCCTATTTATGGGGATCAGTTATA TCCATCGG 3 ' [illustrate: 10 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (8 bases that underscore is arranged)]
Extracting the subtilis genomic dna, is template with the genomic dna, carries out pcr amplification with primer 1 and 2, and the PCR product of acquisition proves subtilis laccase gene sequence through sequential analysis with the BLAST software analysis that NCBI provides.
2.2.3 the glyceraldehyde 3-phosphate dehydrogenase promoter sequence with the pcr amplification yeast saccharomyces cerevisiae.
Primer 1:
5’CC
TACGTATCGAGTTTATCATTATCAAT?3’
[illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2:
5’GG
GCATGCTCGAAACTAAGTTCTTGGTG?3’
[illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and primer 2 and carries out pcr amplification, and the PCR product is through sequencing and prove the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides.
[illustrate: genes of brewing yeast group DNA extraction method: the helicase solution (helicase dissolves with the 1mol/L sorbyl alcohol) that brewing yeast cell is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then.]
2.2.4 synthetic alpha factor signal peptide [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
2.2.5 synthetic Transcription Termination subsequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTC?ATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAG?ATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATC GATCC
2.2.6 synthetic following G418 resistant gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACC?TGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
2.2.7 synthetic following ampicillin resistance gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the ampicillin resistance gene sequence]
5’
CCGGTACCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT
AAGCTTCC3’
2.2.8 pcr amplification rDNA sequence from the genes of brewing yeast group
Primer 1:
5’CC
GGTACCTGAACTAACACCTTTTGTGG3’
Primer 2:
5’CC
TTCGAAGCTAATACATGCTTAAAATC3’
[illustrate: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and primer 2 and carries out pcr amplification, and the PCR product of acquisition proves rDNA sequence in the genes of brewing yeast group through sequential analysis and the BLAST software analysis that provides with NCBI.
2.3 construction of expression vector
2.3.1 express the building process of framework (promotor-signal peptide-gene-Transcription Termination subsequence)
2.3.1.1 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the lignin peroxidase gene order of white-rot fungi and the multiple clone site that the Transcription Termination subsequence is reconstituted in the NM carrier successively of yeast saccharomyces cerevisiae.This carrier is called NM1.
2.3.1.2 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the violent peroxidase gene sequence of white-rot fungi and the multiple clone site that the Transcription Termination subsequence is reconstituted in the NM carrier successively of yeast saccharomyces cerevisiae.This carrier is called NM2.
2.3.1.3 by the effect of DNA restriction enzyme and T4DNA ligase enzyme, with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the laccase gene sequence of subtilis and the multiple clone site that the Transcription Termination subsequence is reconstituted in the NM carrier successively of yeast saccharomyces cerevisiae.This carrier is called NM3.
2.3.1.4 the effect by DNA restriction enzyme and T4DNA ligase enzyme cut the expression framework of NM2 and NM3 carrier, and the expression framework that will downcut is inserted in the multiple clone site of NM1 successively.This carrier is called NM123.
2.3.1.5 the effect by DNA restriction enzyme and T4DNA ligase enzyme is reconstituted in the rDNA sequence of ampicillin resistance gene, G418 gene and yeast saccharomyces cerevisiae the multiple clone site of NM123 carrier successively, thereby finishes the structure of expression vector.
2.4 structure saccharomyces cerevisiae engineered yeast
Calcium chloride method with routine prepares the intestinal bacteria competence, and the carrier DNA of above structure is transformed in intestinal bacteria, extracts plasmid (carrier) DNA.Prepare the yeast saccharomyces cerevisiae competence according to ordinary method, the electricity consumption method for transformation is with the plasmid transformed saccharomyces cerevisiae of above structure, to coat through the brewing yeast cell of transformation and contain YPD Agar flat board (2% peptone that G418 concentration is 700 μ g/ml, 1% yeast extract, 2% glucose), cultivated 3 days for 30 ℃.Picking colony increases bacterium on the G418 resistant panel.The yeast saccharomyces cerevisiae transformant is carried out shake flask fermentation express, according to the expression of SDS-PAGE electrophoresis initial analysis target protein.With ion-exchange and molecular sieve layer analysis method separation and purification all types of target albumen, then with the target protein of separation and purification with Western blotting verify (explanation. Western blot: entrust 35 aminoacid sequences of the above three kinds of protein sequence C end of the synthetic service company of polypeptide synthetic of specialty, polypeptide that these are synthetic are injected in the antibody of anti-these polypeptide of rabbit preparation respectively and are applied to Western blot) prove that above-described 3 kinds of genes express and be secreted into outside the born of the same parents in yeast saccharomyces cerevisiae.Therefrom screening is expressed the high clone of production of enzyme as the wine brewing engineering bacteria.
Mix lignin peroxidase, manganese peroxidase and laccase 2.5 produce reorganization
The saccharomyces cerevisiae engineered yeast of above structure is inoculated in the YPD liquid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) is cultured to OD600=1.5 as seed liquor.In capacity is 1 ton fermentor tank, pack into 700 liters of YPD substratum, by inserting 7 liters of seed liquor, in 30 ℃ by stirring and adding air for continuous fermentation 32 hours.The centrifuging and taking fermented liquid supernatant, the lignin peroxidase activity of measuring fermented liquid supernatant is 〉=17000 units/L, the manganese peroxidase enzymic activity is that 〉=1200 units/L and laccase activity are 〉=1300 units/L.
Illustrate: conventional reddish black B measuring method is used in the lignin peroxidase determination of activity, and manganese peroxidase enzymic activity and laccase activity are measured and all adopted conventional methyl catechol measuring method.
Claims (2)
1. a method of producing the lignin degrading enzyme is characterized in that, its concrete steps are as follows:
1), the applied molecular biology technology is cloned lignin peroxidase gene, manganese peroxidase gene and laccase gene from microorganism;
2), make up yeast expression vector and the yeast saccharomyces cerevisiae expression vector of the expression framework that contains said gene respectively;
3), the yeast expression vector of above-mentioned structure transformed pichia spp obtain the pichia spp recon, the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae of above-mentioned structure is obtained the yeast saccharomyces cerevisiae recon;
4), the pichia spp recon of the above-described lignin peroxidase of screening high expression level, manganese peroxidase and laccase is as Pichia yeast engineering; The yeast saccharomyces cerevisiae recon of the above-described lignin peroxidase of screening high expression level, manganese peroxidase and laccase is as saccharomyces cerevisiae engineered yeast;
5), ferment respectively above-described Pichia yeast engineering and saccharomyces cerevisiae engineered yeast produced lignin peroxidase, manganese peroxidase and laccase.
2. according to the described a kind of method for preparing the microbial inoculum of the xylogen that decomposes plant of claim 1, it is characterized in that: utilize the described production method of claim 1 to prepare lignin peroxidase, manganese peroxidase and laccase product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210498993 CN103205403A (en) | 2012-11-18 | 2012-11-18 | Method for producing ligninolytic enzymes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210498993 CN103205403A (en) | 2012-11-18 | 2012-11-18 | Method for producing ligninolytic enzymes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103205403A true CN103205403A (en) | 2013-07-17 |
Family
ID=48752810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210498993 Pending CN103205403A (en) | 2012-11-18 | 2012-11-18 | Method for producing ligninolytic enzymes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103205403A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540573A (en) * | 2013-10-19 | 2014-01-29 | 沅江浣溪沙酶技术有限公司 | Ligninase and production method thereof |
| CN104232555A (en) * | 2014-09-12 | 2014-12-24 | 上海交通大学 | Engineering bacteria based on manganese peroxidase and implementation method of engineering bacteria |
| CN106591350A (en) * | 2016-12-20 | 2017-04-26 | 广州格拉姆生物科技有限公司 | Multifunctional brewer's yeast capable of degrading cellulose, producing cello-oligosaccharide and secreting antimicrobial peptides |
-
2012
- 2012-11-18 CN CN 201210498993 patent/CN103205403A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540573A (en) * | 2013-10-19 | 2014-01-29 | 沅江浣溪沙酶技术有限公司 | Ligninase and production method thereof |
| CN103540573B (en) * | 2013-10-19 | 2015-10-07 | 沅江浣溪沙酶技术有限公司 | A kind of lignoenzyme and production method |
| CN104232555A (en) * | 2014-09-12 | 2014-12-24 | 上海交通大学 | Engineering bacteria based on manganese peroxidase and implementation method of engineering bacteria |
| CN106591350A (en) * | 2016-12-20 | 2017-04-26 | 广州格拉姆生物科技有限公司 | Multifunctional brewer's yeast capable of degrading cellulose, producing cello-oligosaccharide and secreting antimicrobial peptides |
| CN106591350B (en) * | 2016-12-20 | 2018-06-05 | 广州格拉姆生物科技有限公司 | A kind of energy degraded cellulose production prebiotic fiber oligosaccharides simultaneously secretes the multi-function brewing yeast of antibacterial peptide |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104651383A (en) | Recombinant pichia pastoris engineering bacteria and production method thereof | |
| MX2014000665A (en) | Method for the production of cellulases by a filamentous fungus adapted to a fermenter having a low volumetric oxygen transfer coefficient kla. | |
| CN102234639A (en) | Method for the production of cellulases based on the regulation of the oscillation of the pression of the oxygen disolved in the culture medium | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN101531988B (en) | Alkaline pectinase genetic engineering bacteria and construction method thereof | |
| CN110713996B (en) | Trehalase, and carrier and application thereof | |
| CN109321586A (en) | Recombinant Aspergillus niger Glucose Oxidase optimization gene and its expression vector and application | |
| US20170349888A1 (en) | Process for the production of cellulolytic and/or hemicellulolytic enzymes | |
| CN104480083A (en) | Lipase, engineering bacterium and preparing methods of the lipase and the engineering bacterium | |
| CN101260379B (en) | Gene engineering bacterium for producing 1,3-propanediol and its preparation method and application | |
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN103205403A (en) | Method for producing ligninolytic enzymes | |
| CN104073448A (en) | yeast capable of producing lactic acid by using pentose and hexose | |
| CN105838728B (en) | Polygalacturonase optimization gene and its expression vector and application | |
| US9249402B2 (en) | Process for the continuous production of cellulases by a filamentous fungus using a carbon substrate obtained from an acid pretreatment | |
| CN108753741B (en) | Extracellular AA9 family polysaccharide monooxygenase AnLPMO15g and application thereof | |
| CN104789586A (en) | Escherichia coli genome integration vector, genetically engineered bacterium and application of genetically engineered bacterium to xylitol production | |
| CN103233382A (en) | Method for degrading plant lignin by using pichia pastoris engineered bacteria | |
| CN108865914B (en) | Recombinant saccharomyces cerevisiae strain capable of degrading lignocellulose and application thereof | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN102168059B (en) | Method for efficiently preparing beta-glucanase | |
| JP5469092B2 (en) | Clostridium sartagoformum for the production of biogas | |
| CN103088434B (en) | Construction method and application of Pichia stipitis large-fragment DNA (deoxyribonucleic acid) genome library | |
| CN103233025A (en) | Method for combined degradation of plant lignin by using pichia pastoris engineered bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130717 |