CN103233382A - Method for degrading plant lignin by using pichia pastoris engineered bacteria - Google Patents
Method for degrading plant lignin by using pichia pastoris engineered bacteria Download PDFInfo
- Publication number
- CN103233382A CN103233382A CN 201310134638 CN201310134638A CN103233382A CN 103233382 A CN103233382 A CN 103233382A CN 201310134638 CN201310134638 CN 201310134638 CN 201310134638 A CN201310134638 A CN 201310134638A CN 103233382 A CN103233382 A CN 103233382A
- Authority
- CN
- China
- Prior art keywords
- lignin
- pichia pastoris
- gene
- laccase
- peroxidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a method for degrading plant lignin by using pichia pastoris engineered bacteria. The invention belongs to the technical field of biology. According to the invention, lignin peroxidase gene, manganese peroxidase gene, and laccase gene are cloned from microbes; pichia pastoris expression vectors comprising the three gene expression frameworks are established; the pichia pastoris expression vectors are used for converting pichia pastoris; screening is carried out by using G418 resistance, such that pichia pastoris engineered bacteria comprising a manganese peroxidase gene expression framework, pichia pastoris engineered bacteria comprising a lignin peroxidase gene expression framework, and pichia pastoris engineered bacteria comprising a laccase gene expression framework are obtained; and the three pichia pastoris engineered bacteria subjected to a reaction with a plant raw material, such that plant lignin is degraded. The method provided by the invention has the advantages that: the degradation effect of the three pichia pastoris engineered bacteria is higher than that of natural microbes expressing and secreting manganese peroxidase, lignin peroxidase, and laccase currently applied in plant lignin degradation.
Description
Technical field
The invention belongs to biological technical field, relate to the method for structure and using microbe engineering bacteria.It specifically is the method for the lignin of using microbe engineering bacteria degrade plant material.
Background technology
Manganese peroxidase (Manganese Peroxidase, MnP), lignin peroxidase (Lignin Peroxidase, LiP) and laccase (Laccase) have the effect of common lignin degrading.
Plant resources is constantly regenerated, and is very abundant.The basis of plant is cellulose, hemicellulose and lignin.Wherein useful composition is cellulose in making biogas and ethanol industry, and taking second place is hemicellulose.The former is made of glucose, and the latter is made of pentose.These sugar all are the materials that is converted into ethanol and biogas.But inlayed by lignin between the cellulosic molecule, the cellulose of being inlayed can not be hydrolyzed.Lignin is the armaticity high polymer that contains oxo phenylpropanol or derivatives thereof construction unit in unbodied, the molecular structure that extensively is present in the plant, forms fibrous framework, and structure is very stable.Desire is utilized then necessary first lignin degrading of cellulose.Current method for lignin degrading has physics, chemistry and biological method.The physics method mainly is mechanical crushing method, high temperature pyrolysis preliminary treatment and radiation preliminary treatment etc., but the power consumption of physics method is big, and needs special installation; Chemical method mainly is the method for acid or alkali treatment.It is simple that method of chemical treatment has technology
Characteristics, but the cellulose after handling and hemicellulose loss are big, and produce a large amount of soda acid Litter contaminated environment.Compare with the physics method with chemical method, the bioanalysis of current application mainly is to use the white-rot fungi of enzyme of natural expression-secretion lignin degrading and plant material effect and lignin in the degrade plant material.The advantage of using the lignin of white rot fungus degrading plant is, white-rot fungi has the enzyme system (manganese peroxidase, lignin peroxidase and laccase) of complete lignin degrading, its weak point is just single copy of the contained manganese peroxidase gene of white-rot fungi, lignin peroxidase gene and laccase gene, the output of the enzyme of expressing is few, and, the white-rot fungi poor growth, the cycle of lignin degrading is long.
Pichia pastoris (Pichia pastoris) is the microorganism that is usually used in producing recombinant protein.The Pichia pastoris nutritional requirement is low, expressed proteins can be secreted into outside the born of the same parents, and it has the composing type strong promoter: glyceraldehyde 3-phosphate dehydrogenase promoter (pGAP).
Summary of the invention
The present invention makes up and contains the Pichia yeast engineering that manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene are expressed framework; Express Pichia yeast engineering and the plant material effect of framework with containing manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene, the lignin of degrade plant material by engineering bacteria secretion manganese peroxidase, lignin peroxidase and laccase.
The technical solution adopted in the present invention is:
1. clone gene: from the microorganism that contains manganese peroxidase gene, lignin peroxidase gene, laccase gene, clone manganese peroxidase gene, lignin peroxidase gene and laccase gene respectively by reverse transcription PCR or round pcr.
2. synthesize by pcr amplification or dna sequence dna and obtain the required promoter of construction of expression vector, recombination sequence, signal peptide, the dna sequence dna of transcription terminator and resistant gene expression framework.
3. make up by Protocols in Molecular Biology and contain the yeast expression vector (accompanying drawing 1) that manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene are expressed framework.
4. the yeast expression vector with above structure transforms Pichia pastoris.Express the Pichia yeast engineering of framework according to the high copy of the G418 resistance screening on expression vector recon as containing manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene.
5. contain manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and the laccase gene of above structure are expressed the lignin that the framework Pichia yeast engineering is applied to degrading plant.
The present invention has made up and has contained the Pichia yeast engineering that manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene are expressed framework, with this Pichia yeast engineering and plant material effect, the advantage applies of the lignin of degrading plant in:
Because the structure of engineering bacteria has been selected strong promoter regulation gene, the object that the microorganism that production performance is good makes up as engineering bacteria, and select the recon of high copy as engineering bacteria, so, the present invention makes up contains the manganese peroxidase gene expression construct, the nutritional requirement that the Pichia yeast engineering of lignin peroxidase gene expression construct and laccase gene expression framework not only possesses Pichia pastoris itself is low, characteristics such as growth and breeding is rapid, enzyme system (the manganese peroxidase that also possesses the good representation secretion lignin degrading of engineering bacteria, lignin peroxidase and laccase) function, this manganese peroxidase gene expression construct that contains, the Pichia yeast engineering of lignin peroxidase gene expression construct and laccase gene expression framework is better than the natural expression-secretion lignin peroxidase of the lignin that is currently applied to degrading plant to the degradation of lignin, the natural microorganism of manganese peroxidase and laccase.
Description of drawings
Accompanying drawing 1. yeast expression vectors.
P. the glyceraldehyde 3-phosphate dehydrogenase promoter of Pichia pastoris; The S.MF alpha factor signal peptide; Genel. manganese peroxidase gene; Gene2. lignin peroxidase gene; Gene3. laccase gene; T. tanscription termination subsequence; The G418.G418 gene expression construct; ColE1. Escherichia coli origin of replication; AMP. ampicillin gene expression construct; The rDNA sequence of P.pastoris rDNA. Pichia pastoris.
The Pichia yeast engineering that accompanying drawing 2. ESEMs are clapped and the photo of the rice straw of rice straw effect after 4 days.
The white-rot fungi that contains manganese peroxidase gene, lignin peroxidase gene and laccase gene that accompanying drawing 3. ESEMs are clapped and the photo of the rice straw of rice straw effect after 4 days.
The ammoniacal liquor that accompanying drawing 4. ESEMs are clapped and the photo of the rice straw of rice straw effect after 4 days.
The Pichia pastoris that accompanying drawing 5. ESEMs are clapped and the photo of the rice straw of rice straw effect after 4 days.
The photo of the rice straw that accompanying drawing 6. ESEMs are clapped.
The specific embodiment
The invention will be further described to adopt indefiniteness embodiment below.
Embodiment one
1.1 obtain enzyme gene and the required relevant original paper of construction of expression vector
(1) promoter sequence of the glyceraldehyde phosphate dehydrogenation of pcr amplification Pichia pastoris
With the cell membrane of glusulase cracking Pichia pastoris, extract the Pichia pastoris genomic DNA, use upstream primer (5 ' TT
TACGTAGGATCCTTTTTTGTAGAAATGT3 ') and downstream primer (5 ' GG
GCATGCTGTGTTTTGATAGTTGTT3 ') carry out pcr amplification, the PCR product is through sequencing and prove the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides.
(2) laccase gene of pcr amplification bacillus subtilis
With the cell membrane of glusulase cracking bacillus subtilis, extract the bacillus subtilis genomic DNA, use upstream primer (5 ' AA
CCTAGGATGACACTTGAAAAATTTGTGGATGC3 ') and downstream primer (5 ' AA
GCGGCCGCCTATTTATGGGGATCAGTTATA3 ') carry out pcr amplification, the PCR product is through sequencing and prove the laccase gene sequence of bacillus subtilis with the BLAST software analysis that NCBI provides.
(3) lignin peroxidase gene and the manganese peroxidase gene of application reverse transcription PCR amplification white-rot fungi
Using RNA and extract total RNA that kit extracts white-rot fungi (white-rot fungi type culture-Phanerochaete chrysosporium), is template with total RNA, uses the reverse transcription of cDNA synthetic agent box and becomes cDNA.Be template with above-mentioned synthetic cDNA, use primer 1 (5 ' AA
GAATTCGCCACCTGTTCCAACGGCAAGACCGTC3 ') and primer 2 (5 ' AA
GCGGCCGCCTAAGCACCCGGAGGCGGAGGGATGCG3 ') carry out pcr amplification, the PCR product of acquisition is through sequence analysis and prove the lignin peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides; Be template with above-mentioned synthetic cDNA, use primer 3 (5 ' CC
GAATTCGCGGTCTGCCCCGACGGCACCCGCGTCA3 ') and primer 4 (5 ' TT
GCGGCCGCCTATGCGGGACCGTTGAACTGGACACC3 ') carry out pcr amplification, the PCR product of acquisition is through sequence analysis and prove the manganese peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides
(4) the rDNA sequence of application pcr amplification Pichia pastoris
Extracting the Pichia pastoris genomic DNA, is template with the genomic DNA, uses upstream primer (5 ' CC
GGTACCAggttcacctacggaaaccttg3 ') and downstream primer (5 ' CC
TTCGAATgtctcaaagattaagccatgc3 ') carry out pcr amplification, the PCR product of acquisition proves rDNA sequence in the Pichia pastoris genome through sequence analysis and the BLAST software analysis that provides with NCBI.
Illustrate:
1. Pichia pastoris and bacillus subtilis genome DNA extracting method: the glusulase solution (glusulase with the dissolving of 1mol/L sorbierite) that bacterial cell is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic DNA according to the bacterial genomes DNA extracting method of routine then.
2. 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged).
(5) synthetic following ampicillin resistance gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the ampicillin resistance gene sequence]
5’AA
GGTACCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT?AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTG?CAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAG?GGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAG?CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTG?TCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC?CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGC?AGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTT?TCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG?CCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAAC?GTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGT?GCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGC?AAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT
AAGCTTGG3’
(6) synthetic following G418 resistant gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
CC
ATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATAC?CATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTAT?CGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAA?ATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGC?CATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACG?CGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATT?TTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCAT?CAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTA?ACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGT?CGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCC?TCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCAA
7. synthetic MF alpha factor signal peptide [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
TT
GCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACT?ACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGC?TGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAG?AAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTGG
8. synthetic tanscription termination subsequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the tanscription termination subsequence]:
TT
ACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTA?GATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTT?TATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATC?AGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTT?CTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATC?
GATGG
1.2 structure yeast expression vector
(1) forms cohesive end by the two strands of two base complementrities of the synthetic Escherichia coli origin of replication of the dna sequence dna composite formula of specialty, and at the two ends of every DNA chain-ordering.Effect by the T4DNA ligase makes its cyclisation, forms dna cloning vector.With this cloning vector called after PD.
(2) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the manganese peroxidase gene order of white-rot fungi and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD1.
(3) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the lignin peroxidase gene order of white-rot fungi and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD2.
(4) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the laccase gene sequence of bacillus subtilis and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD3.
(5) by the effect of DNA restriction enzyme and T4DNA ligase, cut the expression framework of PD2 and PD3 carrier, and the expression framework that will downcut is inserted in the MCS of PD1 successively.This carrier is called PD123.
(6) effect by DNA restriction enzyme and T4DNA ligase is reconstituted in the rDNA sequence of ampicillin gene expression construct, G418 gene expression construct and Pichia pastoris the MCS of PD123 carrier successively, thereby finishes the structure (accompanying drawing 1) of expression vector.
1.3 structure Pichia yeast engineering
Calcium chloride method with routine prepares the Escherichia coli competence, and the expression vector (accompanying drawing 1) of above structure is transformed in Escherichia coli, extracts plasmid (carrier) DNA.Prepare the Pichia pastoris competence according to conventional method, electric method for transformation with routine transforms Pichia pastoris with its expression vector (accompanying drawing 1) respectively, to coat through the Pichia pastoris cell of transformation and contain YPD Agr (2% peptone that G418 concentration is 5000 μ g/ml, 1% yeast extract, 2% glucose, 1.5% agar powder) flat board was cultivated 3 days for 30 ℃.To be that clone's transferred species that the YPD Agr flat board of 700 μ g/ml is grown is on the YPD Agr flat board of 20000 μ g/ml in G418 concentration containing G418 concentration, cultivate 3 days for 30 ℃.Selecting to be that clone that the YPD Agr flat board of 20000 μ g/ml is grown carries out shake flask fermentation and expresses in G418 concentration, according to the expression of SDS-PAGE electrophoresis initial analysis target protein.With ion-exchange and molecular sieve layer analysis method separation and purification all types of target albumen, then with the target protein of separation and purification with Western blotting verify (explanation. Western blot: the synthetic service company of polypeptide that entrusts specialty is 35 amino acid sequences of synthetic above-described manganese peroxidase, lignin peroxidase and laccase protein sequence C end respectively, and polypeptide that these are synthetic are injected in the antibody of anti-these polypeptide of rabbit preparation respectively and are applied to Western blot) prove that above-described 3 kinds of genes express and be secreted into outside the born of the same parents in Pichia pastoris.Carry out enzyme assay with conventional method, the result proof reorganization laccase of expression-secretion in Pichia pastoris has laccase activity, in Pichia pastoris the reorganization lignin peroxidase of expression-secretion have lignin peroxidase active and in Pichia pastoris the reorganization manganese peroxidase of expression-secretion have the manganese peroxidase enzymatic activity.Select the recon of high G418 resistance as Pichia yeast engineering.
1.4 use the effect of Pichia yeast engineering and plant, the lignin of degrading plant
(1) Pichia yeast engineering is inoculated in the YPD fluid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) and is cultured to OD
600=6, to get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in the rice straw of pulverizing, mixing was placed 4 days in 30 ℃.Measuring its content through the rice straw residual lignin of Pichia yeast engineering effect with the sulfuric acid process of routine is 4.0%.
(2) the white-rot fungi type culture-Phanerochaete chrysosporium that will have a preliminary treatment that is applied to plant material fermentation methane and ethanol usually (lignin degrading) of expression-secretion manganese peroxidase, lignin peroxidase and laccase is inoculated in the potato culture (20% potato, 2% glucose) and is cultured to OD
600=6, get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in the rice straw of pulverizing, mixing, in 30 ℃ of placements 4 days, measuring its content through the rice straw residual lignin of white-rot fungi effect with conventional sulfuric acid process was 9.8%.
(3) Pichia pastoris is inoculated in the YPD fluid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) and is cultured to OD
600=6, to get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in the rice straw of pulverizing, mixing was placed 4 days in 30 ℃.The content of measuring through the residual lignin of the rice straw of Pichia pastoris effect with the sulfuric acid process of routine is 14.7%.
(4) with rice straw and the 3400mL5% ammoniacal liquor mixing of 2600g through pulverizing, in 30 ℃ of placements 4 days, measuring its content through the rice straw residual lignin of ammoniacal liquor effect with conventional sulfuric acid process was 10.1%.
(5) content of measuring the lignin of natural rice straw with conventional sulfuric acid process is 15.1%
Results of statistical analysis shows, the effect of the lignin of Pichia yeast engineering degrading plant extremely significantly is better than Pichia pastoris (P＜0.001), extremely significantly is better than white-rot fungi (P＜0.001) and extremely significantly be better than the effect of lignin of the degrading plant of ammoniacal liquor (P＜0.001).
Embodiment two
2.1 obtain enzyme gene and the required relevant original paper of construction of expression vector
(1) promoter sequence of the glyceraldehyde phosphate dehydrogenation of pcr amplification Pichia pastoris
With the cell membrane of glusulase cracking Pichia pastoris, extract the Pichia pastoris genomic DNA, use upstream primer (5 ' TT
TACGTAGGATCCTTTTTTGTAGAAATGT3 ') and downstream primer (5 ' GG
GCATGCTGTGTTTTGATAGTTGTT3 ') carry out pcr amplification, the PCR product is through sequencing and prove the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene with the BLAST software analysis that NCBI provides.
(2) laccase gene of pcr amplification bacillus subtilis
With the cell membrane of glusulase cracking bacillus subtilis, extract the bacillus subtilis genomic DNA, use upstream primer (5 ' AA
CCTAGGATGACACTTGAAAAATTTGTGGATGC3 ') and downstream primer (5 ' AA
GCGGCCGCCTATTTATGGGGATCAGTTATA3 ') carry out pcr amplification, the PCR product is through sequencing and prove the laccase gene sequence of bacillus subtilis with the BLAST software analysis that NCBI provides.
(3) lignin peroxidase gene and the manganese peroxidase gene of application reverse transcription PCR amplification white-rot fungi
Using RNA and extract total RNA that kit extracts white-rot fungi bacterium (white-rot fungi type culture-Phanerochaete chrysosporium), is template with total RNA, uses the reverse transcription of cDNA synthetic agent box and becomes cDNA.Be template with above-mentioned synthetic cDNA, use primer 1 (5 ' AA
GAATTCGCCACCTGTTCCAACGGCAAGACCGTC3 ') and primer 2 (5 ' AA
GCGGCCGCCTAAGCACCCGGAGGCGGAGGGATGCG3 ') carrying out pcr amplification. the PCR product of acquisition is through sequence analysis and prove the lignin peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides; Be template with above-mentioned synthetic cDNA, use primer 3 (5 ' CC
GAATTCGCGGTCTGCCCCGACGGCACCCGCGTCA3 ') and primer 4 (5 ' TT
GCGGCCGCCTATGCGGGACCGTTGAACTGGACACC3 ') carry out pcr amplification, the PCR product of acquisition is through sequence analysis and prove the manganese peroxidase gene order of white-rot fungi with the BLAST software analysis that NCBI provides
(4) the rDNA sequence of application pcr amplification Pichia pastoris
Extracting the Pichia pastoris genomic DNA, is template with the genomic DNA, uses upstream primer (5 ' CC
GGTACCAggttcacctacggaaaccttg3 ') and downstream primer (5 ' CC
TTCGAATgtctcaaagattaagccatgc3 ') carry out pcr amplification, the PCR product of acquisition proves rDNA sequence in the Pichia pastoris genome through sequence analysis and the BLAST software analysis that provides with NCBI.
Illustrate:
1. Pichia pastoris and bacillus subtilis genome DNA extracting method: the glusulase solution (glusulase with the dissolving of 1mol/L sorbierite) that bacterial cell is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic DNA according to the bacterial genomes DNA extracting method of routine then.
2. 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged).
(5) synthetic following ampicillin resistance gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the ampicillin resistance gene sequence]
5’AA
GGTACCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT?AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTG?CAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAG?GGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAG?CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTG?TCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC?CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGT℃AGAAGTAAGTTGGCCGC?AGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTT?TCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG?CCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAAC?GTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGT?GCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGC?AAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT
AAGCTTGG3’
(6) synthetic following G418 resistant gene sequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
CC
ATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATAC?CATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTAT?CGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAA?ATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGC?CATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACG?CGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATT?TTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCAT?CAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTA?ACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGT?CGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCC?TCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCAA
7. synthetic MF alpha factor signal peptide [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
TT
GCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACT?ACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGC?TGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAG?AAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTGG
8. synthetic tanscription termination subsequence [what following sequence had underscore is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the tanscription termination subsequence]:
TT
ACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTA?GATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTT?TATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATC?AGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTT?CTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATC?
GATGG
2.2 structure yeast expression vector
(1) forms cohesive end by the two strands of two base complementrities of the synthetic Escherichia coli origin of replication of the dna sequence dna composite formula of specialty, and at the two ends of every DNA chain-ordering.Effect by the T4DNA ligase makes its cyclisation, forms dna cloning vector.With this cloning vector called after PD.
(2) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the manganese peroxidase gene order of white-rot fungi and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD1.
(3) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the lignin peroxidase gene order of white-rot fungi and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD2.
(4) effect by DNA restriction enzyme and T4DNA ligase is with glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence, alpha factor signal peptide dna sequence dna, the laccase gene sequence of bacillus subtilis and the MCS that the tanscription termination subsequence is reconstituted in the PD carrier successively of Pichia pastoris.This carrier is called PD3.
(5) by the effect of DNA restriction enzyme and T4DNA ligase, cut the expression framework of PD2 and PD3 carrier, and the expression framework that will downcut is inserted in the MCS of PD1 successively.This carrier is called PD123.
(6) effect by DNA restriction enzyme and T4DNA ligase is reconstituted in the rDNA sequence of ampicillin gene expression construct, G418 gene expression construct and Pichia pastoris the MCS of PD123 carrier successively, thereby finishes the structure (accompanying drawing 1) of expression vector.
2.3 structure Pichia yeast engineering
Calcium chloride method with routine prepares the Escherichia coli competence, and the expression vector (accompanying drawing 1) of above structure is transformed in Escherichia coli, extracts plasmid (carrier) DNA.Prepare the Pichia pastoris competence according to conventional method, electric method for transformation with routine transforms Pichia pastoris with its expression vector (accompanying drawing 1) respectively, to coat through the Pichia pastoris cell of transformation and contain YPD Agr flat board (2% peptone that G418 concentration is 5000 μ g/ml, 1% yeast extract, 2% glucose), cultivated 3 days for 30 ℃.To be that clone's transferred species that the YPD Agr flat board of 700 μ g/ml is grown is on the YPD Agr flat board of 20000 μ g/ml in G418 concentration containing G418 concentration, cultivate 3 days for 30 ℃.Selecting to be that clone that the YPD Agr flat board of 20000 μ g/ml is grown carries out shake flask fermentation and expresses in G418 concentration, according to the expression of SDS-PAGE electrophoresis initial analysis target protein.With ion-exchange and molecular sieve layer analysis method separation and purification all types of target albumen, then with the target protein of separation and purification with Western blotting verify (explanation. Western blot: the synthetic service company of polypeptide that entrusts specialty is 35 amino acid sequences of synthetic above-described manganese peroxidase, lignin peroxidase and laccase protein sequence C end respectively, and polypeptide that these are synthetic are injected in the antibody of anti-these polypeptide of rabbit preparation respectively and are applied to Western blot) prove that above-described 3 kinds of genes express and be secreted into outside the born of the same parents in Pichia pastoris.Carry out enzyme assay with conventional method, the result proof reorganization laccase of expression-secretion in Pichia pastoris has laccase activity, in Pichia pastoris the reorganization lignin peroxidase of expression-secretion have lignin peroxidase active and in Pichia pastoris the reorganization manganese peroxidase of expression-secretion have the manganese peroxidase enzymatic activity.Select the recon of high G418 resistance as Pichia yeast engineering.
2.4 use the effect of Pichia yeast engineering and plant, the lignin of degrading plant
(1) Pichia yeast engineering is inoculated in the YPD fluid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) and is cultured to OD
600=6, to get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in the rice straw of pulverizing, mixing in 30 ℃ of placements 4 days, proves only residual a small amount of lignin (accompanying drawing 2) of the cell membrane of rice straw with scanning electron microscopic observation.
(2) will have white-rot fungi type culture-Phanerochaete chrysosporium secreting, expressing laccase, lignin peroxidase and manganese peroxidase, that be applied to the preliminary treatment (lignin degrading) of plant material fermentation methane and ethanol usually is inoculated in the potato culture (20% potato, 2% glucose) and is cultured to OD
600=6, get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in the rice straw of pulverizing, mixing was placed 4 days in 30 ℃, with the amount of the cell membrane residual lignin of scanning electron microscopic observation proof rice straw obviously more than the rice straw of handling with the Pichia yeast engineering that mixes (accompanying drawing 3).
(3) Pichia pastoris is inoculated in the sub-YPD fluid nutrient medium (2% peptone, 1% yeast extract, 2% glucose) and be cultured to OD
600=6, to get 1000mL bacterium liquid and be inoculated in 5000 grams (weight in wet base) through in rice straw of pulverizing, mixing was placed 4 days in 30 ℃, and is complete with the cell wall structure of scanning electron microscopic observation proof rice straw, lignin be not degraded (accompanying drawing 4).
(4) with rice straw and the 3400mL5% ammoniacal liquor mixing of 2600g through pulverizing, in 30 ℃ of placements 4 days, with the residual a large amount of lignin of cell wall structure (accompanying drawing 5) of scanning electron microscopic observation proof rice straw.
(5) with the structural integrity of the natural rice straw of scanning electron microscopic observation proof, lignin be not degraded (accompanying drawing 6).
Claims (2)
1. the method with the lignin of Pichia yeast engineering degrading plant is characterized in that: clone manganese peroxidase gene, lignin peroxidase gene and laccase gene by Protocols in Molecular Biology from microorganism; Structure contains the yeast expression vector that manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene are expressed framework; The yeast expression vector of above-mentioned structure is transformed Pichia pastoris, and screen the Pichia yeast engineering that manganese peroxidase gene expression construct, lignin peroxidase gene expression construct and laccase gene are expressed framework that contains that obtains the high copy reorganization of expression vector by the resistance on its expression vector; Above-described Pichia yeast engineering is applied to the lignin of degrading plant.
2. according to the method for the described a kind of lignin with the Pichia yeast engineering degrading plant of claim 1, it is characterized in that: utilize the described method of claim 1 to prepare the product of Pichia yeast engineering of the lignin of degrading plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201310134638 CN103233382A (en) | 2013-04-03 | 2013-04-03 | Method for degrading plant lignin by using pichia pastoris engineered bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201310134638 CN103233382A (en) | 2013-04-03 | 2013-04-03 | Method for degrading plant lignin by using pichia pastoris engineered bacteria |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103233382A true CN103233382A (en) | 2013-08-07 |
Family
ID=48881446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201310134638 Pending CN103233382A (en) | 2013-04-03 | 2013-04-03 | Method for degrading plant lignin by using pichia pastoris engineered bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103233382A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152390A (en) * | 2014-07-31 | 2014-11-19 | 上海交通大学 | Engineering strain based on lignin metabolism channel key enzyme and implementation method thereof |
| CN104630256A (en) * | 2014-12-24 | 2015-05-20 | 上海交通大学 | Construction and application of ganoderma manganese peroxidase pichia pastoris gene engineering strain |
| CN115448902A (en) * | 2022-10-18 | 2022-12-09 | 浙江清华长三角研究院 | Method for extracting flavone and glucan in rice straw |
-
2013
- 2013-04-03 CN CN 201310134638 patent/CN103233382A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152390A (en) * | 2014-07-31 | 2014-11-19 | 上海交通大学 | Engineering strain based on lignin metabolism channel key enzyme and implementation method thereof |
| CN104630256A (en) * | 2014-12-24 | 2015-05-20 | 上海交通大学 | Construction and application of ganoderma manganese peroxidase pichia pastoris gene engineering strain |
| CN115448902A (en) * | 2022-10-18 | 2022-12-09 | 浙江清华长三角研究院 | Method for extracting flavone and glucan in rice straw |
| CN115448902B (en) * | 2022-10-18 | 2023-08-08 | 浙江清华长三角研究院 | Method for extracting flavone and glucan from rice straw |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN104781414B (en) | Method for obtaining 1-kine trisaccharide | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| CN109321586A (en) | Recombinant Aspergillus niger Glucose Oxidase optimization gene and its expression vector and application | |
| CN103233382A (en) | Method for degrading plant lignin by using pichia pastoris engineered bacteria | |
| CN108977401A (en) | Using the method for lignocellulosic culture microalgae | |
| JP7388195B2 (en) | Trichoderma reesei mutant strain and protein production method | |
| CN103233025A (en) | Method for combined degradation of plant lignin by using pichia pastoris engineered bacteria | |
| CN112513249B (en) | Mutant strain of trichoderma filamentous fungus and method for producing protein | |
| CN108118006A (en) | A kind of heatproof zytase kluyveromyces marxianus engineered strain and its application | |
| CN108220218B (en) | Microbial strain modified by kinase gene with phosphorylation function and application thereof | |
| CN103205403A (en) | Method for producing ligninolytic enzymes | |
| WO2020018905A1 (en) | Materials and methods for creating strains of saccharomyces cerevisiae that exhibit an increased ability to ferment oligosaccharides | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN104831574A (en) | Method of degrading lignin of plants with engineering bacteria of saccharomyces cerevisiae | |
| CN108865914B (en) | Recombinant saccharomyces cerevisiae strain capable of degrading lignocellulose and application thereof | |
| CN105820966B (en) | Efficient chitosanase producing strain and fermentation method thereof | |
| CN103131718A (en) | Cloning of hypertonicity-resistant functional gene CgHog1 from Candida glycerinogenes and application thereof | |
| CN102747063A (en) | Xylose isomerase producing method | |
| JP7400468B2 (en) | Trichoderma filamentous fungus mutant strain and protein production method | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN103562216A (en) | Enhanced fermentation of cellodextrins and beta-D-glucose | |
| DK2844731T3 (en) | MUSHROOM CELLS WHICH MAKE REDUCED QUANTITIES OF PEPTAIBOLS | |
| CN103215284A (en) | Method for jointly decomposing plant lignin through bacillus subtilis engineering bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130807 |