CN108220218B

CN108220218B - Microbial strain modified by kinase gene with phosphorylation function and application thereof

Info

Publication number: CN108220218B
Application number: CN201810106983.5A
Authority: CN
Inventors: 薛闯; 杜广庆; 张萌
Original assignee: Dalian University of Technology
Current assignee: Dalian University of Technology
Priority date: 2018-02-02
Filing date: 2018-02-02
Publication date: 2021-09-14
Anticipated expiration: 2038-02-02
Also published as: CN108220218A

Abstract

The invention discloses a clostridium transformed by kinase gene with phosphorylation function and application thereof; the method is a method for improving the yield of butanol by modifying a kinase gene with a phosphorylation function, and particularly, the kinase (including histidine kinase, serine kinase and threonine kinase) gene with the phosphorylation function in clostridium is knocked out, so that the expression of downstream genes is regulated. After the kinase gene with phosphorylation function is knocked out or over-expressed, the butanol yield of the mutant strain is obviously changed relative to the wild strain, and some kinases participate in sporulation and cell morphology change, so that the clostridium cell is kept in a high-activity state, and the butanol synthesis capacity of the cell is improved. The clostridium with phosphorylation function modified by kinase gene has good application prospect in butanol production.

Description

Microbial strain modified by kinase gene with phosphorylation function and application thereof

Technical Field

The invention belongs to the technical field of microbial engineering, and particularly relates to clostridium with phosphorylation kinase gene modification and a method for improving the yield of butanol through phosphorylation kinase gene modification.

Background

Butanol is an important chemical raw material and is also a novel biological energy source. Compared with ethanol, butanol has the advantages of high energy density, small vapor pressure, small corrosiveness, convenient pipeline transportation, and capability of being mixed with gasoline at any ratio without vehicle modification (Biotechnology Advances,2013,31:1575 1587). Butanol is produced by fermentation of clostridium, and the butanol concentration at the end of the fermentation is usually not more than 2.0% (w/v) because the fermentation product butanol has strong toxicity inhibition effect on the strains. With the rapid development of molecular biology technology, the molecular modification of clostridium for producing butanol is the most fundamental method for improving the economy of butanol production by biological methods. At present, the genetic modification of clostridium butyricum is mainly focused on researching metabolic pathway genes, the highest butanol concentration reported is 17.2g/L, and a new target gene needs to be searched for further increasing the butanol concentration when a bottleneck is met.

Kinases are enzymes that catalyze protein phosphorylation reactions, and are mainly involved in the signal transduction process of cells to regulate complex vital activities. In eukaryotes, kinases mainly include serine kinases, threonine kinases and tyrosine kinases, while in prokaryotes, histidine kinases mainly constitute a two-component signal transduction system with corresponding regulatory proteins. Kinases having a phosphorylation function are widely found in clostridium acetobutylicum, clostridium beijerinckii, clostridium saccharobutyricum, clostridium glycoacetate, clostridium ljungdahlii and the like. For example, C.acetobutylicum contains 35 histidine kinases, 2 serine kinases and 3 serine/threonine kinases. These kinases with phosphorylation function can transfer phosphate groups in clostridium to activate downstream proteins, thus having a possible regulation effect on the physiological metabolism of clostridium and also having an influence on the synthesis of clostridium metabolites. At present, no research reports the influence of kinases with phosphorylation functions such as serine/threonine on the product synthesis regulation function of clostridium acetobutylicum.

Disclosure of Invention

The invention relates to a clostridium with phosphorylation function modified by kinase gene, which modifies the kinase coding gene with phosphorylation function in the clostridium to regulate cell metabolism and butanol anabolism so as to change butanol yield. The Clostridium used is Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii), Clostridium glycoacetate (Clostridium saccharoperbutylacetonicum), Clostridium saccharobutyricum (Clostridium saccharobacteriobutylicum), Clostridium ljungdahlii (Clostridium saccharoperbutyricum), and other Clostridium, and particularly, a method for regulating the cell metabolism and the solvent synthesis metabolism of the Clostridium by modifying a kinase coding gene (selected from cac3319, cac0323, cac0903, cac2730, cac0437, cac0404, cac1728, cac2400, cac0579 or cac1235) with a phosphorylation function in the Clostridium, thereby providing a method for regulating the synthesis of butanol by modifying the phosphorylation kinase gene with the phosphorylation function. The unique point of the invention is that the regulation and control of single or multiple kinases with phosphorylation functions on the cell metabolism, solvent synthesis and stress tolerance of clostridium are studied systematically, and the regulation and control effect of the kinases with phosphorylation functions is enhanced through high-density fermentation.

The invention realizes the purpose of regulating and controlling the synthesis of butanol by modifying histidine kinase coding genes cac3319, cac0323, cac0903, cac2730 and cac0437, serine kinase coding genes cac0579 and cac1235, and serine/threonine kinase coding genes cac0404, cac1728 and cac2400 in clostridium and regulating and controlling the expression of downstream genes mainly comprising sporulation related genes, stress resistance genes, cell metabolism related genes and solvent synthesis genes. The modification method specifically comprises the step of knocking out or over-expressing a kinase gene cac3319, cac0323, cac0903 or cac1728 with a phosphorylation function in clostridium.

In the above technical solutions, preferably, the modified method is to knock out the phosphorylated functional kinase gene cac3319 in Clostridium acetobutylicum, and the example is related to the Clostridium acetobutylicum (Clostridium acetobutylicum) ATCC 55025. In the process of producing butanol by fermenting cells, the cell shape is always a rod-shaped structure, the solvent producing period is not expanded, and the terminal fermentation period is not autolysis.

In the above technical solution, preferably, the method for modifying is to simultaneously knock out phosphorylated functional kinase genes cac3319 and cac0323 in clostridium acetobutylicum, so that the double-kinase inactivated clostridium acetobutylicum prepared by the method has a further improved fermentation butanol yield compared with the single kinase gene knock-out. In the process of producing butanol by fermenting cells, the cell shape is always a rod-shaped structure, the solvent producing period is not expanded, and the terminal fermentation period is not autolysis.

In the above-described embodiments, preferably, the knock-out of the phosphorylation kinase gene of the present invention is performed by a gene interruption technique using a class II intron.

In the above-mentioned embodiments, the preferred vectors for knock-out of group II introns are pSY6, pMTL007, etc.

In the above-mentioned technical solution, preferably, the insertion site of the group II intron into the target gene is the first 30% sequence on the target gene fragment.

In the above technical scheme, preferably, the vector for gene overexpression is pIMP1-thl, PMTL82151 and the like.

In another aspect of the invention, the application of clostridium acetobutylicum described above is disclosed, wherein the kinase gene cac3319 with phosphorylation function in the clostridium acetobutylicum is knocked out; or knocking out the acetone butanol clostridium with phosphorylation kinase gene cac3319 and cac0323 with double-kinase inactivation in the acetone butanol clostridium, and performing high-density fermentation by using a fiber bed reactor, thereby further improving the yield of butanol.

In the above technical scheme, preferably, the fermentation process adopts a conventional method for culturing, the fermentation temperature is 35-42 ℃, the fermentation time is 30-100h, and the pH variation control range in the fermentation process is 4.2-6.2.

In the above technical solutions, the pH during fermentation is preferably controlled to 5.0-6.2. The pH regulation is realized by automatically adding alkaline solution, NaOH and NH₄OH and the like can be used.

In the above technical solution, preferably, the histidine kinase-inactivated strain of the present invention is subjected to high-density fermentation to enhance the regulation of kinase having phosphorylation function, thereby further increasing the concentration of the fermentation end point solvent. The cell fixing material used in the high-density fermentation is selected from wood block, ceramic, sponge, towel, resin, activated carbon, zeolite, etc.

Drawings

FIG. 1A is a map of plasmid pSY6 comprising a class II intron vector; FIG. 1B is a schematic illustration of class II intron insertion; FIG. 1C is the results of colony PCR validation;

FIG. 2 is a map of gene overexpression plasmid pIMP1-thl

FIG. 3A shows butanol production by wild type strain ATCC55025 and phosphorylated functional kinase inactivated strain; FIG. 3B shows butanol production by the strain containing the empty plasmids pIMP1-thl and cac0323 overexpression

FIG. 4 is a scanning electron micrograph of the wild strain ATCC55025 and the cac3319 mutant strain at different fermentation times;

FIG. 5 is a graph of fermentation kinetics for the wild strain ATCC55025 and the cac3319 and cac0323 double knockout strains;

FIG. 6 is a graph of the kinetics of high density fermentation for the cac3319 and cac0323 double knock-out strains.

Detailed Description

The present invention will be described in further detail with reference to specific embodiments.

In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and materials, reagents and the like used are all available from biological or chemical companies.

The cell metabolism condition is characterized by cell morphological change and cell lysis state, and is particularly characterized by a field emission scanning electron microscope.

Example 1

The embodiment comprises the following steps:

(1) vector construction

Gene knockout: the pSY6 plasmid containing the II-type intron is used as a vector, as shown in figure 1A, an intron fragment in the vector is modified through overlap extension PCR so as to have the function of specifically recognizing the target gene, and a target site is inserted so as to block the expression of the target gene, as shown in figure 1B. Overlap extension PCR primers were designed by the "Clostron" website (www.clostron.com) and predicted for insertion sites in the gene to be knocked out according to algorithms published in the literature (Journal of Molecular Biology,2004,336: 421-. The first round of PCR was performed using primers IBS and EBS univarial to amplify intron fragment 1, primers EBS1d and EBS2 to amplify intron fragment 2, reaction system and reaction conditions are shown in Table 2, the second round of PCR was performed using intron fragment 1 and intron fragment 2 as templates to amplify the whole intron fragment, reaction system and conditions are shown in Table 3, and PCR products were purified using AxyPrep PCR clean kit. The purified PCR product and pSY6 plasmid were digested with BsrGI and XhoI restriction enzymes in the system shown in Table 4, the digested pSY6 plasmid was purified using AxyPrep DNA gel recovery kit, and the purified plasmid fragment and intron fragment were ligated by ligase in the system shown in Table 5. The ligation product is introduced into escherichia coli for amplification, and a small amount of kit of AxyPrep plasmid DNA is used for extracting plasmids for sequencing verification. And (3) completing the construction of the recombinant plasmid, transferring the recombinant plasmid into escherichia coli for methylation reaction, and extracting the plasmid for later use.

Over-expression of the gene: PCR was carried out using Clostridium acetobutylicum ATCC55025 genomic DNA as a template and cac0323-OS and cac0323-OA as primers (primer sequences are shown in Table 1), the reaction system and reaction conditions are shown in Table 6, the purified PCR product and pIMP1-thl (FIG. 2) plasmid were digested with restriction enzymes, the restriction enzymes were replaced with EcoRI and SmaI, the other plasmids were shown in Table 4, the digested pIMP1 plasmid was purified using AxyPrep DNA gel recovery kit, the purified plasmid fragment and cac0323 gene fragment were ligated by ligase, the ligation plasmid and fragment were replaced with pIMP1-thl and cac0323 fragments, and the other plasmids were shown in Table 5. The ligation product is introduced into escherichia coli for amplification, and a small amount of kit of AxyPrep plasmid DNA is used for extracting plasmids for sequencing verification. And (3) completing the construction of the recombinant plasmid, transferring the recombinant plasmid into escherichia coli for methylation reaction, and extracting the plasmid for later use.

TABLE 1 primer sequences used in this example

TABLE 2 first round PCR reaction System and reaction conditions

TABLE 3 second round PCR reaction System and reaction conditions

TABLE 4 digestion system

TABLE 5 ligation reaction System

TABLE 6PCR reaction System and reaction conditions

(2) Construction of kinase gene modified strain with phosphorylation function

Culturing in CGM activating culture medium under anaerobic condition, OD₆₀₀0.4-0.6C C.acetobutylicum cell culture, centrifuging at 4000rpm for 10min, removing the supernatant, adding 30mL of ice-chilled ETM buffer (280mM sucrose, 0.6mM Na)₂HPO₄，4.4mM NaH₂PO₄，9mM MgCl₂) Resuspending, standing for 10min, centrifuging at 4000rpm for 10min, removing supernatant, adding 2.5mL ET buffer (280mM sucrose, 0.6mM Na)₂HPO₄，4.4mM NaH₂PO₄) Resuspending to prepare competent cells, adding 190 μ L of competent cells into methylated plasmid, mixing, ice-bathing, transferring the mixture of competent cells and plasmid into 0.2cm electric rotating cup for electric transformation, adding CGM culture solution, mixing, adding into the same volume of culture medium, culturing at 37 deg.C, coating 150 μ L of culture solution on CGM agar culture medium with erythromycin resistance, selecting single colony for colony PCR verification, selecting mutant bacteria with type II intron fragment insertion target gene, the PCR product of strain without intron insertion is about 500bp, and the PCR product of strain with intron insertion is 17 bpAround 00bp, as shown in FIG. 1C. And then, the positive colonies are passaged on a non-resistant CGM (China general microbiological culture Collection center) plate until the resistance is lost, so that the kinase inactivation strain without the anti-activity marker and with the phosphorylation function is obtained.

TABLE 7 primer sequences used in this example

Primer and method for producing the same	Sequence (5 '-3')
		cac3319-F	GGGATAGCTTTATTGGTACTG
cac3319-R	GCTTTGAATAGACTCCACAC
		cac0323-F	GGTCGTTACATTAAGGTATGG
cac0323-R	CCATAAGGGTACTACTTAAGGC
		cac0903-F	CTTGATTTTAACTGCCGGA
cac0903-R	AATAGAATTTGGTTGCCGC
		cac2730-F	CCAATGAGCTTTTGACAGTAG
cac2730-R	CACATAACTACTGCCTACTTCC
		cac0404-F	ATGGTGAAAAGTGATATC
cac0404-R	GATATCACTTTTCACCAT
		cac1728-F	TTTAAATCGTCATGTGGCTG
cac1728-R	CCCTGTGCTTGTTCTGGCGAT

Example 2

Method for producing butanol by fermenting kinase-inactivated strain with phosphorylation function

The embodiment mainly comprises the following steps: the seed culture medium is CGM culture medium, before the CGM culture medium is used, introducing nitrogen to remove oxygen for 20min, then sterilizing at 121 deg.C for 15min, cooling to room temperature, and inoculating 2mL histidine kinase inactivated bacteria preserved in refrigerator at-80 deg.C. Culturing at 37 deg.C for 16-20h, inoculating P2 fermentation medium, performing anaerobic fermentation in a fermentation tank, introducing nitrogen gas to remove oxygen before the fermentation medium is used, fermenting at 37 deg.C and stirring at 150rpm, and automatically adding 50% (v/v) ammonia water to control pH of the fermentation solution to be above 5.0 when pH of the fermentation solution is below 5.0. And sampling at regular time to detect the concentration of the thalli and the content of the solvent.

CGM culture medium: each liter of the culture medium contains 20g of glucose, 2g of yeast powder, 4g of tryptone, 0.5g of monopotassium phosphate, 0.5g of dipotassium phosphate, 2.2g of ammonium acetate and a mineral mixture. Wherein the mineral mixture comprises: each liter of culture medium contains 0.1g of 7 hydrated magnesium sulfate, 0.015g of 7 hydrated ferrous sulfate, 0.015g of 2 hydrated calcium chloride, 0.01g of 1 hydrated manganese sulfate, 0.02g of cobalt chloride and 0.002g of zinc sulfate.

P2 fermentation medium: each liter of culture medium contains 80g of glucose, 1g of yeast powder, 0.5g of monopotassium phosphate, 0.5g of dipotassium phosphate, 2.2g of ammonium acetate, mineral mixture and vitamins. Wherein the mineral mixture comprises: each liter of culture medium contains 0.2g of 7 hydrated magnesium sulfate, 0.01g of 7 hydrated ferrous sulfate, 0.01g of 1 hydrated manganese sulfate and 0.01g of sodium chloride; the composition of the vitamins is as follows: each liter of culture medium contains 0.001g of p-aminobenzoic acid, 0.00001g of vitamin B10.001g and 0.00001g of biotin.

Acetone, butanol and ethanol were detected by conventional gas chromatography. Glucose, acetic acid and butyric acid were detected by conventional liquid chromatography.

As shown in FIG. 3A, the butanol yield of the starting strain ATCC55025 was 11.1g/L, the kinase genes cac0903, cac0323, cac3319 and cac1728 with phosphorylation were knocked out, and the butanol yields were respectively increased to 16.4g/L, 14.6g/L, 12.1g/L and 14.7g/L, which were respectively increased by 47.7%, 31.5%, 9.0% and 32.4% compared with the starting strain; as shown in FIG. 3B, the over-expression of kinase gene cac0323 with phosphorylation increased the butanol yield to 15.2g/L, which was 27.7% higher than the no-load control butanol yield of 11.9 g/L. The fermentation result shows that the butanol yield can be improved by modifying a kinase gene with phosphorylation function.

Example 3

Cellular morphology detection of kinase-inactivated strains with phosphorylation

The morphological changes of the cells of the starting strain ATCC55025, cac3319 knockdown bacteria and cac0437 knockdown bacteria were observed by scanning electron microscopy. The method comprises the following specific steps of obtaining materials: in the acid production period (8h), the conversion period from acid production to solvent production (16h), the solvent production period (32h) and the decay period (72h), 4mL of fermentation culture solution is taken and centrifuged at 8000rpm for 5min, the supernatant is discarded, the solution is washed with 0.1mol/L PBS for 10min, and the steps are repeated for 3 times; fixing: after cleaning, centrifuging, removing supernatant, immediately adding 2.5% glutaraldehyde for fixing for more than 2 h; cleaning: washing with 0.1mol/L PBS for 10min, and repeating the step for 3 times; and (3) dehydrating: treating the sample with 50%, 70%, 90% and 95% tert-butanol for 10min respectively, and then treating the sample with pure tert-butanol for 10min, wherein the step is repeated for 3 times; and (3) drying: putting the sample immersed in the pure tert-butyl alcohol and the tert-butyl alcohol into a refrigerator at 4 ℃ to freeze the liquid tert-butyl alcohol into a solid state, putting the solid state into a filter flask for vacuumizing to sublimate the tert-butyl alcohol, and drying the sample; spraying gold: adhering a sample on a sample table, and spraying gold in an ion sputtering instrument; and finally observing through a field emission scanning electron microscope.

The scanning electron microscope results of the clostridium cells are shown in fig. 4, when the fermentation is carried out for 8h and 16h, the wild strains and the histidine kinase inactivated strains do not have obvious changes on cell morphology, when the fermentation is carried out for 32h, the wild strains show typical intermediate swelling morphological changes, when the acetone butanol clostridium is considered to have typical cell morphology changes in a solvent producing period, and when the fermentation is carried out for 72h, a dissolved hole appears on the cell surface, and the cell autolysis phenomenon is obvious. And cac3319 knockdown bacteria cells do not present a swelling state, and autolysis does not occur after fermentation is finished, so that the histidine kinase inactivated strain is always kept in a high-activity state in the whole fermentation period, and a basis is provided for the high butanol synthesis capacity of the histidine kinase inactivated strain.

Example 4

Fixed fermentation of cac3319 and cac0323 double-knock-out degerming fiber bed reactor

Using cac3319 knockout bacteria as starting strains, knocking out cac0323 expression to obtain dual knockout bacteria of cac3319 and cac0323, and performing batch fermentation and immobilized fermentation, wherein the batch fermentation is as in example 3, and the immobilized fermentation is as follows: performing a batch fermentation of Clostridium acetobutylicum according to conventional procedure, growing the cells to OD₆₀₀At the maximum, the bacterial solution was circulated in the fermentor and fiber bed reactor at a flow rate of 0.5L/min, and a towel supported by a steel wire mesh was installed inside the fiber bed reactor to fix the clostridial cells. After reacting for 2h, completely pumping the fermentation liquor in the reaction system, then adding a fresh P2 culture medium, circulating for 24h, pumping the fermentation liquor in the reaction system again, and adding a fresh P2 culture medium for high-density fermentation. And sampling at regular time to detect the concentration of the thalli and the content of the solvent.

The results of batch fermentation with cac3319 and cac0323 double knock-out bacteria are shown in FIG. 5, and the yields of acetone, butanol and ethanol are respectively increased to 6.8g/L, 18.2g/L and 3.7g/L, which is 64.0% higher than that of the original strain ATCC 55025. The results of high-density fermentation by cac3319 and cac0323 double knock-out bacteria are shown in FIG. 6, the yields of acetone, butanol and ethanol are further increased to 8.9g/L, 20.7g/L and 3.0g/L, the total solvent yield reaches 32.6g/L, and compared with the original strain ATCC55025, the yield of butanol is increased by 86.5%. It is shown that the tolerance of cac3319 and cac0323 double knock-out bacteria to solvent and the solvent synthesis ability are both significantly improved under the condition of high-density cells. By simultaneously knocking out kinase genes cac3319 and cac0323 with phosphorylation functions, the yield of butanol breaks through the bottleneck of 20g/L in immobilized fermentation, and technical support is provided for further realizing industrialization of producing butanol by microbial fermentation.

Claims

1. The clostridium is modified by a kinase gene with phosphorylation function, and is characterized in that the clostridium modifies the kinase coding gene with phosphorylation function to regulate and control butanol anabolism so as to change the yield of butanol;

the modified kinase genes are selected from cac0323, cac0903 and cac 1728.

2. The clostridium with phosphorylation function engineered by kinase gene according to claim 1, wherein the clostridium is clostridium acetobutylicum (clostridium acetobutylicum) ((clostridium acetobutylicum))Clostridium acetobutylicum) Clostridium beijerinckii (Clostridium beijerinckii），Clostridium saccharoperbutylacetonicumClostridium saccharobutyricum (C.), (Clostridium saccharobutylicum) Or Clostridium ljungdahlii: (Clostridium ljungdahlii)。

3. The clostridium of claim 1 or 2, wherein the clostridium is modified by knocking out the kinase genes cac0323, cac1728 and/or cac0903 with phosphorylation function in clostridium acetobutylicum or overexpressing the kinase gene cac0323 with phosphorylation function in clostridium acetobutylicum.

4. The clostridium of claim 3, wherein the clostridium is modified by knocking out or over-expressing a kinase gene cac0323 with phosphorylation function or knocking out cac1728 with phosphorylation function in clostridium acetobutylicum, and the yield of butanol is improved in the fermentation process of the clostridium cells for producing butanol.

5. The clostridium with phosphorylation function modified by kinase gene according to claim 3, wherein the method for modifying is to knock out the kinase genes cac3319 and cac0323 with phosphorylation function in clostridium acetobutylicum, and the clostridium cell has a rod-shaped structure all the time in the process of producing butanol by fermentation, and has no expansion in the solvent producing period and no autolysis at the end of fermentation.

6. The use of the clostridium with phosphorylation function modified by kinase gene according to claim 5, wherein the clostridium acetobutylicum of claim 5 is used for high-density fermentation in a fiber bed reactor, and the yield of butanol is further improved.

7. The use of claim 6, wherein the fermentation temperature is 35-42 ℃, the fermentation time is 30-100h, and the pH is 4.2-6.2.

8. The use according to claim 6, wherein the cell fixing material used in the high density fermentation is at least one selected from the group consisting of wood block, ceramic, sponge, towel, resin, activated carbon, zeolite.